RECOMBINANT PROTEINS OF PARAPOXVIRUS OVIS AND PHARMACEUTICAL COMPOSITIONS THEREFROM

20190292231 ยท 2019-09-26

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to polynucleotides coding for the PPVO viral genome, to fragments of the polynucleotides coding for the PPVO genome and to polynucleotides coding for individual open reading frames (ORFs) of the PPVO viral genome. The invention also relates to recombinant proteins expressed from the above mentioned polynucleotides and to fragments of said recombinant proteins, and to the use of said recombinant proteins or fragments for the preparation of pharmaceutical compositions.

Claims

1. A method for inducing an immunomodulatory activity in a subject, consisting of administering to the subject an individual recombinant protein encoded by a polynucleotide selected from the group consisting of: (i) a polynucleotide having the sequence consisting of nucleotide residues 31003 to 46845 of SEQ ID NO:1 (PPVO insert of VVOV 96), (ii) a polynucleotide having the sequence consisting of nucleotide residues 24056 to 33789 of SEQ ID NO:1 (PPVO insert of VVOV 97), (iii) a polynucleotide having the sequence consisting of nucleotide residues 82324 to 92502 of SEQ ID NO:1 (PPVO insert of VVOV 243), and (iv) a polynucleotide having the sequence consisting of nucleotide residues 74804 to 88576 of SEQ ID NO:1 (PPVO insert of VVOV 285).

2. The method of claim 1, wherein the immunomodulatory activity results in the induction of interferon-gamma.

3. The method of claim 1, wherein the immunomodulatory activity results in the induction of tumor necrosis factor-alpha.

4. The method of claim 1, wherein the immunomodulatory activity results in the stimulation of MHC-I cross-presentation.

5. The method of claim 1, wherein the recombinant protein is attached to or is a part of a structure selected from the group consisting of: particle-like structure, fusion proteinprotein coated particle, and virus-like particle.

6. A method for inducing an immunomodulatory activity in a subject, consisting of administering to the subject an individual recombinant virus containing a recombinant protein encoded by a polynucleotide selected from the group consisting of: (i) a polynucleotide having the sequence consisting of nucleotide residues 31003 to 46845 of SEQ ID NO:1 (PPVO insert of VVOV 96), (ii) a polynucleotide having the sequence consisting of nucleotide residues 24056 to 33789 of SEQ ID NO:1 (PPVO insert of VVOV 97), (iii) a polynucleotide having the sequence consisting of nucleotide residues 82324 to 92502 of SEQ ID NO:1 (PPVO insert of VVOV 243), and (iv) a polynucleotide having the sequence consisting of nucleotide residues 74804 to 88576 of SEQ ID NO:1 (PPVO insert of VVOV 285).

7. The method of claim 6 wherein the immunomodulatory activity results in the induction of interferon-gamma.

8. The method of claim 6 wherein the immunomodulatory activity results in the induction of tumor necrosis factor-alpha.

9. The method of claim 6 wherein the immunomodulatory activity results in the stimulation of MHC-I cross-presentation.

Description

BRIEF DESCRIPTION OF THE FIGURE

[0083] FIG. 1 shows the genomic locations of the DNA fragments constituting the insertion library. The position of each DNA fragment is shown against the KpnI map of PPVO NZ2 (Mercer, et al., Virology (1997) 229:193-200).

EXAMPLES

Example 1: Determination of the Integrated PPVO Fragments in the Active VVOVs

DNA Preparation from Vaccinia lister/PPVO Recombinants was Performed as Follows

[0084] BK-KL 3A cells were grown to confluency in 175 cm.sup.2 flasks (Becton Dickson Labware, Heidelberg, Germany). Cells were infected with a recombinant Vaccina lister/PPVO virus (VVOV) of Mercer, et al. (Virology (1997) 229:193-200) at a MOI (multiplicity of infection) of 0.01-0.32 and incubated at 37 C. until 100% CPE (cytopathic effect) had been reached. The infected cells were frozen at 80 C., thawed and processed as follows, with modification to the RNA extraction method of Vilcek, et al. (J. Clin. Microbiol. (1994) 32:2225-2231). Using 2 ml PLG Heavy Eppendorf tubes (Eppendorf, Hamburg, Germany) 0.5 ml aliquots of cellular suspension were incubated with 100 g Proteinase K (Roche Molecular Biochemicals, Mannheim, Germany) and 50 l SDS (Sigma-Aldrich, Chemie GmbH, Taufkirchen, Germany) at 56 C. for 25 min. 0.5 ml Roti-Phenol/Chloroform (Carl Roth GmbH, Karlsruhe, Germany) was added and the tubes were inverted for several times. After centrifugation at 12000g for 10 min, the upper phase was transferred into a fresh tube and two volumes of ethanol (Merck Eurolab GmbH, Darmstadt, Germany) and 1/10 volume of sodium acetate (Sigma-Aldrich, Chemie GmbH, Taufkirchen, Germany) was added. The reagents were mixed several times and stored at 80 C. for 3 h. The tubes were centrifuged at 14000g for 30 min, the supernatant was decanted and the pellet was air-dried for 5-10 min. Finally the DNA pellet was resuspended in 30 l nuclease free water and stored at 20 C. until used.

[0085] DNA concentration was measured spectrophotometrically on a BioPhotometer 6131 (Eppendorf, Hamburg, Germany) at 260/280 nm. The DNA yield of different sample preparations spanned from 100 ng/ml up to 1 g/ml.

Polymerase Chain Reaction (PCR) of Terminal Flanking Regions of the Integrated Fragments in the Vaccinia lister/PPVO Recombinants was Performed as Follows

[0086] Three different PCR amplification systems were used for amplifying the terminal flanking regions. Each reaction mixture of 50 l contained 100 ng-1 g resuspended DNA and primers (Table 1)) were added in a final concentration of 300 nM. Amplifications were carried out on a Mastercycler gradient (Eppendorf, Hamburg, Germany).

[0087] The 3-prime flanking region of recombinant VVOV 285 had been analyzed using 2 Ready-Mix PCR Master Mix (1.5 mM MgCl.sub.2) (AB Gene, Hamburg, Germany). 1 l BSA (MBI Fermentas GmbH, St. Leon-Rot, Germany) was added to each reaction. Denaturation was performed at 94 C. for 3 min, followed by 30 cycles (94 C. for 30 s, 58.7 C.-65.3 C. for 30 s, 72 C. for 1 min) and 72 C. for 5 min.

[0088] The 5-prime flanking region of the PPVO insert of recombinant VVOV 285, the 3-prime flanking region of VVOV 97, and both terminal flanking regions of VVOV 215, VVOV 243, VVOV 245 were amplified using PfuTurbo DNA Polymerase (Stratagene, Amsterdam, Netherlands). The reactions were setup with 2.5 U of enzyme, 1.5 mM MgCl.sub.2 and 200 M of each dNTP. Denaturation was performed at 94 C. for 3 min, followed by 30 cycles (94 C. for 30 s, 58.7 C.-65.3 C. for 30 s, 72 C. for 1 min) and 72 C. for 5 min.

[0089] The amplification of the 5-prime flanking region of VVOV 97 and VVOV 82, the 3-prime flanking region of VVOV 96 and VVOV 283 were performed with Platinium Pfx DNA Polymerase (Life Technologies GmbH, Karlsruhe, Germany). A reaction of 50 l contained 1.25 U polymerase, 1-1.5 mM MgCl.sub.2 and 300 M of each dNTP. Additional use of PCRx Enhancer Solution was necessary for amplification of the 5-prime flanking regions of VVOV 96 (1 concentrated) and the 3-prime flanking regions of VVOV 82 (2 concentrated). Denaturation was performed at 94 C. for 2 min, followed by 30 cycles (94 C. for 15 s, 54.6 C.-60.7 C. for 30 s, 68 C. for 1-2 min) and 68 C. for 5-7 min.

[0090] 18 l of each amplification product was analyzed by agarose gel electrophoresis on 1.5-2% SeaKem LE agarose (Biozym, Hessisch Oldendorf, Germany). After staining in a ethidium bromide solution for 20 min the DNA fragments were visualized on an UV transilluminator UVT-20 M/W (Herolab, Wiesloch, Germany).

[0091] The sequence of the amplified DNA-fragments were determined by standard sequencing procedures and compared to the published Vaccinia lister thymidine kinase-sequence and the genome sequence of PPVO NZ2 to determine exactly the integrated PPVO NZ2 sequences.

TABLE-US-00001 TABLE1 PCR-primers, amplification and sequencing of the terminal flanking regions of the integrated fragments in the Vaccinia lister/PPVO NZ2 recombinants Amplified Lengthof terminal amplification regionof Primersusedforamplification product VVVO NZ2insert Primername Sequence5.fwdarw.3 SEQIDNO: [bp] VVOV 5 VAC-P11-1 ATTACAGTGATGCCTACATGCCG 2 264 215 PPVO14r-1 GCTGTAGTCGTGGTCCGGC 3 3 PPVO4r-2 CTTCCTAGGCTTCTACCGCACG 4 402 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 VAC-P11-1 ATTACAGTGATGCCTACATGCCG 2 553 245 PPVO57-1 CTGGCCAACGACGCCTTC 6 3 PPVO40-1 TCTGGTACCCCTTGCCGG 7 321 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 VAC-P11-1 ATTACAGTGATGCCTACATGCCG 2 241 285 PPVO78r-5 GAACCCGCTCTCGCTCGA 8 3 PPVO64r-1 GCCGGGCAAGTGTCTGGTC 9 320 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 VAC-P11-1 ATTACAGTGATGCCTACATGCCG 2 392 330 PPVO92-1 CTCGAAGTAGCTGATGTCGCG 10 3 PPVO96r-1 AGAGCTTTACGTAGACTCTCCAAGTGTC 11 462 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 VAC-TK-fwd ATACGGAACGGGACTATGGACG 12 239 96 PPVO22r-3 GCGGTGGCCATGTACGTG 13 3 PPVO22r-4 GGTTGTGGCGATGGTCGG 14 1055 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 VAC-TK-fwd ATACGGAACGGGACTATGGACG 12 309 97 PPVO18r-1 CTTGATGAGCCGGACGCA 15 3 PPVO25r-1 CCGAGTTGGAGAGGAAGGAGC 16 318 VAK-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 VAC-P11-1 ATTACAGTGATGCCTACATGCCG 2 478 243 PPVO79-1 CTGTTGGAGGATGAGGTCAAGGA 17 3 PPVO71r-1 CGTGCTCATGCCTGTGGAC 18 269 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 283 3 PPVO92-4 CGACATCCTCACCTGCAAGAAG 19 234 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5 VVOV 5 VAK-TK-fwd ATACGGAACGGGACTATGGACG 12 275 82 PPVO120-1 TACAGGCAGCCCGTGACC 20 3 PPVOR3R4-3 GCCGTGTGTCACGTTGATGC 21 1960 VAC-TK-1 CGGTTTACGTTGAAATGTCCCAT 5

Example 2: Induction of Interferon Gamma and Tumor Necrosis Factor Alpha by PPVO Gene Products

[0092] The 16 recombinants were tested of their ability to induce tumor necrosis factor alpha (TNF-) and interferon gamma (IFN-) in whole blood cultures.

[0093] Whole blood cultures containing blood and RPMI medium (Life Technologies GmbH, Karlsruhe, Germany) in the ratio of 1:5 were stimulated with the recombinant viruses. A pure Vaccinia lister and a whole PPVO preparation served as controls. All preparations were used at a final dilution of 1:10. The stimulation for the IFN- determination was done together with Concanavalin A (SIGMA, St. Louis, Mo.), because the virus alone does not induce IFN-. Then the cells were incubated for 24 h (TNF-) and or 72 h (IFN-). The cytokine concentration was then determined in the cell culture supernatants by TNF- or IFN- specific ELISA. These time points were found to be optimal when the experimental conditions were determined using whole PPVO as a control.

[0094] It was possible to identify 5 active recombinant viruses (VVOV 96, VVOV 97, VVOV 243, VVOV 285, and VVOV 330) that induced both TNF- and IFN- secretion and, thus, could mimic the effect of the whole PPVO. The results are depicted in Table 2.

TABLE-US-00002 TABLE 2 Recombinant Virus Clone or Interferon TNF control Induction (%) Induction (%) Vaccinia virus control 100 100 NZ-2 control 2224 264 VVOV 80 200 66 VVOV 82 173 65 VVOV 85 209 94 VVOV 86 138 73 VVOV 96 1638 1016 VVOV 97 1713 1285 VVOV 212 94 62 VVOV 213 192 38 VVOV 215 97 82 VVOV 216 197 71 VVOV 243 1446 933 VVOV 245 98 45 VVOV 247 85 74 VVOV 283 115 78 VVOV 285 1128 1127 VVOV 330 1762 2135

[0095] TNF- was determined after 24 h stimulation of blood cells with the recombinant virus or the controls, respectively. IFN- was determined after 72 h stimulation of blood cells with the recombinant virus or the controls. Stimulation was performed in the presence of the mitogen ConA. The relative induction in percent of the Vaccinia virus control is shown. Therefore, values greater than 100% are due to the activity of the PPVO fragments. Active PPVO fragments are in bold. The data represent mean values of three different blood donors.

TABLE-US-00003 TABLE 3 PPVO NZ2 Sequence PPVO NZ2 ORFs Active recombinant [Bp] that is contained in that are contained in PPVO Vaccinia virus the recombinant the recombinant VVOV 97 24056-33789 18r-25r VVOV 96 31003-46845 22r-39 VVOV 285 74804-88576 64r-76 VVOV 243 82324-92502 71r-79 VVOV 330 102490-108393 .sup.92-96r

[0096] The recombinant Vaccinia lister/PPVO viruses that induce both interferon gamma and TNF- expression are listed in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

Example 3: Local Immunomodulation by PPVO Gene Products in Liver Sinus Endothelial Cells (LSEC)

[0097] We have established a new cell-based assay system that allows testing of hepatoprotective properties of recombinant PPVO proteins expressed in different systems (e.g., Vaccinia virus). This assay system uses primary murine liver cells, which play the central role in deciding whether immunity or tolerance is induced in the liver, the LSEC. The unique ability of LSEC to present exogenous antigens to CD8+ T cells on MHC class I molecules allows immune surveillance of hepatocytes as viral antigens released by infected hepatocytes are likely to be taken by LSEC and presented to cells of the immune system. The new assay allows to measure the ability of LSEC to interact antigen-specifically with CD8+ T cells, that are responsible for tissue destruction in necroinflammatory hepatitis.

[0098] Pure populations of LSEC are isolated from murine liver by a stepwise procedure of portal-vein perfusion with collagenase A (0.05%), mechanical dispersion and further enzymatic digestion in a rotatory waterbath for 40 min at 37 C. (245 rpm), gradient centrifugation (metrizamide 1.089 g/cm.sup.3) and centrifugal elutriation using a Beckman Avanti J25I centrifuge equipped with a JE-6B rotor and a standard elutriation chamber. LSEC cell populations isolated by this method are typically around 95-99% pure as measured by uptake of endothelial cell specific substrate (acetylated low density lipoprotein). LSEC were seeded onto collagen type I coated 24 well tissue culture plates at a density of 100.000 cells per well and were further cultured in Dulbecco's modified Eagle Medium supplemented with 5% fetal calf serum (specially tested not to interfere with the assay system) and 2% glutamine. Three days after isolation, when LSEC gained a post mitotic and quiescent state, we tested for the ability of LSEC to present soluble ovalbumin to (ovalbumin-specific) CD8+ T cells. LSEC were incubated with 1 M of ovalbumin for three hours (antigen dose and time were previously shown to be optimal for testing of substances suspected to influence antigen-presentation), washed and incubated with a CD8+ T cell hybridoma (200.000 cells/well) that recognizes the peptide SIINFEKL (SEQ ID NO:320). SIINFEKL (SEQ ID NO:320) is recognized in a H2b context and directly binds on the MHC-I molecules. Therefore, it has not to be processed by the cell. This allows to differentiate between accessory functions of LSEC (such as MHC-I expression) and antigen-processing function.

[0099] The extent of CD8+ T cell activation was measured by determining the extent of IL-2 release from T cells by specific sandwich ELISA.

[0100] Using Vaccinia virus expressed recombinant proteins derived from PPVO we have been able to attribute hepatoprotective activity to individual clones. To be able to compare different clones directly with respect to their ability to influence cross-presentation by LSEC, we used equal amounts of infectious units.

[0101] We found that LSEC cross-present exogenous ovalbumin very efficiently on MHC class I molecules (k.sup.b) to CD8+ T cells. To our surprise we found if LSEC were incubated with several recombinant PPVO proteins we observed subsequently a potent downregulation of cross-presentation by more than 60% compared to the mock-treated control that includes all but the active ingredient. Several regions within the genome of PPVO have immunoregulatory properties. Especially the region termed 82 (43% reduction) which is located at the 3 end of the genome appears to be responsible for the overall effect of PPVO on cross-presentation by LSEC. Further regions (VVOV 215, VVOV 212, VVOV 247 and VVOV 86) bear further immunoregulatory potential, although to a lesser degree (around 30% reduction in cross-presentation). It further appears that genes coding for proteins that downregulate cross-presentation are arranged in clusters. It is of interest to note that we identified two gene clusters coding for proteins that improved cross-presentation (VVOV 330, VVOV 283, VVOV 285, VVOV 97, and VVOV 96). However, for unknown reasons the downregulatory effect of the proteins mentioned above is dominant in the activity of PPVO on cross-presentation.

[0102] Our results strongly suggest that PPVO contains a mixture of different proteins that in a complementary way work to eliminate hepatocytes from hepatitis B virus while conserving hepatic integrity and avoiding long lasting damage secondary to hepatic fibrosis. As PPVO contains a gene with high homology to the anti-inflammatory agent IL-10 (located in the 5-prime region of the genome) we wondered whether the potent downregulatory effect of the clone 82 was due to expression of ovine IL-10. This assumes that there is cross-reactivity between murine and ovine IL-10 at the level of receptor recognition. We have been unable to demonstrate involvement of ovine IL-10 on the immunoregulatory potential of PPVO. Recombinant murine IL-10 did not show any influence on cross-presentation through LSEC and several monoclonal antibodies to murine and human IL-10 did not influence PPVO mediated downregulation of cross-presentation. We conclude that the immunoregulatory component of PPVO is probably not IL-10 but a new, so far not identified mediator. The data for the MHC-I cross-presentation-down-modulating recombinant virus are depicted in Table 4, those for the MHC-I cross-presentation-stimulating recombinant viruses in Table 5.

TABLE-US-00004 TABLE 4 PPVO NZ2 Sequence PPVO NZ2 ORFs Active recombinant [Bp] that is contained in that are contained in PPVO Vaccinia virus the recombinant the recombinant VVOV 82 122616-136025 120-R3

[0103] The recombinant Vaccinia lister/PPVO virus that down-modulates the MHC-I cross presentation is designated in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

TABLE-US-00005 TABLE 5 PPVO NZ2-Sequence PPVO NZ2-ORFs Active recombinant [Bp] that is contained in that are contained in PPVO Vaccinia virus the recombinant the recombinant VVOV 97 24056-33789 18r-25r VVOV 96 31003-46845 22r-39 VVOV 285 74804-88576 64r-76 VVOV 283 .sup.89.4-103483 78r-92 VVOV 330 102490-108393 .sup.92-96r

[0104] The recombinant Vaccinia lister/PPVO viruses that stimulate the MHC-I cross presentation are designated in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

Example 4: Determination of the Immunostimulatory Activity of the Vaccinia lister/PPVO Recombinants in the Aujeszky Mouse Model

[0105] We also tested the activity of recombinant Vaccinia lister/PPVO NZ2-viruses in the Aujeszky mouse model, a lethal challenge model of acute Suid Herpesvirus 1 disease for determining the activity of various immunostimulators (e.g., Baypamun, CpG oligonucleotides).

[0106] a) Conditions Employed for the Mice

[0107] The NMRI mice (outbreed strain HdsWin:NMRT; female; weight: 18-20 g; obtained via Harlan/Winkelmann, Borchen, Germany) were kept in autoclavable polycarbonate crates lined with sawdust in an S2 isolation stall at 20-22 C. (atmospheric humidity: 50-60%) and subjected to an artificial day/night rhythm (illumination from 6:30 h to 18:30 h and darkness from 18:30 h to 6:30 h). They had free access to feed and water.

[0108] b) Challenge Model

[0109] Groups of mice consisting of 10 mice per group were used for the tests. All of the animals in one group were given the same test substance.

[0110] After the mice were supplied they were kept in the animal stall for 2-3 days. Then the Vaccinia lister/PPVO NZ2 recombinants were diluted with PBS (Life Technologies GmbH, Karlsruhe, Germany) to a titer equivalent of approx. 10.sup.8 TCID.sub.50/ml and thermally inactivated (twice for one hour at 58 C.). Of these solutions 0.2 ml was administered per mouse intraperitoneally.

[0111] 24 hours after the treatment the mice were infected with the pseudorabies virus of the Hannover H2 strain by intraperitoneal administration. For this purpose the virus was diluted in PBS to a test titer of approx. 10.sup.4 TCID.sub.50/ml and 0.2 ml of this suspension was administered.

[0112] As a negative control one group of mice was treated with PBS and then infected. The mice in this group died 3-8 days after infection. A large proportion of the mice treated the Vaccinia lister IPPVO NZ2 recombinants VVOV 215, VVOV 245, VVOV 285 or VVOV 330 survived infection with the pseudorabies virus. 10 days after the infection with the virus the test was ended.

[0113] The level of induced immunostimulation was determined by comparing the number of dead mice in the PBS control group with the number of dead mice in the test groups and was quantified by the efficacy index (EI). This index indicates the percentage proportion of mice protected against the lethal effects of the Aujeszky virus infection through immune stimulation by the substance to be tested. It is calculated by means of the following formula:


EI=(ba)/b100,

where b is the percentage proportion of the dead mice in the control group and a the percentage proportion of the dead mice in the test group.

[0114] A chi-square test was used for the statistical evaluation. This test reveals the minimum activity indices indicating a significant difference between the mortality rate of those mice treated with the test substance and those treated with PBS. Activity indices of 60% are significant where at least 5 of the mice used in tests with n=6 mice per group in the PBS control group and at least 7 of the mice used in tests with n=10 in the PBS control group do not survive the infection with the Aujeszky virus.

[0115] Altogether 3 separate tests were carried out in each case. The testing of Vaccinia lister/PPVO NZ2 recombinants in the Aujeszky mouse model shows the following:

[0116] Surprisingly, after the treatment of the mice with the Vaccinia lister/PPVO NZ2 recombinants VVOV 215, VVOV 245, VVOV 285 or VVOV 330 the average activity indices of higher than 60% demonstrated immunostimulation. By contrast all of the other Vaccinia lister/PPVO NZ2 recombinants were ineffective. The data is summarized in Table 6.

TABLE-US-00006 TABLE 6 PPVO NZ2-Sequence PPVO NZ2 ORFs Active recombinant [Bp] that is contained in that are contained in PPVO Vaccinia virus the recombinant the recombinant VVOV 215 10264-20003 .sup.4r-14r VVOV 245 47952-66263 40r-57 VVOV 285 74804-88576 64r-76 VVOV 330 102490-108393 .sup.92-96r

[0117] The recombinant Vaccinia lister/PPVO viruses that protected mice from herpesvirus induced death are designated in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

TABLE-US-00007 TABLE7 ORF from to N-term SEQIDNO C-term SEQIDNO Comment L1 3 539 IRGFAG 22 PQKVFRL 23 longtermalrepeat(LTR)-protein, retroviralpseudoprotease L2r 781 449 MSEGGRL 24 LLGLLFP 25 LTR-protein,retroviral pseudoprotease L3r 1933 1664 MTVHPPK 26 VLPPNSL 27 LTR-protein,retroviral pseudoprotease L4r 3269 2790 MHPSPRR 28 PVSHPFL 29 LTR-protein,retroviral pseudoprotease L5 2799 3851 MGDREGE 30 FEDGVKC 31 LTR-protein,retroviral pseudoprotease L6 2962 3753 MCTVATF 32 GAPRAGW 33 LTR-protein,similarto134r, retroviralpseudoprotease L7r 3784 3122 MTPTSRE 34 ARTAPPR 35 LTR-protein,retroviral pseudoprotease L8r 4341 4129 MPGEGQY 36 NGGLGKI 37 LTR-protein,retroviral pseudoprotease 1ar 4904 4428 MEFCHTE 38 DTAWYIS 39 dUTPase 1r 6517 4970 MLSRESV 40 RAMLTRP 41 homologofG1LinNZ2,Ankyrin- repeats 2r 8042 6684 MFFWFWC 42 SGEGVPV 43 3r 9989 8070 MLGFWGK 44 VLPSVSR 45 involvedinmaturationofEEV (ExtracellularEnvelopedVirions) 4r 11195 10062 MWPFSSI 46 EFCKPIN 47 PhospholipaseD-typeenzyme 5r 11493 11227 MLIYGPR 48 RLLKDFP 49 homologofB3LinNZ2 6 11802 12038 MGVVMCG 50 APAGVIE 51 7r 12358 12080 MPVKVKQ 52 ASREFIV 53 ubiquitinationproteinwithRING- finger-motiv(relatedtoyeast proteinsAPC11andHRT1) 8r 13980 12364 MEEELTR 54 SPMVVFN 55 noVacciniavirushomolog 9ar 14826 14053 MIRIGGG 56 DNMRVDD 57 10 15080 15394 MDGGVHK 58 EQMCRRQ 59 virioncoreDNA-binding phosphoprotein 11r 16838 15423 MAPPVIE 60 AKNVITH 61 polyApolymerase 12r 19021 16847 MLQLLKR 62 NNRGFRK 63 13r 19704 19156 MACECAS 64 NNCGISF 65 interferonresistanceprotein, homologytomammalianPACT (proteinactivatorofthe interferon-inducedproteinkinase) alsocalledPRKRA(dsRNA dependentactivatorof Interferon-inducedproteinkinase), 13r-proteincontainsadsRBDmotiv (double-strandedRNAbinding domain)andaDRADA-domainthat istypicalforRNA-editingenzymes) 14r 20314 19736 MDEDRLR 66 KKGKPKS 67 RNApolymerase 15 20401 22101 MDFVRRK 68 VVLQGRA 69 16 22125 22940 MVDSGTH 70 PENVVLL 71 17 23003 23866 MASYISG 72 RTHTVYV 73 18r 26908 23873 MLFEMEL 74 SKPVFTG 75 DNApolymerase 19 26926 27213 MEPRFWG 76 AKVRPLV 77 distanthomologoftheERV1/ALR- protein-family(ERV1:yeastprotein, EssentialforRespirationand Vegatativegrowth,ALR: mammalianprotein,Augmenterof LiverRegeneration) 20r 27626 27216 MEAINVF 78 RAYEGML 79 21r 29754 27616 MLLYPKK 80 LLGDGGD 81 relatedto12r 22r 32217 29800 MLIRTTD 82 EAQNMQN 83 23r 33380 32418 MEDERLI 84 PSPCGGE 85 24r 33602 33393 MDKLYTG 86 FHYLKLV 87 25r 34466 33612 MKRAVSK 88 LEAPFNI 89 DNAbindingphosphoprotein 26r 34735 34502 MESRDLG 90 LNARRQN 91 27r 35905 34739 MNHFFKQ 92 RSLYTVL 93 28r 37194 35905 MDKYTDL 94 PEKPAAP 95 coreprotein 29 37200 39248 MENHLPD 96 IEAEPPF 97 RNAhelicase 30r 41037 39229 MIVLENG 98 RMGARPR 99 Zn-protease,involvedinvirion morphogenesis 31 41374 42066 MTFRELI 100 DSMASRS 101 latetranscriptionfactor 32r 42336 41731 MRGHPAH 102 VAPREEL 103 33r 42407 41997 MASDASP 104 QPSSSRR 105 Glutaredoxin-likeenzyme 34 42410 43765 MGIKNLK 106 PRLLKLR 107 35 43770 43958 MVFPIVC 108 LPMLDIS 109 RNApolymerase 36 43980 44534 MREFGLA 110 AEPPWLV 111 37r 45727 44537 MESSKQA 112 TRAPPLF 113 corevirionproteinprecursor 38 45760 46557 MTLRIKL 114 DRSLSCD 115 latetranscriptionfactor 39 46567 47568 MGGSVSL 116 YLLIVWL 117 40 47572 48303 MGAAASI 118 TEFPPSV 119 virionprotein,relatedtovaccinia F9L 41 48352 48621 MVRRVLL 120 LCLFSMD 121 42r 49887 48634 MEEKRGR 122 ARAMVCL 123 43 49917 50693 MTNLLSL 124 TGAEAAP 125 coreprotein,DNAbindingdomain 44 50719 51102 MAAPTTP 126 VDVLGGR 127 44a 51059 51511 MDHEKYV 128 ATLSPGL 129 45 51584 52591 MEGVEMD 130 RPLRGGK 131 polyApolymerase 46 52509 53066 MNRHNTR 132 SVSVVLD 133 RNApolymerase 47r 53523 53023 MFFRRRA 134 GRRPPRP 135 48 53607 57473 MSVVARV 136 EAAEEEF 137 RNApolymerasechain1 49r 58070 57528 MGDKSEW 138 FVCDSPS 139 tyrosinephosphatase 50 57700 58662 MAAAPLR 140 ATSGVLT 141 51r 59674 58673 MDPPEIT 142 LLVTAIV 143 immunodominantenvelopeprotein 52r 62089 59678 MDSRESI 144 YMINFNN 145 RNApolymerase-associated transcriptionspecificityfactor(also calledRAP94) 53 62198 62881 MSSWRLK 146 KAAACKK 147 latetranscriptionfactor 55 62909 63862 MRALHLS 148 NSEQVNG 149 topoisomeraseI 56 63858 64271 MDEALRV 150 FIRAAVA 151 57 64309 66831 MDAPSLD 152 LYVFSKR 153 mRNAcappingenzyme 58r 67266 66799 MEPSAMR 154 DVQHVDL 155 virionprotein 58ar 67803 67273 MAGFSQS 156 TTCVPPQ 157 59 67915 68607 MATPANA 158 FSFYSEN 159 UracilDNAglycosylase 60 68624 70984 MAAPICD 160 IEDVENK 161 ATPase,involvedinDNA replication 61 70994 72898 MNSDVIK 162 EVSVVNI 163 earlytranscriptionfactor 62 72938 73507 MSTFRQT 164 ASPAAKN 165 RNApolymerase 63 73540 74211 MRTYTSL 166 WGAAVTR 167 NTPpyrophosphohydrolase 64r 76120 74207 MTSAHAA 168 VDPASIA 169 virionNTPase 65r 76749 76186 MEGRARF 170 RFCNYCP 171 66r 77698 76799 MKTDCAS 172 KLKLLLQ 173 mRNAcappingenzyme 67r 79343 77709 MNNSVVS 174 AEKVTAQ 175 rifampicinresistance,virion membrane 68r 79816 79367 MKRIALS 176 MALKSLI 177 latetransactivatorprotein 69r 80529 79858 MNLRMCG 178 AACSLDL 179 latetransactivatorprotein 70r 80774 80529 MGDNVWF 180 VLGLEQA 181 thioredoxin-likeprotein 71r 82815 80788 MESPACA 182 NMCDVLC 183 majorcoreprotein 72r 83835 82834 MDLRRRF 184 VDNTGTS 185 coreprotein 73 83874 85583 MEESVAV 186 LLNYGCG 187 RNA-polymerase 74r 85535 84402 MDRLRTC 188 AEAAESA 189 75r 88096 85574 MVSVMRK 190 QEFYPQP 191 earlytranscriptionfactor 76 87759 88667 MFQPVPD 192 SACRASP 193 77r 88920 88642 MRPCYVT 194 TRGTQTG 195 78r 91652 88938 MTAPNVH 196 AVSFDSE 197 majorcoreprotein 79 91667 92674 MTAVPVT 198 VRKLNLI 199 80r 93466 92681 MASEKMA 200 DLDGGMC 201 virionprotein 81r 93761 93486 MGLLDAL 202 RFSAASS 203 virionmembraneprotein 82r 94060 93788 MDIFETL 204 DIELTAR 205 virionmembraneprotein 83r 94238 94080 MVSDYDP 206 HFVHSVI 207 84r 94508 94242 MFLDSDT 208 DMPFSVV 209 85r 95571 94498 MGDTVSK 210 KTINVSR 211 86r 96187 95600 MESYFSY 212 EDLFFAE 213 virionmembraneprotein 87 96202 97665 MFGGVQV 214 GRDLAAV 215 RNAhelicase 88r 97915 97643 MSAVKAK 216 PLRDLAR 217 Zn-fingerprotein 89 98251 99537 MTSESDL 218 AIARAQP 219 DNApolymeraseprocessivityfactor 90 99537 99974 MIVAAFD 220 NYVLRIN 221 91 100001 101140 MLALFEF 222 LKELLGP 223 intermiediatetranscriptionfactor 92 101168 104650 MEQALGY 224 SLFSPED 225 RNApolymeraseb-chain 93r 106354 104795 MESDNAL 226 GQHAAIW 227 A-typeinclusionbody/Fusionpeptide 94r 107947 106400 MEKLVSD 228 GRSGAIW 229 A-typeinclusionbody/Fusionpeptide 95r 108256 107990 MDENDGE 230 QTGYSRY 231 viralfusionprotein 96r 108719 108300 MDAVSAL 232 LFLKSIL 233 97r 109679 108738 MADAPLV 234 RELRANE 235 RNApolymerasesubunit 98r 109861 109682 MEEDLNE 236 MGQASSA 237 99r 110830 110033 MDVVQEV 238 ADSDGGN 239 ATPase 100 110208 110417 MRSWFWQ 240 PLTGMCL 241 100a 110469 110651 FRPKSVG 242 SGHTKPS 243 101 110915 111397 MAHNTFE 244 KYFCVSD 245 envelopedvirionglycoprotein 102 111419 111913 MGCCKVP 246 CMKEMHG 247 envelopedvirionglycoprotein 103 111949 112485 MSRLQIL 248 RKLDVPI 249 104 112593 113450 MKAVLLL 250 LNLNPGN 251 GM-CSF/IL-2inhibitionfactor 105r 113323 112967 MHASLSS 252 DETLTYR 253 106 113526 114152 MEVLVII 254 GEFFYDE 255 107 114199 115236 MPLFRKL 256 RDALDGL 257 108 115353 115787 MACFIEL 258 TTFSSSE 259 109 115859 116551 MSSSSSE 260 TTGTSTS 261 TT 110 116729 117523 MACLRVF 262 CSMQTAR 263 GM-CSF/IL-2inhibitionfactor 111r 117572 117114 MAIAHTT 264 FRFRTPG 265 112 117423 118085 MAATIQI 266 KRDGYSR 267 114r 118968 118375 MEGLMPK 268 RPISVQK 269 115 118508 119119 MDSRRLA 270 LGDSDSD 271 116 119588 120202 MRLILAL 272 PQMMRIG 273 117 120314 121231 MAGFLGA 274 CKVEEVL 275 118 121380 123920 MHLKKDP 276 LAFPSLA 277 119 121288 122256 MANRLVF 278 RPMEIDG 279 120 122350 123924 MENNDGN 280 RFLPSHK 281 relatedto1r/G1LwithAnkyrin-repeats 121 123962 125566 MDPAGQR 282 CSETDRW 283 122r 125193 124591 MSSSAAA 284 IAPDSRM 285 123r 125689 123935 MTAEASI 286 DPVYHKK 287 123ar 123839 123297 MPRTTSG 288 REQTEGL 289 124 125652 126170 MANREEI 290 VRVLRRT 291 125r 126121 125699 MTAPTPR 292 AAYSLAR 293 126 126279 127769 MADEREA 294 LACAMRK 295 127 127851 128408 MSKNKIL 296 SYMTTKM 297 sheep-likeInterleukin10 128 128520 130076 MLTRCYI 298 RASGLAE 299 relatedto1r/G1LwithAnkyrin-repeats 129 130105 131700 MVGFDRR 300 CGRRAPE 301 relatedto1r/G1L,withAnkyrin- repeats(NTslightlychanged) 130 131790 133283 MILARAG 302 PDAAALS 303 Kinase 131 133246 133920 MPPRTPP 304 RPAALRA 305 132 133972 134370 MKLLVGI 306 RPPRRRR 307 homologtothesheepVEGF(Vascular EndothelialGrowthFactor) 133a 134417 134693 MRKKAPR 308 ARTAPPR 309 correspondstoL7r R1 134402 134992 MMRSGHA 310 RMHRSEL 311 LTR-protein(correspondstoL4r), retroviralpseudoprotease R2r 134853 134419 MCTVATF 312 SVAPSSA 313 LTR-protein(correspondstoL6,134r), retroviralpseudoprotease R3 135628 135897 MTVHPPK 314 VLPPNSL 315 LTR-protein(correspondstoL3r), retroviralpseudoprotease R4 136780 137112 MSEGGRL 316 LLGLLFP 317 LTR-protein(correspondstoL2r), retroviralpseudoprotease R4r 137558 137022 IRGFAGG 318 PQKVFRL 319 LTR-protein(correspondstoL1r), retroviralpseudoprotease

[0118] Sequences of the Parapox ovis open reading frames. ORFs the names of which end with r are encoded on the complementary DNA strand. Base pair positions in the from and to column are relative to SEQ ID NO:1.