Insect muscle actin promoter

10426147 ยท 2019-10-01

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a gene expression system, suitable for expression in an insect, comprising an insect muscle actin promoter operably linked to a marker gene, which overcomes or ameliorates one or more of: cost of rearing; amount of handling; errors in identification due to human error or loss of marker by the insect; and health concerns related to the effects of marker powders on workers in mass rearing facilities.

Claims

1. A polynucleotide expression system, comprising: a polynucleotide sequence encoding a fluorescent marker; and an insect muscle actin promoter comprising a nucleic acid sequence that is at least 95% identical as the nucleic acid sequence set forth in SEQ ID NO: 1, 5, or 6, operably linked to the polynucleotide sequence.

2. The polynucleotide expression system of claim 1, wherein the fluorescent marker is selected from the group consisting of green fluorescent protein (GFP), EGFP, ZsGreen, TurboGFP, AcGFPI, yellow fluorescent protein (YFP), mCitrine, DsRed, DsRed2, DsRed-Express, DsRed monomer, mCherry, mStrawberry, mRaspberry, mPlum, AmCyan, CyPet, tdTomato, AsRed2, and/or E2-Crimson.

3. The polynucleotide expression system of claim 1, further comprising an enhancer operably linked to the promoter.

4. The polynucleotide expression system of claim 1, further comprising a 5 untranslated region (UTR) and/or a 3 UTR for the polynucleotide sequence.

5. The polynucleotide expression system of claim 4, wherein the 3 UTR is from an insect muscle actin gene.

6. The polynucleotide expression system of claim 5, wherein the 3 UTR is from the insect muscle actin gene of Mexfly.

7. The polynucleotide expression system of claim 1, further comprising a transgene, wherein expression of the fluorescent marker in an insect indicates the presence of the transgene or a trait associated with the transgene in the insect.

8. The polynucleotide expression system of claim 1, wherein expression of the fluorescent marker in an insect is inducible, repressible, and/or derepressible.

9. An insect comprising, in its genome, the polynucleotide expression system of claim 1.

10. A method, comprising: transforming an insect with the polynucleotide expression system of claim 1.

11. The method of claim 10, further comprising detecting fluorescence due to expression of the fluorescent marker in at least two developmental stages selected from the group consisting of the egg, larval, pupal, and adult developmental stages of the insect.

12. The method of claim 11, wherein the fluorescence is visible to the naked eye at the larval, pupal, and adult stages of the insect.

13. The method of claim 10, further comprising detecting fluorescence due to expression of the fluorescent marker in at least two body segments of the insect.

14. The method of claim 13, wherein the body segments are selected from the group consisting of the head, thorax, and abdomen.

15. The method of claim 10, wherein the polynucleotide expression system confers no detectable fitness disadvantage on an insect when the fluorescent marker is expressed in the insect.

16. The method of claim 10, further comprising detecting fluorescence with the naked eye.

17. The method of claim 10, wherein the insect is of the order Diptera or Lepidoptera.

18. The method of claim 10, wherein the insect is of the family Culicidae, Tephritidae, or Bombycidae.

19. The method of claim 10, wherein the insect is selected from the group consisting of: Aedes aegypti, Aedes albopictus, Anopheles stephensi, Anopheles albimanus, Anopheles gambiae, Medfly, Mexfly, Oriental fruit fly, Olive fruit fly, Melon fly, Natal fruit fly, Cherry fruit fly, Queensland fruit fly, Peach fruit fly, Caribbean fruit fly, West Indian fruit fly, codling moth, silk worm, pink bollworm, diamondback moth, Gypsy moth, Navel Orange Worm, Peach Twig Borer, rice stem borer, a moth of the family Noctuidae, and a moth of the subfamily Heliothinae.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) The accompanying Figures serve to illustrate the present invention.

(2) FIG. 1 shows the DNA sequence of the Mexfly Muscle actin promoter and 5UTR region used in construct #4014;

(3) FIG. 2 is a plasmid map of #4104, showing a map of the Mexfly muscle actin promoter (MexMuAc pro) construct containing: MexMuAc promoter driving DsRed2 fluorescent protein; known transformation marker, Hr5IE1-zsgreen; piggy bac ends for transformation into insect cells; bacterial origin of replication (puC ori) and ampicillin resistance gene (bla (amp[R]) for growth and selection in Escherichia coli;

(4) FIG. 3 shows the DNA sequence of the Bombyx mori muscle action promoter (BmA1) fragment (SEQ ID NO: 5);

(5) FIG. 4 is a plasmid map of #4143;

(6) FIG. 5 is a plasmid map of #4247;

(7) FIG. 6 shows the DNA sequence of Aedes aegypti muscle actin promoter fragment (SEQ ID NO: 6);

(8) FIG. 7 is a plasmid map of #4133;

(9) FIG. 8 shows the DNA sequence of 5 UTR (including truncated intron in lower case) of #4133 (SEQ ID NO: 14);

(10) FIG. 9 shows the DNA sequence of ZsGreen of #4133 (SEQ ID NO: 18);

(11) FIG. 10 shows the DNA sequence of DsRed 2 of #4014 (SEQ ID NO: 19);

(12) FIG. 11 shows the DNA sequence of Sv40 3 UTR (SEQ ID NO: 20); and

(13) FIG. 12 shows the DNA sequence of Mexfly muscle actin 3 UTR (SEQ ID NO: 21).

DETAILED DESCRIPTION OF THE INVENTION

(14) Systems of the present invention may be used in order to express any suitable marker protein. For the sake of convenience, such marker proteins will frequently be referred to as fluorescent proteins herein, but it will be appreciated that any such reference includes reference to all suitable marker proteins, unless otherwise apparent from the context.

(15) Expression of a fluorescent protein is desirable for several applications including (i) identification of transgenics in the process of transformation, (ii) identifying the presence of the transgene in laboratory strains and experiments, (iii) identifying the presence of the transgene in released insects and their descendants, e.g. following trapping.

(16) The expression should be strong so as to be readily scored, e.g. against background, or in older specimens (e.g. which have been dead for some time before scoring). The expression should ideally be in most, or all, body parts and developmental stages, so that presence can be determined in all or most life cycle stages and in incomplete or damaged specimens. Yet expression, especially strong expression, may impose undesirable fitness penalties, such as those driven by cytoplasmic actin promoters, as explained above, or weak expression. Accordingly, it is desirable to restrict expression to a single tissue. This should improve fitness unless the tissue happens to be particularly sensitive to expression.

(17) Muscle fits the above criteria. Muscle promoters make strong candidates for such expression given that muscle tissue is ample in any organism both spatially and temporally. Furthermore, it is possible to systematically identify, by homology, highly expressed muscle-specific proteins, which are the structural proteins of muscles. We have identified such a muscle promoter and shown that it does indeed give very strong, clear expression of a fluorescent reporter in two tephritid fruit flies, and in moths, Plutella xylostella and pink bollworm. Moths in general, and these species in particular, are a preferred target insect in which the system is expressed.

(18) It is preferred to distinguish between muscle actin and non-muscle, or cytoplasmic actin, which is found in essentially every cell and which, therefore, tends to have much broader expression in terms of tissue and cell types. A further benefit of tissue-specific expression, rather than constitutive expression, is that expression in different tissues can, in principle, be scored independently. Moreover, it is preferred to distinguish between muscle actin and indirect flight muscle actin (Allen M L, Christensen B M 2004). Expression of indirect flight muscle actin is substantially restricted to the indirect flight muscle. Consequently, it is expressed in fewer body regions, essentially just the thorax, and in fewer developmental stages, being late larvae, pupae and possibly through into adults, than conventional muscle actins. As noted above, restricted spatial expression markers make it ineffective for field monitoring purposes, as trapped insects may lose significant part of their bodies in a trap, resulting in misidentification and recording of the caught insects in a control programme.

(19) Accordingly, in some embodiments, the indirect flight muscle actin is excluded, especially Act88F from Drosophila.

(20) There are various muscle actin promoters in some insects, so the invention preferably provides those that express across at least two, and preferably 3, or even all, life cycle stages, which is clearly an advantage for detection, for instance. Thus, any two of egg, larval, pupal or adult expression is preferred, and preferably consecutive stages. In addition to, or in combination with, any of theses, it is also preferred that that expression is across at least two and preferably all body segments of an insect, being the head, thorax and abdomen. It is particularly preferred that the expression is seen in all, or at least the abdomen and/or thorax, body sections in adults.

(21) Surprisingly, despite widespread and strong expression of the fluorescent protein conferred by the muscle actin promoter, we have found that no fitness disadvantage was conferred on the transgenic insect. Thus, the gene expression system of the present application obviates the need for the use of dyes or powders and alleviates the disadvantages associated with these methods, including those of adverse health effects on the handlers and the possibilities of human error.

(22) As such, it is preferred that expression of the marker gene, e.g. a fluorescent protein, under the control of the muscle actin promoter is sufficiently strong that the transgenic individuals are easily recognizable. This is particularly the case if they are recognisable by the naked eye. Ideally, this will be at all, or two or 3, of the larval, pupal and, in some cases, adult stages. It is also preferred that the expression, preferably strong expression, of the marker gene, such as fluorescent protein, confers little or no fitness disadvantage, preferably such that little or no the effects of the transgene are observed in any of the transgenic strains.

(23) Actin is a globular multi-functional protein that forms microfilaments. It is present in all eukaryotic cells at high concentrations. In muscle fibres, actin comprises 20% of total cellular protein by weight. Actin has been one of the most highly conserved proteins throughout evolution, because it interacts with a large number of other proteins. It has 80.2% sequence conservation at the nucleotide level between Homo sapiens and Saccharomyces cerevisiae, and 95% conservation of the primary structure of the protein product. Although most yeasts have only a single actin gene, higher eukaryotes, in general, express several isoforms of actin encoded by a family of related genes. Mammals have at least six actin isoforms coded by separate genes, which are divided into three classes, alpha, beta and gamma, according to their isoelectric points. In general, alpha actins are found in muscle, whereas beta and gamma isoforms are prominent in non-muscle cells. Although the amino acid sequences and in vitro properties of the isoforms are highly similar, these isoforms cannot completely substitute for one another in vivo (Perrin and Ervasti, 2010).

(24) Considering the high expression of muscle actin in eukaryotic organisms, indicative of strong promoter sequences, and the conserved nature of the genes involved, we decided to identify and utilise these promoters as potential transformation markers with reliable field properties; i.e. sustainable fluorescent expression in dead tissue. To this end, the muscle actin promoter from the Mexican fruit fly, Anastrepha ludens, was identified and isolated as described in the example below. It should be noted that there will often be more than one muscle actin gene in an insect genome. A person skilled in the art would recognise that any variant of the muscle actin promoter may be used with the gene expression system described herein.

(25) The marker may also be considered to be a reporter.

(26) The gene expression system may also comprise further genes (i.e. polynucleotide sequences for expression, e.g. of a transgene), the expression of the marker serving to indicate the presence of that transgene or its associated trait in an individual. This may be used as an indicator of successful transformation, or of the inheritance of the transgene in the progeny of a transformant (i.e. in an insect line).

(27) Expression of the marker protein can be used to allow the assessment of the degree of inclusion of a transgene, or other effector, into the population. This has several advantages, including that, like any such marker, it identifies the presence of the transgene, so one can follow inheritance. The more tightly the marker is linked to the trait of interest e.g. a lethal system, the less likely it is that mutations occur which inactivate one but not the other. In practice, though, if the marker and transgene are on the same inserted DNA segment, then this is extremely unlikely in any case.

(28) The polynucleotides making up the present expression system may be DNA, RNA or a mixture of both.

(29) The system may be inducible or it may be repressible. Suitable examples exist in the art, including GAL4-UAs or the tet-on or tet-off systems, described for instance in our RIDL PCT publication mentioned hereinabove. Expression of the marker gene may therefore be induced or de-repressed, for instance by removal of tetracycline from the environment, such as the diet, of the insect.

(30) In a further aspect, a method of quality control is hereby provided, comprising expressing the present expression system in a target group of individuals and determining whether those individuals meet expected criteria such as size, number, developmental stage or localisation. For instance, if the marker gene is a reporter such as a fluorescent protein, then the individuals where expression from the system occurs will become visible under suitable wavelengths of light. This method may further comprise inducing or de-repressing expression of the present expression, for instance as mentioned above, so that the individuals where expression from the system has been induced or de-repressed will become visible under suitable wavelengths of light.

(31) Although cytoplasmic actin promoters have been used in the past as transformation markers (see above and below), this is the first use of a muscle actin promoter being used for a similar purpose. Furthermore, we have successfully utilised the same plasmid, #4014, FIG. 2, in two different Tephritids; the Mediterranean fruit fly, C. capitata, and the Olive fly, B. oleae, with similar transgenic insect phenotypes and levels of DsRed2 expression. To our surprise, expression of the DsRed2 fluorescent protein under the Mexfly muscle actin promoter is so strong that transgenic individuals are easily recognizable by the naked eye at all larval, pupal and in some cases adult stages. Moreover, despite the strong DsRed2 expression, no adverse effects of the transgene have been encountered in any of the lines we have generated so far; strains have been kept in our laboratories for more than 2 years. OX4676 was also used in both species.

(32) We have tested Medfly adults containing either the IE1-Hr5 or polyubiquitin promoter sequences driving fluorescent proteins, in various simulated trapping conditions, under a number of different temperature and humidity environments, and found that although both markers express well in dead tissue for a week, the accuracy of identification between a transgenic and wild type insects drops considerably after longer periods on a trap. However, fluorescence was identified accurately in the same experiment, after a month in a trap, in Medfly individuals carrying the Mexfly-muscle actin promoterDsRed2 plasmid, #4014, FIG. 2. Furthermore, in the latter case, Medflies did not require removal from the trap, which is usually required, as commonly used yellow sticky traps exhibit quite a strong colouring under various excitation filters.

(33) Owing to the conserved nature of the actin genes, similar, or the same, muscle actin promoters may be used other insects, for example Lepidoptera, coleopterans and mosquito species, with minimal genetic manipulation. We have also isolated a muscle actin promoter from Bombyx mori, and have prepared a gene expression system comprising the same. This gene expression system was tested in Pink Bollworm (Example 5). The results were comparable to Medfly individuals transformed with #4014 construct. Moreover, we have also isolated a muscle actin promoter from Aedes aegypti based on homology to published genome sequence.

(34) Particularly preferred is a muscle actin promoter from Bombyx Mori or Aedes Aegypti, and most preferably from Mexfly.

(35) A muscle actin promoter from other species may also be used and, in some embodiments, the origin of the promoter will tally with the species in which it is expressed (i.e. the species to be transformed). In other embodiments, a muscle actin promoter from one species may be used for expression of the fluorescent protein in another species. That other species may be in the same class (i.e. another insect), but more preferably in the same order or family, and most preferably in the same genus as the organism to be transformed.

(36) As such, a muscle actin promoter may be isolated from any insect, preferably from the order Diptera or the order Lepidoptera.

(37) More preferably, the muscle actin promoter may be from a Culicidae and, most preferably, from a mosquito, preferably from the genera Stegomyia, Aedes, Anopheles or Culex. Particularly preferred are Stegomyia aegyptae, also known as Aedes aegypti, Stegomyia albopicta (also known as Aedes albopictus), Anopheles stephensi, Anopheles albimanus and Anopheles gambiae.

(38) It is also preferable that the muscle actin promoter is from a Tephritid, preferably from Medfly (Ceratitis capitata), preferably from Mexfly (Anastrepha ludens), preferably from Oriental fruit fly (Bactrocera dorsalis), Olive fruit fly (Bactrocera oleae), Melon fly (Bactrocera cucurbitae), Natal fruit fly (Ceratitis rosa), Cherry fruit fly (Rhagoletis cerasi), Queensland fruit fly (Bactrocera tyroni), Peach fruit fly (Bactrocera zonata) Caribbean fruit fly (Anastrepha suspensa) or West Indian fruit fly (Anastrepha obliqua). Medfly (Ceratitis capitata), Mexfly (Anastrepha ludens), or Olive fruit fly (Bactrocera oleae) are particularly preferred.

(39) Within Lepidoptera, moths are particularly preferred, including codling moth (Cydia pomonella), and the silk worm (Bombyx mori), the pink bollworm (Pectinophora gossypiella), the diamondback moth (Plutella xylostella), the Gypsy moth (Lymantria dispar), the Navel Orange Worm (Amyelois transitella), the Peach Twig Borer (Anarsia lineatella) and the rice stem borer (Tryporyza incertulas), also the noctuid moths, especially Heliothinae.

(40) The muscle actin promoter is also preferably from Drosphila melanogaster. Most preferably, it is that provided in SEQ ID NOS: 5 or 6 and most preferably SEQ ID NO: 1 or variants of any thereof.

(41) Gene expression systems of the present invention, comprising a muscle actin promoter from the any of the above organisms, may be expressed in a range of insects.

(42) It is preferred that the gene expression system is capable of expression in Dipterans and most preferably Tephritids, Medfly (Ceratitis capitata), Mexfly (Anastrepha ludens), preferably Oriental fruit fly (Bactrocera dorsalis), Olive fruit fly (Bactrocera oleae), Melon fly (Bactrocera cucurbitae), Natal fruit fly (Ceratitis rosa), Cherry fruit fly (Rhagoletis cerasi), Queensland fruit fly (Bactrocera tyroni), Peach fruit fly (Bactrocera zonata) Caribbean fruit fly (Anastrepha suspensa) or West Indian fruit fly (Anastrepha obliqua).

(43) Where a list of options is provided herein, such as the list of insect types in which it is preferred that the systems of the present invention can be expressed, it will be appreciated that the present invention contemplates each member of that list individually, as well as being part of that group.

(44) It is also particularly preferred that the gene expression system is capable of expression in a mosquito, preferably from the genera Stegomyia, Aedes, Anopheles or Culex. Particularly preferred are Stegomyia aegyptae, also known as Aedes aegypti, Stegomyia albopicta (also known as Aedes albopictus), Anopheles stephensi, Anopheles albimanus and Anopheles gambiae.

(45) Expression in Lepidoptera is also preferred, especially moths, including codling moth (Cydia pomonella), and the silk worm (Bombyx mori), the pink bollworm (Pectinophora gossypiella), the diamondback moth (Plutella xylostella), the Gypsy moth (Lymantria dispar), the Navel Orange Worm (Amyelois transitella), the Peach Twig Borer (Anarsia lineatella) and the rice stem borer (Tryporyza incertulas), also the noctuid moths, especially Heliothinae.

(46) In a further aspect, expression may be in a beneficial insect. A beneficial insect, in the context of the present invention, is, for example, a pollinator and/or is a predator or parasitoid, parasite suitable for controlling agricultural or horticultural pests. Especially preferred are bees, including honeybees, bumblebees and other pollinators. Some bees are pollinators, whilst others are predators or act as parasites. Thus, predatory or parasitic bees and wasps may also be preferred beneficials. Another preferred group of beneficials are ladybugs. The preferred beneficial can also be selected from the group consisting of: Minute Pirate Bugs; Big Eyed Bugs; Assassin Bugs; Damsel Bugs; Mealybug Destroyer; Soldier Beetle; Green Lacewing; predatory mites, e.g. Amblyseius swirskii, Phytoseulius persimilis, Typhlodromus pyri and Amblyseius fallacis, Syrphid Fly; Tachinid Fly; Ichneumon wasps, e.g. Aphidius spp., Aphelinid Wasps, e.g. Encarsia spp. and Trichogramma wasps.

(47) It is particularly preferred that the gene expression system comprises a muscle actin promoter from Bombyx mori or Aedes aegypti, and most preferably from Mexfly, and can be expressed in any of the above insects.

(48) However, it will also be appreciated that any combination of the various promoters discussed herein can be used in any of the insects discussed herein. One particularly preferred example is the use of a muscle actin promoter from Bombyx mori or Aedes aegypti, and most preferably from Mexfly in Tephritids, especially fruit flies. Another particularly preferred example is the use of a muscle actin promoter from Bombyx mori or Aedes aegypti, and most preferably from Mexfly in mosquitoes, especially Aedes, including Aedes aegypti. Another particularly preferred example is the use of a muscle actin promoter from Bombyx mori or Aedes aegypti, and most preferably from Mexfly in moths, especially Bombyx mori or Plutella xylostella.

(49) Another particularly preferred example is the use of a muscle actin promoter from Bombyx mori or Aedes aegypti, and most preferably from Mexfly in Medfly (Ceratitis capitata). Another particularly preferred example is the use of a muscle actin promoter from Bombyx mori or Aedes aegypti, and most preferably from Mexfly in Olive fly (Bactrocera oleae). Another particularly preferred example is the use of a muscle actin promoter from Bombyx mori or Aedes aegypti, and most preferably from Mexfly in Pink Bollworm.

(50) The insect in which the present system is expressed may be referred to as a transformant, or may be considered to be the progeny thereof, or as a host. The insect may be a pest, for instance a disease vector, for instance a mosquito species that may carry the malarial parasite or act as a vector for dengue fever, or an agricultural pest, for instance moths or flies, especially fruit flies.

(51) The system described herein is suitable for expression in an insect, but it will be understood that this may also be preferably referred to as capable of expression in or adapted to or having the ability to express in an insect. It is preferable that insects are transformed with the gene expression system by injection into embryos.

(52) Plasmids, or other suitable vectors, may be used as vehicles for the expression systems of the present invention, and may be introduced into the population by any suitable transformation means known in the art.

(53) A promoter is typically understood to be a region of DNA sufficient to initiate transcription of a gene, and should preferably include features such as promoter elements such as transcription factor and RNA polymerase binding sites. It may comprise further regulatory elements such as enhancers, and extended regions of DNA for 5 and 3 UTRs which enhance expression of the gene. The skilled person would be able to assess which features are necessary for improved expression of the gene. A particularly preferred 3 UTR is the 3 UTR of the muscle actin gene from Anastrepha ludens.

(54) When a muscle actin promoter is referred to as being isolated from, taken from or simply from a particular species, it will be understood that it does not necessarily mean that the particular DNA is derived from an organism belonging to that species. Instead, it will be understood that it means that the DNA sequence is largely, or completely, identical to that found in the genome of the wildtype of that species. The extraction or isolation may have occurred in the past and may have been used in the transformation of the host insect's ancestors.

(55) The gene expression system comprises a muscle actin promoter operably linked to a marker gene. In this context, it will be understood that this means that the promoter is suitable or capable of driving transcription of the marker gene. It is generally preferred that they are situated substantially adjacent each other and not separated by more than 3 or 4 kbp.

(56) By gene herein is meant principally a sequence encoding an effector. In this case, the effector is largely a protein so as to function as a marker, as required, generally so as to express a detectable marker. Preferably, the marker is a protein, which confers a detectable change in phenotype of the insect.

(57) A marker gene is a gene used to determine if a nucleic acid sequence has successfully transformed an organism such that it is being expressed. The nucleic acid sequence may, for example, encode a functional protein which causes sterility in an insect. The marker gene may be considered as a screening marker as opposed to a selectable marker, which may protect the organism from a selective agent that would normally kill it or prevent its growth, such antibiotic. A marker for screening will cause the cells containing the marker gene to appear different to those that, for instance, have not been transformed or which do not contain the transgene. A preferred example of a screening marker is a fluorescent protein, such as GFP.

(58) As such, it is preferable that the marker gene of the expression system described herein encodes a fluorescent protein. It is particularly preferred that the fluorescent protein is a green fluorescent protein (GFP), ZsGreen, TurboGFP, yellow fluorescent protein (YFP), mCitrine, DsRed, DsRed2, mCherry, AmCyan, CyPet and other members of the GFP-like protein super-family. These proteins are typically derived from marine invertebrates, e.g. anemones, and when expressed emit fluorescence after exposure to bright light of a specific excitation wavelength. Fluorescent proteins are widely used for transgenic research purposes..sup.3

(59) In the red spectrum any of the following are preferred: DsRed-Express, tdTomato, DsRed monomer, AsRed2, mstrawberry, mcherry, mRaspberry, E2-Crimson, or mPlum.

(60) In the green spectrum, either of the following is preferred: EGFP, AcGFP1.

(61) The marker gene may encode other proteins manifesting a phenotype which varies depending on the level of expression. This has the advantage of allowing qualitative or quantitative analysis for screening.

(62) Where reference to a particular nucleotide sequence is made, it will be understood that this includes reference to any mutant or variant thereof, having substantially equivalent biological activity thereto. Preferably, the mutant or variant has at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 99%, preferably at least 99.9%, and most preferably at least 99.99% sequence identity with the reference sequences.

(63) We therefore report a unique marker system and methods for simple and reliable monitoring of released insects in the field that confers significant cost benefits to a SIT control pest programme and requires minimal training of personnel. Released males may also be identified by farmers and workers in the field with the use of a portable lamp with the appropriate excitation wavelengths, eliminating the need for the traps to be transferred to a laboratory facility for careful examination and identification of the trapped insects. Also, the use of such a marker allows for the development of a highly accurate, automated detection and monitoring system based on computer software, which is able to detect the phenotype conferred by the marker gene of the expression system.

EXAMPLES

Example 1

(64) Mexfly Muscle Actin

(65) Mounier et al (1992) compared the sequences of insect muscle and cytoplasmic actins and identified Bm A1 (from Bombyx mori), Dm Act57A and Dm Act87E (both from Drosophila melanogaster) as muscle actins. The cDNA sequences of these 3 genes were aligned using CLUSTALW, and the following degenerate primers designed:

(66) TABLE-US-00001 364)BmA1degF (SEQIDNO:2) GATGTGYGACGAYGATGTTMG 365)BmA1degR (SEQIDNO:3) CTTCTCSAGGGANGTGGAGGCG
which amplify a 718 bp product. These primers were used for PCR on Mexfly adult female cDNA using Phusion polymerase. The resulting PCR product was cloned and sequenced. The sequence (confirmed by BLAST comparison to GenBank sequences) was extended by 5 and 3 RACE in order to obtain the complete mRNA sequence.

(67) The promoter sequences was isolated from the coding sequence of the Mexfly Muscle actin gene using

(68) TABLE-US-00002 453)MexmuflR (SEQIDNO:4) CATTRTCAACRACCARAGCAGCA 454)MexmuFlRn (SEQIDNO:7) CAGCAACATCRTCGTCGCACATC
in adaptor-mediated PCR as follows:

(69) Mexfly genomic DNA was digested with ClaI, BamHI and SphI restriction enzymes. It was ligated to adaptors consisting of an appropriate sticky end for ligation to the digested DNA and primer annealing sites for primers:

(70) TABLE-US-00003 222)PRIMER: (SEQIDNO:8) GTGTAGCGTGAAGACGACAGAA 223)MID (SEQIDNO:9) GACGACAGAAAGGGCGTGGTG.

(71) PCR was carried out on these templates using 222) Primer and 453) MexmuFIR. The resulting PCR product was diluted 1 in 100 then used as a template for nested PCR using primers 223) MID and 454) MexmuFIRn. These PCR products were cloned using the TOPO PCR cloning kit (invitrogen) and sequenced.

(72) Primers

(73) TABLE-US-00004 464)MexmuAcRn2 (SEQIDNO:10) TCACACCGCGCTCATCGTCA 465)MexmuAcRn3 (SEQIDNO:11) CACGTTAATGTTGAGCTGCATGG 466)MexmuAcRn4 (SEQIDNO:12) ATCCGAGCGAGTCAGCAACAAC
were designed from this sequence to use on the same ligated DNA templates using Primer and mid primers as before. This extended the promoter sequence further.

(74) A 2.2 kb sequence incorporating the promoter and 5UTR (untranslated region) (FIG. 1) were cloned in front of the start ATG codon of DsRed2 fluorescent protein (FIG. 10), in a plasmid (#4104, FIG. 2) also containing piggy bac transposon ends and the transformation marker, Hr5IE1-zsgreen. #4104 contains MexMuAc promoter driving DsRed2 fluorescent protein; known transformation marker, Hr5IE1-zsgreen; piggybac ends for transformation into insect cells; Sv40 3 UTR sequence (FIG. 11), bacterial origin of replication (puC ori) and ampicillin resistance gene (bla (amp[R])) for growth and selection in Escherichia coli.

(75) Regarding FIG. 2, OX4676 was used in both species. Others were used for both olive fly and medfly with the single difference that we used 4-ended piggybac constructs for medfly and single ended piggybac constructs for olive fly. Despite the different numbers, all constructs utilised the exact same sequences relating to the transformation marker.

(76) This is the first demonstration of DsRed2 expression under the Mexfly muscle actin promoter. The plasmid utilises a green fluorescent protein (ZsGreen; clontech) under a generic promoter-enhancer sequence; Hr5-IE1 as a transformation marker. As we did not know at that stage whether the isolated DNA sequence upstream of the Mexfly muscle actin gene served as an adequate promoter sequence to drive DsRed2 expression, even more so in another Tephritid; Ceratitis capitata, we thought it best to utilise a promoter sequence known to function well previously to drive the expression of a different fluorescent protein; ZsGreen in order to identify transformed individuals. Both markers utilised the bi-directional SV40 3 UTR previously functional in a number of different insect species.

(77) 530 pre-blastoderm Medfly embryos were injected with a piggybac transposon-transposase mix (600:300 ng/l, respectively). 260 GO adults were back-crossed to wild type of the opposite sex, in pools of 10. Progeny was collected and screened for the presence of both fluorescent proteins. 8 independent insertion events were generated. All lines exhibited green fluorescence under the appropriate excitation wavelength as expected. Furthermore, all lines displayed a strong red expression in all muscle tissue under the appropriate wavelength. Fluorescence was clearly detectable in all developmental stages. No recordable differences were observed among siblings of the same strain, indicating a uniform and ubiquitous expression. Red expression was so strong in most of the strains analysed that a pink hue was clearly visible at mid-late larval and early-mid pupal stages with naked eye; that is transformed individuals were evident with 100% accuracy without the need of a standard microscope equipped with the appropriate excitation filters for the fluorescent protein used (DsRed2 in this particular case), a standard procedure for fluorescent screening. Adult colouration was not apparent in any of these strains. Nevertheless, all adultsat all agesdisplayed a strong red expression when examined under a suitable microscope. Two of these strains were tested in parallel with other Medfly strains utilising Hr5-IE1 and polyubiquitin promoter sequences driving expression of DsRed2, for dead tissue fluorescence sustainability under various trapping methods and simulated environmental conditions and clearly outperformed existing markers.

(78) #4014 Medfly strains have been continuously reared in our premises for over 40 generations without an observable fitness penalty in adult longevity, female egg fecundity, embryo hatching or pupal recovery.

(79) Subsequent sperm-lethal constructs (#4676, #4705 #4751 and #4718) (GB2500113 and WO2013/131920) used the Mexfly muscle actin 3UTR (FIG. 12), which resulted in stronger expression. Therefore, one way of making the Bombyx muscle actin promoter stronger, may be to incorporate its 3UTR into the construct.

Example 2

(80) #4751 (PB-MexMActPro-DsR-tetO21-Prota-SG4-mCh-SG4-FokI-CcBTubPro-tTAV2-Cci-tTAV3)

(81) Given the desirable properties of the Mexfly muscle actin promoter as a transformation marker and monitoring tool, we decided to further utilise this promoter in conjunction with our newly developed sperm lethal technology (GB2500113) In this instance and in all examples following, we have utilised the 3 UTR of the muscle actin gene from Anastrepha ludens. Plasmid #4751 was injected in preblastoderm Medfly embryos as described above. Two different transformation events were attained. Both strains displayed robust red fluorescence under a suitable microscope and a light red phenotype clearly visible with naked eye at larval and pupal stages. In one of the two strains, visible colouration was apparent even at the adult stage, irrespective of the dark exoskeleton processed by this species. This may indicate an improved expression of the fluorescent protein possibly through utilisation of its own UTR sequence. As before, no detrimental effects were observed in either strain for any rearing parameter.

Example 3

(82) OX4676 (PB-Mex-mActin-DsRed-tra-ubi-ZsGreen1)

(83) In most cases, an insect male has the capacity of mating more than one female whilst females of most species usually mate only once in their lifetime. This means that one could exploit double, triple or even multiple the amount of females, compared to the amount of males, in mass-rearing cages to increase egg yield and therefore production of males for release in a cost-effective manner. This is in operation in Medfly mass-rearing factories today, utilising the white pupae mutation associated with the TSL (temperature sensitive lethal) sexing strains; females are white as pupae compared to males that display the normal brown pupal phenotype. Nevertheless, the white pupae mutation or any other phenotypic mutation that can be used in a similar way has to be isolated, characterised and cloned separately for all insect pests that SIT can be applied to, a laborious and costly procedure.

(84) Development of differential fluorescent expression in males and females is a far less strenuous, affordable and thus widely applicable way of achieving similar outcomes in a number of different insect species of interest, with none or minimal manipulation among species. To investigate this possibility, we have developed construct #4676 where the Mexfly muscle actin promoter drives expression of DsRed2 in males and females but also drives expression of ZsGreen in females only. For female specificity, we have utilised the same sex specific alternative splicing described and patented prior to this experiment (PCT/GB2007/000488). Insertion of a cassette exon from the C. capitata transformer gene between the DsRed2 and ZsGreen DNA sequences means that the ZsGreen transcript is disrupted in male splice variants but not in the female-specific ones.

(85) This construct has been injected in Medfly and Olive fly pre-blastoderm embryos. 4 independent insertion events were generated in Medfly and 7 in olive fly. Males and females of all strainsboth speciesexhibited the red fluorescent phenotype, while females only of all strains displayed the green fluorescent phenotype under the appropriate excitation filters. In other words, transposition of this construct to two different Tephritids resulted in the expected phenotype. Nevertheless, none of the strains displayed the strong fluorescent expression seen previously with this promoter. This could be the result of a very long and thus unstable transcript being produced which may comprise expression levels. Furthermore, green fluorescence was sometimes hard to detect in females of some strainsespecially in Medfly, possibly due to positional effects.

Example 4

(86) #4705 (PB MexMActPro-DsR-tetO21-Prota-mCh-FokI-CcBTubPro-tTAV2)

(87) This is a single piggybac construct utilising our novel sperm lethal technology discussed in Example 2 in combination with our unique transformation marker promoter from A. ludens. The transposon was co-injected with piggybac transposase mRNA (600: 500 ng/l) into preblastoderm olive fly embryos. Ten independent transgenic strains were generated all displaying a very strong and ubiquitous fluorescent phenotype under a suitable microscope and different hues of red colouring in larvae and pupae.

Example 5

(88) Bombyx mori Muscle Actin

(89) BmA1 promoter was identified by BLAST of the published coding sequence against the published Bombyx mori genomic sequence (whole genome sequencing project: http://silkbase.ab.a.u-tokyo.ac.jp/cgi-bin/index.cgi). A 2.58 kb fragment 5 of the gene was amplified as the promoter fragment, from Bombyx mori genomic DNA (FIG. 3).

(90) Using plasmid DNA amplified and purified by Midiprep or MaxiPrep, DNA mixes were prepared to a final concentration of 500 ng/l and 300 ng/l of construct and helper plasmid (making piggybac transposase), respectively, after final re-suspension in injection buffer. 1467 embryos were injected with this construct (#4143, FIG. 4), resulting in 238 survivors and 1 line. The green fluorescence was observed in transgenic insects.

(91) Construct #4143 (FIG. 4) consists of Bombyx mori BMA1 muscle actin promoter driving zsgreen fluorescent protein; known transformation marker Baculovirus OPIE2 promoter driving DsREd2; PB transposon ends for transformation into insects; bacterial origin of replication (pUC on) and ampicillin resistance gene (bla AmpR) for growth and selection in E. coli.

(92) Construct #4247 was also injected (FIG. 5). The only difference between this and #4143 (FIG. 4) is that there are an extra 340 nucleotides at the beginning of the promoter (5 end) and it also includes 66 bp comprising the 5UTR at the 3 end of the promoter (which should make the promoter much more efficient). 1945 embryos were injected with this construct resulting in 588 survivors.

Example 6

(93) Aedes aegypti Muscle Actin

(94) Similarly, the published genome sequence from Aedes aegypti (http://aaegypti.vectorbase.org/) was searched using BLAST for homology to the Mexfly Muscle actin gene. This identified Aedes Actin1 as the muscle actin gene. This gene has a large intron in the 5UTR (FIG. 8), which was truncated in the construct (#4133, FIG. 7). The promoter (FIG. 6) was amplified in two fragments using the following primer pairs:

(95) TABLE-US-00005 723)AemuAcproAscF (SEQIDNO:_13) GGCGCGCCGTTCGAGCAGTAGACCCACCAACC 724)AemuAcintSphR (SEQIDNO:_14) GCATGCTATGCCTTAGGAAGCCCTGCCG 725)AemuAcintSphF (SEQIDNO:_15) GCATGCCGTATATCGAGTGGCAAGCTCGAAG 726)AemuAcproNheR (SEQIDNO:_16) GCTAGCCAACCGTCTATTCGCATAGTACAATTCC.

SEQUENCES

(96) SEQ ID NO: 1MexFly muscle actin promoter and 5 UTR region used in construct #4014

(97) SEQ ID NO: 2BmA1degF Primer

(98) SEQ ID NO: 3BmA1degR Primer

(99) SEQ ID NO: 4453) MexmufIR

(100) SEQ ID NO: 5Bombyx mori muscle actin promoter

(101) SEQ ID NO: 6Aedes aegypti muscle actin promoter

(102) SEQ ID NO: 7454) MexmuFIRn

(103) SEQ ID NO: 8222) PRIMER

(104) SEQ ID NO: 9223) MID

(105) SEQ ID NO: 10464) MexmuAcRn2

(106) SEQ ID NO: 11465) MexmuAcRn3

(107) SEQ ID NO: 12466) MexmuAcRn4

(108) SEQ ID NO: 13723) AemuAcproAscF

(109) SEQ ID NO: 14724) AemuAcintSphR

(110) SEQ ID NO: 15725) AemuAcintSphF

(111) SEQ ID NO: 16726) AemuAcproNheR

(112) SEQ ID NO: 175UTR (including truncated intron in lower case) of #4133

(113) SEQ ID NO: 18 DNA sequence for ZsGreen of #4133

(114) SEQ ID NO: 19DNA sequence for DsRed2 of #4014

(115) SEQ ID NO: 20 Sv40 3 UTR Sequence

(116) SEQ ID NO: 21Mexfly muscle actin 3 UTR sequence

REFERENCES

(117) Allen, M., Handler, A., Berkebile, D., and Skoda, S. (2004). piggyBac transformation of the New World screwworm, Cochliomyia hominivorax, produces multiple distinct mutant strains. Med. Vet. Entomol., 18, pp. 1-9.

(118) Allen, M., O'Brochta, D., Atkinson, P., and Levesque, C. (2001). Stable, germ-line transformation of Culex quinquefasciatus (Diptera: Culicidae). J. Med. Entomol., 38(5), pp. 701-710.

(119) Allen, M., Christensen, B., (2004) Flight muscle-specific expression of act88F: GFP in transgenic Culex quinquefasciatus Say (Diptera: Culicidae). Parasitology International, 53, pp. 307-314.

(120) Alphey, L., Nimmo, D., O'Connell, S., and Alphey, N. (2008). Insect population suppression using engineered insects, in S. Aksoy, (ed.), Transgenesis and the management of vector-borne disease. Austin, Tex., Landes Bioscience, pp. 93-103.

(121) Bakri, A., Mehta, K., and Lance, D. R. (2005). Sterilizing insects with ionizing radiation, in V. A. Dyck, J. Hendrichs, and A. S. Robinson, (eds.), Sterile Insect Technique. Principles and practice in area-wide integrated pest management. The Netherlands, Springer, pp. 233-268.

(122) Berghammer, A. J., Klingler, M., and Wimmer, E. A. (1999). A universal marker for transgenic insects. Nature, 402(6760), pp. 370-1.

(123) Burn, T., Vigoreaux, J., and Tobin, S. (1989). Alternative 5C actin transcripts are localized in different patterns during Drosophila embryogenesis. Developmental Biology, 131(2), pp. 345-355.

(124) Catteruccia, F., Benton, J., and Crisanti, A. (2005). An Anopheles transgenic sexing strain for vector control. Nature Biotechnology, 23(11), pp. 1414-1417.

(125) Catteruccia, F., Godfray, H. C., and Crisanti, A. (2003). Impact of genetic manipulation on the fitness of Anopheles stephensi mosquitoes. Science, 299(5610), pp. 1225-7.

(126) Catteruccia, F., Nolan, T., Loukeris, T., Blass, C., Savakis, C., Kafatos, F., and Crisanti, A. (2000). Stable germline transformation of the malaria mosquito Anopheles stephensi. Nature, 405(6789), pp. 959-962.

(127) Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., and Prasher, D. C. (1994). Green fluorescent protein as a marker for gene expression. Science, 263(5148), pp. 802-805.

(128) Dyck, V. A., Hendrichs, J., and Robinson, A. S. (2005). Sterile Insect Technique: Principles and practice in Area-Wide Integrated Pest Management. City: Springer: The Netherlands, pp. 801.

(129) Franz, G. (2002). Recombination between homologous autosomes in medfly (Ceratitis capitata) males: type-1 recombination and the implications for the stability of genetic sexing strains. Genetica, 116, pp. 73-84.

(130) Fraser, M. J., Jr. (2012). Insect Transgenesis: Current Applications and Future Prospects. Annual Review of Entomology, 57(1), pp. 267-289.

(131) Graham, H. M., and Mangum, G. L. (1971). Larval diets containing dyes for tagging pink bollworm. J Econ Entomol, 64, pp. 377-379.

(132) Hagler, J., and Jackson, C. (2001). Methods for marking insects: current techniques and future prospects. Annu. Rev. Entomol., 46, pp. 511-543.

(133) Hagler, J. R., and Miller, E. (2002). An alternative to conventional insect marking procedures: detection of a protein mark on pink bollworm by ELISA. Entomol Exp Appl, 103(1), pp. 1-9.

(134) Handler, A., and Harrell, R. (2001). Polyubiquitin-regulated DsRed marker for transgenic insects. BioTechniques, 31, pp. 820-8.

(135) Handler, A., and Harrell, R. A. I. (1999). Germline transformation of Drosophila melanogaster with the piggyBac transposon vector. Insect Mol Biol, 8, pp. 449-457.

(136) Horn, C., Schmid, B., Pogoda, F., and Wimmer, E. (2002). Fluorescent transformation markers for insect transgenesis. Insect Biochem Mol Biol, 32(10), pp. 1221-35.

(137) Irvin, N., Hoddle, M. S., O'Brochta, D. A., Carey, B., and Atkinson, P. W. (2004). Assessing fitness costs for transgenic Aedes aegypti expressing the GFP marker and transposase genes. Proc Natl Acad Sci USA, 101(3), pp. 891-6.

(138) Knipling, E. (1955). Possibilities of insect control or eradication through the use of sexually sterile males. J Econ Entomol, 48, pp. 459-469.

(139) Koukidou, M., Klinakis, A., Reboulakis, C., Zagoraiou, L., Tavernarakis, N., Livadaras, I., Economopoulos, A., and Savakis, C. (2006). Germ line transformation of the olive fly Bactrocera oleae using a versatile transgenesis marker. Insect Molecular Biology, 15(1), pp. 95-103.

(140) Loukeris, T. G., Livadaras, I., Arca, B., Zabalou, S., and Savakis, C. (1995). Gene transfer into the medfly, Ceratitis capitata, with a Drosophila hydei transposable element. Science, 270(5244), pp. 2002-5.

(141) Marrelli, M. T., Moreira, C. K., Kelly, D., Alphey, L., and Jacobs-Lorena, M. (2006). Mosquito transgenesis: what is the fitness cost? TRENDS Parasit, 22(5), pp. 197-202.

(142) Matz, M., Fradkov, A., Labas, Y., Savitsky, A., Zaraisky, A., Markelov, M., and Lukyanov, S. (1999). Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol, 17(10), pp. 969-73.

(143) Morrison, N. I., Franz, G., Koukidou, M., Miller, T. A., Saccone, G., Alphey, L. S., Beech, C. J., Nagaraju, J., Simmons, G. S., and Polito, L. C. (2011). Genetic improvements to the sterile insect technique for agricultural pests. Asia Pacific J Mol Biol and Biotechnol, 18(2), pp. 275-295.

(144) Mounier, N., Gouy, M., Mouchiroud, D., and Prudhomme, J. C. (1992). Insect muscle actins differ distinctly from invertebrate and vertebrate cytoplasmic actins. J Mol Evol, 34(5), pp. 406-415.

(145) Papathanos, P., Bossin, H., Benedict, M., Catteruccia, F., Malcolm, C., Alphey, L., and Crisanti, A. (2009). Sex separation strategies: past experience and new approaches. Malaria Journal, 8(Suppl 2), pp. S5.

(146) Parker, A. (2005). Mass-rearing for sterile insect release, in V. A. Dyck, J. Hendrichs, and A. S. Robinson, (eds.), Sterile Insect Technique. Principles and practice in area-wide integrated pest management. The Netherlands, Springer, pp. 209-232.

(147) Peloquin, J. J., Thibault, S. T., Staten, R., and Miller, T. A. (2000). Germ-line transformation of pink bollworm (Lepidoptera: Gelechiidae) mediated by the piggyBac transposable element. Insect Mol Biol, 9(3), pp. 323-33.

(148) Perera, O., Harrell, R., and Handler, A. (2002). Germ-line transformation of the South American malaria vector, Anopheles albimanus, with a piggyBac-EGFP tranposon vector is routine and highly efficient. Insect Molecular Biology, 11(4), pp. 291-7.

(149) Perrin, B. J., and Ervasti, J. M. (2010). The actin gene family: Function follows isoform. Cytoskeleton, 67(10), pp. 630-634.

(150) Pinkerton, A., Michel, K., O'Brochta, D., and Atkinson, P. (2000). Green fluorescent protein as a genetic marker in transgenic Aedes aegypti. Insect Molecular Biology, 9(1), pp. 1-10.

(151) Prasher, D. C., Eckenrode, V. K., Ward, W. W., Prendergast, F. G., and Cormier, M. J. (1992). Primary structure of the Aequorea victoria green-fluorescent protein. Gene, 111(2), pp. 229-233.

(152) Robinson, A. (2002). Mutations and their use in insect control. Mutation Research, 511, pp. 113-32.

(153) Robinson, A., and van Heemert, C. (1982). Ceratitis capitataa suitable case for genetic sexing. Genetica, 58(3), pp. 229-237.

(154) Robinson, A. S., and Hendrichs, J. (2005). Prospects for the future development and application of the sterile insect technique, in V. A. Dyck, J. Hendrichs, and A. S. Robinson, (eds.), Sterile Insect Technique. Principles and practice in area-wide integrated pest management. The Netherlands, Springer, pp. 727-760.

(155) Rssler, Y. (1979). The genetics of the Mediterranean fruit fly: a white pupae mutant. Annals of the Entomological Society of America, 72, pp. 583-585.

(156) Rubin, G. M., and Spradling, A. C. (1982). Genetic transformation of Drosophila with transposable element vectors. Science, 218(4570), pp. 348-53.

(157) Steiner, L. Methods of estimating the size of populations of sterile pest tephritidae in release programs. Presented at Panel proceedings: Insect ecology and the sterile-male techique, Vienna.

(158) Tamura, T., Thibert, C., Royer, C., Kanda, T., Eappen, A., Kamba, M., Komoto, N., Thomas, J.-L., Mauchamp, B., Chavancy, G., Shirk, P., Fraser, M., Prudhomme, J.-C., and Couble, P. (2000). Germline transformation of the silkworm Bombyx mori . using a piggyBac transposon-derived vector. Nat. Biotech., 18, pp. 81-84.