Recombinant protein
10428129 ยท 2019-10-01
Assignee
Inventors
- Wen-Jiun Peng (Hukou Township, Hsinchu County, TW)
- Shu-Ping Yang (Hukou Township, Hsinchu County, TW)
- Hung-Chih Peng (Hukou Township, Hsinchu County, TW)
- Yu-Hung Chen (Hukou Township, Hsinchu County, TW)
Cpc classification
C07K2319/31
CHEMISTRY; METALLURGY
C07K14/59
CHEMISTRY; METALLURGY
International classification
C07K14/59
CHEMISTRY; METALLURGY
Abstract
A recombinant protein is provided. The recombinant protein of the invention comprises an erythropoietin and a highly glycosylated peptide, and has a longer half-life. Further, the recombinant protein of the invention may also comprise a carboxyl-terminal peptide of human chorionic gonadotropin and a carboxyl-terminal peptide of thrombopoietin.
Claims
1. A recombinant protein, comprising an erythropoietin and a highly glycosylated peptide, wherein the highly glycosylated peptide comprises the sequence of SEQ ID NO: 1 and/or 2.
2. The recombinant protein according to claim 1, wherein the carboxy-terminal end of the erythropoietin is attached to the highly glycosylated peptide.
3. The recombinant protein according to claim 1, wherein the amino-terminal end of the erythropoietin is attached to the highly glycosylated peptide.
4. The recombinant protein according to claim 1, further comprising a carboxy terminal peptide of human chorionic gonadotropin.
5. The recombinant protein according to claim 4, wherein the carboxy terminal peptide of human chorionic gonadotropin comprises the sequence of SEQ ID NO: 3.
6. The recombinant protein according to claim 5, wherein the carboxy-terminal end of the highly glycosylated peptide is attached to the carboxy terminal peptide of human chorionic gonadotropin.
7. The recombinant protein according to claim 4, further comprising a carboxy terminal peptide of thrombopoietin.
8. The recombinant protein according to claim 7, wherein the carboxy terminal peptide of thrombopoietin comprises the sequence of SEQ ID NO: 4.
9. The recombinant protein according to claim 7, wherein the carboxy-terminal end of the carboxy terminal peptide of human chorionic gonadotropin is attached to the carboxy terminal peptide of thrombopoietin.
10. The recombinant protein according to claim 1, further comprising a carboxy terminal peptide of thrombopoietin.
11. The recombinant protein according to claim 10, wherein the carboxy terminal peptide of thrombopoietin comprises the sequence of SEQ ID NO: 4.
12. The recombinant protein according to claim 10, wherein the carboxy-terminal end of the carboxy terminal peptide of human chorionic gonadotropin is attached to the carboxy terminal peptide of thrombopoietin.
13. The recombinant protein according to claim 1, wherein the recombinant protein comprises the sequence of SEQ ID NO: 5.
14. The composition comprises the recombinant protein of claim 1 and a pharmaceutically acceptable carrier or adjuvant.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE INVENTION
(6) The present invention provides a recombinant erythropoietin with a long half-life and a manufacture method thereof.
(7) In one embodiment, the present invention provides a recombinant protein comprising an erythropoietin and a highly glycosylated peptide.
(8) As used herein, the phrase erythropoietin (EPO) includes EPO of every origin, especially human or animal EPO. The term used herein encompasses not only the naturally occurring, that is wild-type forms of EPO, but also its derivatives, analogs, modifications, mutants or others, as long as they show the biological effects of wild-type erythropoietin.
(9) Any protein having the activity of EPO, such as muteins or otherwise modified protein, is also encompassed. Recombinant EPO may be prepared via expression in CHO, BHK, COS, HeLa or PER.C6 cell lines or other appropriate cell lines, by recombinant DNA technology and the related content can be referred to U.S. Pat. Nos. 5,733,761, 5,641,670, 5,733,746, 5,994,122, 5,733,761, 5,641,670, 5,981,214 and 5,272,071. Its preparation and therapeutic application can be referred to U.S. Pat. Nos. 5,547,933 and 5,621,080, Huang, S. L., Proc. Natl. Acad. Sci. USA (1984) 2708-2712, as well as Lai, P. H. et al., J. Biol. Chem. 261 (1986) 3116-3121, an Sasaki, H. et al., J. Biol. Chem. 262 (1987) 12059-12076. The preferred species for EPO is human.
(10) As used herein, the phrase highly glycosylated peptide refers to a polypeptide having about 10 to 30 amino acid residues with at least one glycoside. The highly glycosylated peptide of the present invention includes one or more N- or O-linked glycosylation site(s) for producing one or more glycan(s). For example, a sequence of SEQ ID NO: 1 and/or 2, or a sequence having at least 60%, 65%, 70%, and 80% sequence identity to SEQ ID NO: 1 or 2, preferably, 90%, 95%, or 99% sequence identity.
(11) The highly glycosylated peptide is fused with an EPO to form the recombinant protein of the present invention. The highly glycosylated peptide can be located on the N-terminal end (N-ter) or carboxy-terminal end (C-ter) of the EPO, and the number of the highly glycosylated peptide is not limited. For example, one or more the same or different highly glycosylated peptide (s) can be attached to N-terminal end and/or C-terminal end of the EPO. The recombinant protein containing the highly glycosylated peptide has a longer half-life and higher activity. In one embodiment, the highly glycosylated peptide (SEQ ID NO: 1 and/or 2) can be located on the N-ter or C-ter of EPO, as shown in
(12) The highly glycosylated peptide includes, but is not limited to, SEQ ID NO: 1 and/or 2. One or more the same or different highly glycosylated peptide(s) can be attached to the C-ter of EPO. For example, SEQ ID NO: 1 or 2 is attached to the C-ter of EPO; or two or more SEQ ID NO: 1 or 2 are attached to the C-ter of EPO; or SEQ ID NO: 1 and 2 are attached to the C-ter of EPO, sequentially; or SEQ ID NO: 2 and 1 are attached to the C-ter of EPO, sequentially. In another embodiment, SEQ ID NO: 1 and 2 are attached to the C-ter of EPO, sequentially.
(13) The recombinant protein of the present invention further comprises a carboxy terminal peptide of human chorionic gonadotropin (hCG).
(14) As used herein, the phrase carboxy terminal peptide of hCG (hereinafter referred to as CTP) refers to an amino acid sequence found at the carboxy terminus of human chorionic gonadotropin beta subunit which extends from amino acid 112-118 to residue 145 at the C-terminus or to a portion, or a variant or analog thereof, which has equivalent biological activity. The CTP sequence peptide is 28, 29, 30, 31, 32, 33 or 34 amino acids long and commences at position 112, 113, 114, 115, 116, 117, or 118 of the hCG amino acid sequence.
(15) The CTP of the present invention includes, but is not limited to, SEQ ID NO: 3, or a sequence having at least 65%, 70%, 80%, 90% sequence identity to SEQ ID NO: 3, preferably at least 95% sequence identity.
(16) The CTP of the invention may be attached to EPO (at the N-ter or C-ter) and/or the highly glycosylated peptide (at the N-ter or C-ter). The amount of the CTP is not limited. For example, one or more the same or different CTP of hCG can be attached to the N-ter of EPO or C-ter of the highly glycosylated peptide(s) of the invention.
(17) The CTP of the present invention may acts as a protectant against degradation of proteins or peptides. In the present application, the CTP of hCG can extends circulatory half-life of recombinant proteins, and enhances the potency of recombinant proteins.
(18) The invention further comprises a carboxy terminal peptide of thrombopoietin (TPO).
(19) As used herein, the phrase carboxy terminal peptide of thrombopoietin (hereinafter referred to as TpS) refers to amino acids at positions 176 to 353 of thrombopoietin, particularly the amino acids at positions 337 to 353 of thrombopoietin, or a variant or analog thereof, which has equivalent biological activity.
(20) The TpS of the invention includes, but is not limited to, SEQ ID NO:4, or a sequence having at least 65%, 70%, 80%, or 90% sequence identity to SEQ ID NO: 4, preferably at least 95%, or 99% sequence identity.
(21) The TpS of the present invention may be attached to the EPO (at the N-ter or C-ter), the highly glycosylated peptide (at the N-ter or C-ter) and/or the CTP (at the N-ter or C-ter), and the amount of the TpS is not limited. In one embodiment, one or more the same or different TpS can be attached to the N-ter of the EPO or C-ter of the highly glycosylated peptide. In another embodiment, one or more the same or different TpS can be attached to the N-ter of EPO or the C-ter of the CTP.
(22) The TpS of the present application may acts as a protectant against degradation of proteins or peptides derived therefrom. The TpS can extend circulatory half-life of the recombinant proteins, and enhance the potency of the recombinant proteins.
(23) In the present invention, the amount and arrangement of EPO, the highly glycosylated peptide, CTP, and TpS are not limited.
(24) In one embodiment, the recombinant protein of the present invention comprises SEQ ID NOS: 1, 2, 3, and 4.
(25) In another embodiment, the recombinant protein of the present invention may be selected from SEQ ID NO: 5 (EPO-NNCT), 6 (NNCT-EPO), 7 (EPO-N1N2), 8 (N1N2-EPO), 9 (EPO-N1), or 10 (EPO-N2).
(26) The highly glycosylated peptide, CTP, and TpS also can be modified by deletion, substitution, insertion and/or chemical modification. The method and process of the amino acid deletion, substitution, insertion and/or chemical modification are well known in the art, and the highly glycosylated peptide, CTP, and TpS still maintain the original activity after modification.
(27) In one embodiment, modifications include, but are not limited to, N terminus modification, C terminus modification, polypeptide bond modification, such as CH.sub.2NH, CH.sub.2S, CH.sub.2SO, OCNH, CH.sub.2O, CH.sub.2CH.sub.2, SCNH, CHCH, or CFCH, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and can be referred to Quantitative Drug Design, C. A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992).
(28) In one embodiment, the peptide bond (CONH) of the polypeptide can be substituted by, such as, N-methyl bond (N(CH.sub.3)CO), ester bond (C(R)HCOOC(R)N), ketomethylen (COCH.sub.2), -aza bond (NHN(R)CO), where R is any alkyl, hydroxyethylene bond (CH(OH)CH.sub.2), thioamide (CSNH), alkene bonds (CHCH), amide bond (NHCO), or polypeptide derivative (N(R)CH.sub.2CO).
(29) The present invention further provides a polynucleotide encoding the recombinant protein of the present invention.
(30) The phrase a polynucleotide or nucleotide refers to a single or double stranded nucleic acid sequence which be isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a combination of the above.
(31) The polynucleotides of the present invention may be prepared using PCR techniques, or any other method or procedure known to one skilled in the art. The procedure involves the ligation of two different DNA sequences (See, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons, 1992).
(32) The polynucleotides of the invention may be inserted into expression vectors to enable expression of the recombinant protein. In one embodiment, the expression vector includes additional sequences which render this vector suitable for replication and integration in prokaryotes or eukaryotes. In another embodiment, expression vectors comprise transcription and translation initiation sequences (e.g., promoters or enhances) and transcription and translation terminators (e.g., polyadenylation signals).
(33) A variety of prokaryotic or eukaryotic cells can be used as host-expression systems to express the polypeptides of the present invention. In one embodiment, these expression systems include, but are not limited to, microorganisms, such as bacteria, yeast, plant cell, eukaryotes (e.g. mammalian cells, CHO cells), etc.
(34) Methods for transformation can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986], and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors.
(35) The present invention of the invention further provides a composition, comprising the recombinant protein of the invention and a physiologically acceptable carrier or excipient.
(36) The phrases pharmaceutically acceptable carrier or excipient which be interchangeably used refer to a carrier, excipient or adjuvant that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. The carrier comprises, but is not limited to polyethylene glycol (PEG), a biocompatible polymer with solubility in both organic and aqueous media. The excipients include, but are not limited to calcium carbonate, calcium phosphate, various sugars and starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
(37) The composition of the present invention can be used to treat a patient having anemia, an anemic patient having chronic renal insufficiency, an anemic patient having end stage renal disease, an anemic patient undergoing dialysis, an anemic patient having chronic renal failure, an anemic HIV infected patient, an anemic patient having cancer, an anemic patient undergoing chemotherapy, and an anemic patient scheduled to undergo non-cardiac, non-vascular surgery.
(38) After an effective amount of the composition of the present invention is administrated to an anemia patient, the hematocrit (Ht) of anemia patient can be increased significantly, and the recombinant EPO with high glycosylation of the present invention has a longer half-life in a subject. The recombinant EPO with high glycosylation of the present invention has a longer half-life than that of the commercial EPO products (e.g., Eprex and Aranesp). Eprex is the brand name for epoetin alfa (rch), which is recombinant human erythropoietin (EPO) expressed in Chinese hamster ovary cells (rch) and has a 165 amino acid sequence identical to that of human urinary EPO. Aranesp is the brand name for darbepoetin alfa, which is recombinant human erythropoietin (EPO) expressed in Chinese hamster ovary cells and has a 165-amino acid protein that differs from recombinant human erythropoietin in containing 5 N-linked oligosaccharide chains, whereas recombinant human erythropoietin contains 3 chains. For example, the high-glycosylated EPO of the present invention has a half-life at least about 1 time longer than the commercial EPO products, preferably, 2 times, more preferably, 3 times. In another embodiment, the high-glycosylated EPO of the present invention has a longer half-life, a higher AUC (area under curve) and Cmax, and a longer Tmax values than that of the commercial EPO products (e.g., Eprex and Aranesp).
(39) The phrase therapeutically effective generally refers to from about 1 to 10000 I.U./kg, preferably from about 50 to 2000 I.U./kg, more preferably from about 50 to 600 I.U./kg, and most preferably from about 50 to 300 I.U./kg body weight. The formulations of the present invention may be administered at any desired frequency or time interval between administrations. A dosing regimen, the subject is administered the sustained release formulations of the present invention thrice per two weeks, once per week, once per two weeks, once per three weeks, once per month, once per five weeks, once per six weeks, or at more frequent or less frequent intervals, or at any combination of frequencies or time intervals as desired. The dosage required will vary according to a number of factors known to those skilled in the art, including, but not limited to, the compound or compounds used, the species of subject, the size of the subject, and the severity of the associated disease condition that anemia. A preferred dosing regimen may be once per three weeks, particularly for subjects receiving chemotherapy for the treatment of cancer, since many chemotherapeutic regimens are administered on a once per three-week schedule.
EXAMPLES
Example 1
Host Cells
(40) Cells were purchased from the Culture Collection and Research Center (CCRC, 60133) of Food Industry Research and Development Institute, Taiwan. CHO dfhr-cells were cultured in IMDM medium (Isocoves Modified Dulbecco's Medium, IMDM, Gibco Cat. 12200-36) supplemented with 10% fetal bovine serum (Gibco Cat. 10091148) plus hypoxanthine and thymidine (Gibco, Cat. 11067-030) and 2 mM L-glutamine (Gibco Cat. 25030-081). Dhfr() marker was used for amplification and selection. Expression of the dhfr gene could be amplified by challenging with the dihydrofolate reductase inhibitor, methorexate (MTX, Sigma Cat no. M8407). When the dfhr genes were amplified, other neighboring genes often were co-amplified, so that after each round of amplification cells were subcloned to select clones with increased production rates. Cells were cultured in a 37 humified 95% air/5% CO.sub.2 incubator (Model 3326, Forma scientific).
Example 2
Construction of the Expression Vectors
(41) 2.1 EPO-NNCT
(42) EPO-NNCT gene fragment was obtained using assembly PCR method and then inserted into pcDNA3.1/Neo (+)/DHFR vector, yielding pND/EPO-NNCT. The expression vector construct contained the neomycin-resistance gene as a selective marker. EPO-NNCT gene was shown in
(43) 2.2 NNCT-EPO
(44) The DNA fragment of NNCT was reproduced by PCR using LSPNS1 primer (3-cctagggccaccatgggggtgcacgaatgtcctgcctggctgtggcttctcctgtccctgctgtcgctccctctgg-5; SEQ ID NO: 11), LSPNS2 primer (3-ctgtccctgctgtcgctccctctgggcctcccagtcctgggcgaggccgagaatatcacgacgggcggtaac-5; SEQ ID NO: 12), and ENNCT1-A primer (3-ctcggctgtcacagatgaggcgtggtggggccccttcctgagacagattctgggagtgggtgtaggatg-5; SEQ ID NO: 13) from pND/EPO-NNCT plasmid to obtain NNCT-EPO fragment as shown in
(45) 2.3 EPO-N1N2
(46) The DNA fragment of EPO-N1N2 was reproduced by PCR using E-S primer (3-cctagggccaccatgggggtgcacgaatgtcctgcc-5; SEQ ID NO: 14) and ENNCT2-A primer (3-gtatacctacagctgcagagtctcgttcacctgggaagag-5; SEQ ID NO: 15) from pND/EPO-NNCT plasmid to obtain EPO-N1N2 fragment as shown in
(47) 2.4 N1N2-EPO
(48) The DNA fragment of N1N2-EPO was synthesized by GENEWIZ, Inc (as shown in
(49) 2.5 EPO-N1
(50) The DNA fragment of EPO-N1 was reproduced by PCR using E-S primer (3-cctagggccaccatgggggtgcacgaatgtcctgcc-5; SEQ ID NO: 14) and ENNCT4-A primer (3-gtatacctagtctgggacagtgatattctc-5; SEQ ID NO: 16) from pND/EPO-NNCT plasmid as shown in
(51) 2.6 EPO-N2
(52) The DNA fragment of EPO-N2 was obtained by PCR method using E-S primer (3-cctagggccaccatgggggtgcacgaatgtcctgcc-5; SEQ ID NO: 14) and ENNCT5-A primer (3-gtatacctaca gctgcagagtctcgttcacctgggaagagttgaccaacagtctgtcccctgtcctgcaggcctccc-5; SEQ ID NO: 17) from pND/EPO-NNCT plasmid to obtain EPO-N2 fragment as shown in
Example 3
Establishment of the Recombinant Cell Lines
(53) Vector containing EPO-NNCT gene was transfected into CHO dhfr-cells by electroporation (PA4000 PulseAgile electroporator, Cyto Pulse Sciences). Cells were first trypsinized and resuspended at a concentration of 310.sup.6 cells/ml in CP-T buffer (Cyto Pulse Cat. CP-T). 200 l of cell suspension (610.sup.5 cells) was mixed with 10 g pND/BMP2 and electrophoresed. Electrophoresed cells were cultured in a complete medium (IMDM with 10% fetal bovine serum and HT supplement) without selective substance for recovery growth. After 48 hours growth in medium without selective substance, the cells were transferred to the complete medium containing IMDM, 10% fetal bovine serum, L-glutamine and 5 nM MTX, with selective substance. After approximately 2-week culture period, cell lines were transferred to 96-well plates, and cell lines which express high level of rhBMP-2 were selected through quantifying protein level by ELISA. The selected cells were cultured in a selective medium. The cells were diluted to the concentration of 1 cell/100 W and then transferred to a 96-well plate to culture to grow to cell clusters. Cells with high expression level were screened according to the results of ELISA and MTX concentrations were gradually increased from 0.005, 0.01, 0.02 to 0.05 M.
Example 4
Batch Culture
(54) 410.sup.5 cell/ml of recombinant cell line obtained from Example 3 were batch-cultured in 50 ml flask containing serum free medium. Cells were monitored everyday and culture medium was collected to measure the concentration of the EPO and select a high-yield clone under 0.02 M MTX challenge. In spinner culture, the accumulated productivity of EPO-NNCT was 140.69 g/ml as shown in Table 1.
(55) TABLE-US-00001 TABLE 1 Results of batch culture Max. Yield (g/ml) 140.9 Max. cell concentration (10.sup.6 cell/ml) 2.42 IVC (10.sup.6 cell-day) 14.60 q (pg/cell/day) 9.63
Example 5
Bioactivity Assay
(56) The process and procedure of the example were carried out according to the disclosure of European Pharmacopeia 5.2 (Erythropoietini solution concentrata). Female 8-week-old BALB/c mice were classified into two groups, and injected subcutaneously with 21, 42, 84, 168, 336, and 672 ng/ml of EPO-NNCT (SEQ ID NO: 5) of the invention and Eprex, individually. After injection, the 0.25 ml whole blood was collected. After the cells were stained, the cells were analyzed by flow cytometry and CellQuest Pro software, and the results were shown in Table 2. Referring to
(57) TABLE-US-00002 TABLE 2 Amount of Reticulocytes after injection Subcutaneous injection (ng/ml) Reticulocytes (mean %) EPO-NNCT 672 23.15 (SEQ ID 336 19.45 NO: 5) 168 16.14 84 13.17 42 11.47 21 10.52 Eprex 672 15.50 336 14.05 168 11.57
(58) 25 female 8-week-old BALB/c mice were classified into five groups, and injected subcutaneously with 336 ng/ml of EPO-NNCT (SEQ ID NO: 5) and Eprex, individually. The mice whole blood was collected at 4 to 9, and 13 days after injection. The percentage of reticulocyte was determined by flow cytometry and analyzed by CellQuest Pro software. As shown in Table 3, the amount (mean %) of reticulocytes was highest at Day 7 in the mice injected with the EPO-NNCT (SEQ ID NO: 5) of the invention and significantly higher than that of Eprex.
(59) TABLE-US-00003 TABLE 3 Amount of Reticulocytes at different day after injection Reticulocytes Day (Mean %) S.D. CV EPO-NNCT 5 20.33 2.38 11.70 (SEQ ID 6 27.26 1.99 7.29 NO: 5) 7 28.12 2.11 7.51 8 25.42 2.17 8.55 9 16.37 3.09 18.89 13 5.21 0.53 10.19 Eprex 5 11.28 1.56 13.86 6 7.42 0.81 10.97 7 6.35 1.16 18.22 8 11.11 1.22 10.95 9 10.76 2.40 22.31 13 8.61 0.92 10.67
Example 6
Pharmacokinetic Assay
(60) 14 female 8-week-old BALB/c mice were classified into four groups, and intravenously and subcutaneously injected with 2000 IU/kg of EPO-NNCT (SEQ ID NO: 5) of the invention, Eprex, and Aranesp, individually. The mice blood was collected at 5 min, 10 min, 30 min, 1 hr, 2 hr, 5 hr, 8 hr, 24 hr, 30 hr, 48 hr, 72 hr, 96 hr, 120 hr, 168 hr, 216 hr, 264 hr, and 336 hr after injection, centrifuged to obtain the serum, and then the serum was stored at 70 C. The pharmacokinetic assay was carried out using Quantikine IVD Epo ELISA kit to measure the optical density at 450 nm and 600 nm and then analyzed by SoftMax Pro 5 software. The results are shown in Table 4. Referring to
(61) TABLE-US-00004 TABLE 4 Pharmacokinetic properties of EPO-NNCT Tmax half-life (hr) AUC (ng .Math. hr/ml) Cmax (ng/ml) (hr) intravenous injection EPO-NNCT 25.03 8387.44 (n = 2) Aranesp 17.89 5694.75 (n = 2) Eprex 6.35 269.96 (n = 3) subcutaneous injection EPO-NNCT 26.53 4502.90 68.19 24 (n = 2) Aranesp 17.78 2547.34 58.16 24 (n = 2) Eprex 7.14 169.55 6.88 10 (n = 3)
(62) Similarly, compared to Eprex, EPO-N1N2 (SEQ ID NO: 7), N1N2-EPO (SEQ ID NO: 8), and NNCT-EPO (SEQ ID NO: 6) of the present invention also had a longer half-life (21-30 hours), and a higher AUC (Area Under Curve) value (370-981 ng.Math.hr/ml), as shown in Table 5.
(63) Further, EPO-N1 (SEQ ID NO: 9) and EPO-N2 (SEQ ID NO: 10) had a Tmax of about 24 hours. Accordingly, it is known that EPO-N1 (SEQ ID NO: 9) and EPO-N2 (SEQ ID NO: 10) had a higher Tmax as compared to commercial Eprex.
(64) TABLE-US-00005 TABLE 5 Pharmacokinetic properties of EPO-N1N2, N1N2-EPO, NNCT-EPO and Eprex (subcutaneous injection) Tmax half-life (hr) AUC (ng .Math. hr/ml) Cmax (ng/ml) (hr) EPO-N1N2 21.76 370.47 11.77 24 (SEQ ID NO: 7) N1N2-EPO 30.14 448.04 13.78 30 (SEQ ID NO: 8) NNCT-EPO 25.50 981.63 26.18 24 (SEQ ID NO: 6) Eprex 7.14 169.55 6.88 10
(65) Although preferred embodiments are disclosed as above, they cannot be used to limit the preset invention, and anyone skilled in the art can make some changes and modifications without exceeding the spirit and scope of the present invention, and thus the scope of the present invention will be limited only by the appended claims.
SYMBOL DESCRIPTION
(66) EPO: Erythropoietin
(67) N1: Highly glycosylated fragment 1
(68) N2: Highly glycosylated fragment 2
(69) CTP: Carboxy terminal peptide of human chorionic gonadotropin
(70) TpS: Carboxy terminal peptide of thrombopoietin