DUNALIELLA MUTANT AND METHOD FOR PRODUCING PIGMENT BY USING SAME
20190290712 ยท 2019-09-26
Assignee
Inventors
Cpc classification
A23V2002/00
HUMAN NECESSITIES
A61K31/047
HUMAN NECESSITIES
A23K20/179
HUMAN NECESSITIES
C12P23/00
CHEMISTRY; METALLURGY
A23K10/16
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A61K36/05
HUMAN NECESSITIES
A23L5/46
HUMAN NECESSITIES
A23K10/30
HUMAN NECESSITIES
International classification
A61K36/05
HUMAN NECESSITIES
C12P23/00
CHEMISTRY; METALLURGY
A23K20/179
HUMAN NECESSITIES
A23L5/46
HUMAN NECESSITIES
A61K31/047
HUMAN NECESSITIES
Abstract
A novel alga mutant having improved pigment productivity is provided. The mutant can be used to produce carotenoid-based pigments, particularly, xanthophyll by using a small amount of energy, and thus can effectively produce pigment on an industrial level. In addition, the mutant can be used as a source for foods, health functional foods, and medications which contain a pigment. Further, when account is taken of the physiological characteristics of the euryhaline microalgae Dunaliella and the geological characteristics of Korean, the three sides of which are in contact with the sea, sea-water can be used as a culture medium, with the expectation of reducing the cost and leading to the development of related industries.
Claims
1. Dunaliella sp. Macular Pigment 3 (MP3) (KCTC 12990BP) algae having a xanthophyll-producing ability.
2. The algae according to claim 1, wherein the Dunaliella sp. MP3 has an ability to produce: lutein and zeaxanthin; and one or more pigments selected from the group consisting of chlorophyll b, chlorophyll a and -carotene.
3. A culture of Dunaliella sp. MP3 (KCTC 12990BP) algae.
4. A pigment composition, comprising: one or more selected from the group consisting of Dunaliella sp. MP3 (KCTC 12990BP) algae according to claim 1, a culture of the algae, a dried product of the culture and an extract thereof.
5. The pigment composition according to claim 4, which comprises zeaxanthin at 10 to 15 parts by weight with respect to 100 parts by weight of the total pigments.
6. A composition for oral administration, comprising: one or more selected from the group consisting of Dunaliella sp. MP3 (KCTC 12990BP) algae according to claim 1, a culture of the algae, a dried product of the culture, and an extract thereof.
7. A feed or feed additive composition, comprising: one or more selected from the group consisting of Dunaliella sp. MP3 (KCTC 12990BP) algae according to claim 1, a culture of the algae, a dried product of the culture, and an extract thereof.
8. A food or food additive composition, comprising: one or more selected from the group consisting of Dunaliella sp. MP3 (KCTC 12990BP) algae according to claim 1, a culture of the algae, a dried product of the culture, and an extract thereof.
9. The composition comprising one or more selected from the group consisting of Dunaliella sp. MP3 (KCTC 12990BP) algae according to claim 1, a culture of the algae, a dried product of the culture, and an extract thereof, which is effective in strengthening or maintaining eye health; preventing or improving macular degeneration; preventing or improving function degradation of eye; improving or preventing damage to the retina; suppressing aging; maintaining retinal health; reducing a risk of the occurrence of macular degeneration; or preventing or improving decreased visual acuity.
10. A method of producing a pigment, comprising: culturing Dunaliella sp. MP3 (KCTC 12990BP) algae.
11. The method according to claim 10, further comprising: extracting a pigment from the Dunaliella sp. MP3 (KCTC 12990BP) algae, a culture of the algae, a concentrate of the culture or a dried product of the culture.
12. The method according to claim 10, wherein the pigment is a xanthophyll pigment.
13. A method of producing a raw material of food or feed, comprising: culturing Dunaliella sp. MP3 (KCTC 12990BP) algae.
14. A method for strengthening or maintaining eye health; preventing or improving macular degeneration; preventing or improving function degradation of eye; improving or preventing damage to the retina; suppressing aging; maintaining retinal health; reducing a risk of the occurrence of macular degeneration; or preventing or improving decreased visual acuity of a subject, comprising administering one or more selected from the group consisting of Dunaliella sp. MP3 (KCTC 12990BP) algae according to claim 1, a culture of the algae, a dried product of the culture, and an extract thereof to the subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The above and other objects, features and advantages of the present invention will become more apparent to those of ordinary skill in the art by describing in detail exemplary embodiments thereof with reference to the accompanying drawings, in which:
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0034] However, the present invention can be modified and implemented in various forms, and therefore, only specific embodiments will be described in detail. Also, the present invention is not limited to specific disclosures, and it should be understood that the present invention includes all modifications, equivalents and alternatives included in the technical idea and scope of the present invention.
[0035] Hereinafter, the present invention will be described in further detail.
[0036] The present invention relates to Dunaliella sp. MP3 (KCTC 12990BP) algae.
[0037] The Dunaliella sp. algae are unicellular green algae with two flagella of equal length, their cells are spindle-shaped, their size is 7 to 25 m in length depending on the species and has a chloroplast. The Dunaliella sp. algae can be grown in an environment with a high salt concentration.
[0038] The mutant is constructed by general mutagenesis, and identified by isolation using subculture and a conventional method. The mutagenesis may be performed using a general mutagen, and in one exemplary embodiment of the present invention, the mutation is induced by treatment of a chemical.
[0039] The Dunaliella MP3 mutant of the present invention has a pigment-producing ability, and specifically, a xanthophyll-producing ability. More specifically, the Dunaliella MP3 mutant has the ability to produce lutein and zeaxanthin, and may further produce one or more selected from the group consisting of chlorophyll b, chlorophyll a and -carotene.
[0040] The mutant has a significantly higher capability of producing zeaxanthin per cell than conventional wild-type Dunaliella sp. algae, and has 20 to 30% higher zeaxanthin accumulation per cell than base algae Dunaliella sp. Zea1 (BIOTECHNOLOGY AND BIOENGINEERING, VOL. 81, NO. 1), and therefore it can be effectively used as algae for producing a xanthophyll.
[0041] In one exemplary embodiment, since it was confirmed that the MP3 mutant of the present invention has the highest zeaxanthin accumulation per unit cell density and per dry weight compared to the wild-type and Zea1 algae of the same species (
[0042] The mutant of the present invention can survive under dim light, and specifically, can be cultured under a light intensity ranging from 10 to 2,000 mol photons/m.sup.2s. The mutant cannot be photosynthesized under complete darkness below a dim light condition, and cells can get damaged by light stress under a very high light condition. When the mutant is cultured under the above-described conditions, the xanthophyll content in the mutant may be increased, and an excellent growth rate may be exhibited.
[0043] The MP3 mutant may be properly grown under a conventional growth environment for the Dunaliella sp. algae (light intensity, temperature, salinity, etc.). In addition, since the MP3 mutant has excellent zeaxanthin accumulation at a low light intensity (
[0044] The MP3 mutant may be cultured in a sea water environment, and specifically, in a culture medium containing sea water. The mutant of the present invention may be cultured under a salinity condition ranging from 0.05M to 5.5M based on a NaCl concentration. The culture medium may further include Tris, as well as NaCl. The culture medium contains nutrients necessary for microorganisms to be cultured, that is, to culture a specific microorganism, and further contains a material used for a specific purpose. The medium is called a growth medium or culture medium, and is a concept encompassing a natural medium, a synthetic medium and a selective medium. The Dunaliella mutant may be cultured according to a conventional culture method. In one exemplary embodiment, it was confirmed that the MP3 mutant of the present invention had an excellent zeaxanthin-producing ability in the culture medium composition environment of Table 1.
[0045] The pH of the culture medium is not particularly limited as long as the Dunaliella sp. algae can survive and grown, and the Dunaliella sp. algae may survive at pH 6 or more, specifically, at pH 7 to pH 9, and may have the optimal growth rate in a range from pH 8.0 or more to less than pH 9.0.
[0046] The MP3 mutant is developed by a chemical mutation using Dunaliella sp. Zea1 (BIOTECHNOLOGY AND BIOENGINEERING, VOL. 81, NO. 1) as base algae, and identified as the Dunaliella sp. Algae through ITS sequencing.
[0047] Specifically, using ITS1 (ITS1-F: TCCGTAGGTGAACCTGCGG, ITS1-R: GCTGCGTTCTTCATCGATGC) and ITS2 (ITS2-F: GCATCGATGAAGAACGCAGC, ITS2-R: TCCTCCGCTTATTGATATGC) as primers for amplifying a base sequence, the results of ITS1 and ITS2 sequencing for the Dunaliella strains (wild-type, Zea1 and base algae) and the mutant MP3 were summarized and aligned using the clustalW program, and then a phylogram is constructed using an unweighted pair group method with arithmetic mean (UPGMA) algorithm in the MEGA6 program (
[0048] From a topological point of view, when looking at the phylogram, it was confirmed that the mutant of the present invention is close to the base algae Zea1, and both are close to the wild-type Dunaliella species. In addition, it can be confirmed that the mutant of the present invention is phylogenetically related to Dunaliella tertiolecta A2.
[0049] Based on the analysis result, the selected mutant of the present invention was named Dunaliella sp. MP3, and deposited in Korean Collection for Type Cultures (KCTC) on Mar. 16, 2016 and received Accession No. KCTC 12990BP on Mar. 23, 2016.
[0050] High contents of pigments, particularly, xanthophyll-based pigments may be accumulated in cells of the MP3 mutant of the present invention, and among these pigments, zeaxanthin may be contained at a higher amount, and therefore the MP3 mutant algae may be cultured to be effectively used as a raw material of food, feed, medications, etc.
[0051] In terms of this, the present invention relates to a culture of Dunaliella sp. MP3 (KCTC 12990BP) algae.
[0052] The culture used herein refers to a medium in which a specific microorganism is cultured, and in other words, a medium obtained after culture. The culture includes the Dunaliella sp. MP3. In addition, the culture includes all of a concentrated and dried product of the culture obtained by culturing and processing such as concentrating and drying the culture medium. The culture may include a by-product of the culture, and a type of the culture may be, but is not limited to, a liquid or a solid.
[0053] The medium contains nutrients necessary for microorganisms to be cultured, that is, to culture a specific microorganism, and further contains a material used for a specific purpose. The medium is called a growth medium or culture medium, and is a concept encompassing a natural medium, a synthetic medium and a selective medium. The pH of the medium may be in a range in which the Dunaliella sp. MP3 algae can be grown, and for example, at pH 6 or more, and preferably, at pH 7 to pH 9.
[0054] In addition, the present invention relates to a composition including one or more selected from the group consisting of the Dunaliella sp. MP3 (KCTC 12990BP) algae of the present invention, a culture of the algae, a dried product thereof, and an extract thereof.
[0055] The composition may be used for improving human or animal health.
[0056] The mutant of the present invention produces xanthophyll-based pigments including zeaxanthin and lutein and then accumulates them in a body, and in terms of this, the composition may be a pigment composition or a xanthophyll pigment composition.
[0057] The pigment composition may include zeaxanthin at 10 wt % to 15 wt % with respect to the total content of the pigments included in the composition. According to an exemplary embodiment of the present invention, from a result of measuring the zeaxanthin content in the total pigment per cell of each of the Dunaliella wild-type algae, Zea1 algae and the MP3 mutant, it can be confirmed that the MP3 mutant has a significantly higher zeaxanthin content among the total pigments, than that of the wild-type and Zea1 (
[0058] The pigment composition may be used as a raw material of food or feed, or as a preparation for oral administration.
[0059] Therefore, the composition, or a pigment composition or xanthophyll pigment composition including an extract thereof may be a composition for oral administration since it can be included in food, medications or feed.
[0060] The composition for oral administration may be included in an oral preparation formulated by a method known in the art in the form of powder, granules, tablets, pills, sugar-coated tablets, capsules, a liquid, a gel, a syrup, a slurry or a suspension. For example, an oral preparation may be obtained as tablets or sugar-coated tablets by mixing an active ingredient with a solid excipient, grinding the mixture, adding suitable supplements and processing the resulting mixture into a granulated mixture. Examples of suitable excipients may include saccharides such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, starches such as corn starch, wheat starch, rice starch and potato starch, celluloses such as cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropyl methyl-cellulose, and fillers such as gelatin, polyvinylpyrrolidone. In some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be further added as a disintegrating agent.
[0061] In addition, since the composition may be added to food or feed to attain a specific purpose, in terms of this, the composition may be a food composition, a food additive composition, a feed composition or a feed additive composition. When the composition is used in feed or food, xanthophyll pigments, particularly, zeaxanthin and lutein, which are produced by the Dunaliella sp. MP3 algae and accumulated in cells can maintain or strengthen the health of the body. Specifically, the zeaxanthin and lutein are macular pigments and may prevent or improve macular degeneration, and thus are effective in prevention or improvement of macular degeneration-related eye diseases. More specifically, since the zeaxanthin and lutein are effective in strengthening or maintaining eye health; preventing or improving macular degeneration; preventing or improving eye functionality; improving or preventing damage to the retina; suppressing aging; maintaining retinal health; reducing a risk of the occurrence of macular degeneration; or preventing or improving decreased visual acuity, the feed or food composition may be used to prevent or improve the symptoms, or used for the above-mentioned effects.
[0062] The composition for additives used herein includes any component added to food or feed as well as a main ingredient, and specifically, may be an active ingredient having functionality in food or feed, or a food additive added for coloring, preservation, etc. to processed food, which is defined by the Ministry of Food and Drug Safety (MFDS).
[0063] The food may be a health functional food, more specifically, a health functional food for eye health.
[0064] The food, food additive, feed or feed additive composition may further include other active ingredients without damaging the activity of the Dunaliella sp. MP3 (KCTC 12990BP) algae of the present invention, a culture of the algae, a dried product thereof and an extract thereof. In addition, additional components including a carrier may be further included.
[0065] In the present invention, the feed composition may be prepared as fermented feed, compounded feed, or pellets or silage. The fermented feed may be prepared by including the Dunaliella sp. MP3 algae of the present invention, dry cells of the algae, a culture thereof and an extract thereof, and further including various microorganisms or enzymes. The compounded feed may be prepared by mixing various types of general feed with the Dunaliella sp. MP3 algae of the present invention, dry cells of the algae, a culture thereof and an extract thereof. The pellet-type feed may be prepared by formulating the fermented feed or compounded feed using a pelletizer. The silage may be prepared by mixing green forage with the Dunaliella sp. MP3 algae, dry cells of the algae, a culture of the algae and/or an extract thereof, and a use of the composition of the present invention is not limited thereto.
[0066] The composition may be prepared by being mixed with a carrier and a flavor, which are conventionally used in the food or pharmaceutical field, and administered in the form of a tablet, a troche, a capsule, an elixir, a syrup, a powder, a suspension or a granule. As the carrier, a binder, a lubricant, a disintegrating agent, an excipient, a solubilizing agent, a dispersing agent, a stabilizer or a suspending agent may be used. As an administration method, oral administration, parenteral administration or a coating method may be used, but oral administration is preferred. In addition, a dose may be suitably selected depending on the degree of absorption, inactivation rate, and excretion rate of an active ingredient in a body, the age, sex or condition of a subject. The pH of the composition can be easily adjusted according to conditions for preparing a drug or food containing the composition.
[0067] The composition may include any one selected from the group consisting of the Dunaliella sp. MP3 (KCTC 12990BP) algae, a culture of the algae, a dried product thereof and an extract thereof at 0.001 to 99.99 wt %, and preferably 0.1 to 99 wt % with respect to the total weight of the composition, and a content of the active ingredient may be suitably adjusted according to a method of using the composition, and an intended use of the composition.
[0068] The Dunaliella sp. MP3 (KCTC 12990BP) algae may be included in the composition as it is or in a dry form, and the algae culture may be included in the composition in a concentrated or dried form. In addition, the dried product refers to a dried form of the algae or a culture thereof, or a powder form prepared by lyophilization.
[0069] In addition, the extract refers to an extract obtained by extracting MP3 algae, a culture thereof or a dried product thereof, and includes an extract obtained using a solvent, and one obtained by disrupting the MP3 algae of the present invention. Specifically, the extract may be obtained by extracting and isolating pigments accumulated in cells of the Dunaliella sp. MP3 (KCTC 12990BP) algae of the present invention by a physical or chemical method.
[0070] The extraction process may be performed by a conventional method, and for example, a target pigment may be extracted by adding an extraction solvent to cells, homogenizing the cells, and disrupting the cells. After extraction, the algae lysate may be removed by centrifugation, and the extraction solvent may be removed by a method such as vacuum distillation. In addition, the extraction process may further include a conventional purification process. Since the pigment is insoluble in water, it may be more easily extracted from the algae of the present invention.
[0071] Since the Dunaliella MP3 mutant of the present invention has an excellent xanthophyll-producing ability, particularly, zeaxanthin at a low light intensity, the composition including the mutant and a by-product thereof is effective in improvement of body activity, maintenance of body functionality and prevention of degradation of body functionality. Specifically, the xanthophyll pigment is known to have a macular degeneration inhibitory effect, an antioxidant effect and an anticancer effect, and therefore, the composition of the present invention may be used as a raw material included in food, medications or feed to maintain body health, specifically, maintain a xanthophyll pigment-involved body function, or prevent or enhance degradation of the body function.
[0072] In addition, the present invention provides a method of producing a pigment using Dunaliella sp. MP3 (KCTC 12990BP) algae.
[0073] In addition, the present invention provides a method of producing a raw material of food or feed, which includes an operation of culturing Dunaliella sp. MP3 (KCTC 12990BP) algae.
[0074] When the Dunaliella sp. MP3 (KCTC 12990BP) algae of the present invention is used, the xanthophyll accumulation in the cultured Dunaliella algae may be increased, and thus the supply of a raw material industrially used may be effectively performed.
[0075] The production method may include an operation of culturing Dunaliella sp. MP3 (KCTC 12990BP) algae.
[0076] In addition, after the culturing operation, the production method may further include an operation of isolating the Dunaliella sp. MP3 algae of the present invention from the culture. The isolated algae may be further subjected to a processing operation including drying.
[0077] In addition, the production method may further include an operation of extracting a pigment from the Dunaliella sp. MP3 (KCTC 12990BP) algae, a culture of the algae, or a concentrated or dried product of the culture.
[0078] The culture may be performed in a medium under a salinity condition of 0.05M to 5.5M based on an NaCl concentration. In addition, the culture may be performed under a dim light condition, specifically, a light intensity condition in a range from 10 to 2,000 mol photons/m.sup.2s. Since the Dunaliella MP3 mutant of the present invention has an excellent pigment-producing ability even at a low light intensity, a xanthophyll content in a body may be increased, and a xanthophyll may be highly accumulated without supply of high intensity light energy, and thus this method can be effectively used on an industrial level.
[0079] The above-mentioned extraction may be performed by a conventional method of extracting a pigment from a microorganism, for example, an enzyme method, ultrasonic extraction, or mechanical extraction, but the present invention is not limited thereto.
[0080] In addition to the culturing operation, the production method may further include a concentrating operation for increasing a content of the algae after the culture, and a drying operation for further reducing moisture of the algae that has been subjected to the concentrating operation. However, the concentrating or drying operation is not needed, and is generally performed using concentrating and drying methods and machines, which are conventionally used in the art.
[0081] The production method may further include a purifying operation after the extracting operation, which may be performed by a conventional purification method used in the art.
[0082] The xanthophyll prepared through the concentration or drying operation may be used as a raw material of food, health functional food, cosmetics or drugs.
[0083] The method of producing a xanthophyll may be performed by employing a different method without impairing the effect of the present invention.
[0084] Contents of the algae and composition can also be applied to the production method of the present invention.
[0085] Hereinafter, preparation examples and experimental examples of the present invention will be described in detail. The following examples and experimental examples are merely provided to illustrate the present invention, but the scope of the present invention is not limited thereto.
EXAMPLE 1
Mutagenesis, Selection of Mutant and Analysis of Morphological Characteristic
[0086] High zeaxanthin-containing algae Zea1 (Dunaliella sp. Zea1) derived from Dunaliella sp. and used as base algae in this experiment were cultured in a liquid medium having the composition shown in Table 1 below. Shaking culture was performed under conditions including a light intensity of approximately 100 mol photons/m.sup.2s, a temperature of 25 to 26 C. and a speed of 90 rpm.
TABLE-US-00001 TABLE 1 Component Concentration in culture medium Salts and major component NaCl 1.5M Tris 40 mM KNO.sub.3 5 mM MgCl.sub.2 4.5 mM MgSO.sub.4 0.5 mM CaCl.sub.2 0.3 mM K.sub.2HPO.sub.4 0.1 mM FeCl.sub.3 0.002 mM NaEDTA 0.02 mM Trace component H.sub.3BO.sub.3 50 M MnCl.sub.2 10 M ZnSO.sub.4 0.8 M CuSO.sub.4 0.4 M NaMoO.sub.4 2 M NaVO.sub.3 1.5 M CoCl.sub.2 0.2 M Carbon source NaHCO.sub.3 25 mM pH of culture medium 7.4
[0087] base algae Zea1 were cultured until they reached the exponential phase, and then cells were harvested and resuspended to have a cell density of 810.sup.6 to 1010.sup.6 cells/mL, and then treated with a chemical mutation-inducing material, ethyl methane sulfonate (EMS), to have a final concentration of 0.2 M. After incubation for two hours, the treated EMS was washed with a liquid medium, and then the cells were harvested by centrifugation. The cells were resuspended with a liquid medium, incubated in the dark for one day, and then transferred to a solid medium in which agar is further added to the same composition as the liquid medium of Table 1 and plated thereon. After one week, colonies developed on the solid medium were isolated, and a single colony was transferred to the liquid medium of Table 1 and cultured in the liquid. A mutant was selected by analyzing the characteristic of each colony.
[0088] Specifically, by visual observation, pale green colonies, which looked lighter than the wild-type and base algae (Zea1), were first screened, and algae having a relatively higher zeaxanthin content were secondly screened by HPLC analysis of the first-selected colony of algae.
[0089] To compare morphological characteristics of the mutants, microscope images of the wild-type Dunaliella sp. algae, the base algae Zea1 of the present invention and the MP3 mutant (macular pigment mutant 3, hereinafter, referred to as a mutant or MP3 mutant) obtained in the present invention are shown in
[0090] As shown in
[0091] As shown in
[0092] In addition, as shown in
EXAMPLE 2
Confirmation of Growth Characteristic of Isolated Mutant
[0093] 2-1. Confirmation of Growth Rate
[0094] To compare the cell growth rates and the final growth levels of the wild-type Dunaliella algae, Zea1 and the MP3 mutant, each type of algae was inoculated in a medium of the composition shown in Table 1 at a cell density of 110.sup.6 cells/mL, and cultured at different light intensities of 50, 100 and 300 mol photons/m.sup.2s. In the comparative experiment, the temperature was 25 to 26 C., and shaking culture was performed at 90 rpm. After the initiation of culture, 0.5 mL of the culture was taken and a cell density per mL was measured on day 1, 2, 3, 4 or 5 under a microscope using a hemocytometer. The cell density according to a light intensity was measured on each measuring day, and the result is shown in
[0095] As shown in
[0096] 2-2. Measurement of Dry Weight
[0097] Actually, to use microalgae on an industrial level, since a dry cell weight is also an important part, dry weights were measured to compare the final biomass thereof.
[0098] Specifically, samples were inoculated at 10010.sup.4 cells/mL, and harvested on day 2, which is in the exponential phase. To compare the final algal biomass, 1 mL or 2 mL of the suspension of the culture was filtered through a microfilter (filter paper), the filtrate was dried in a dry oven at 65 C. for 24 hours, and then 110.sup.6 cells of the wild-type, Zea1 and the mutant were weighed to measure dry cell weights. Since Dunaliella was grown in a high-salinity liquid medium, residual salts remain after the cells were harvested by centrifugation and can affect the dry cell weight of the cells. For this reason, the experiment was performed while the filtrate was filtered through a filter paper to remove as many salts as possible. The result is shown in
[0099] In addition, a dry cell weight was calculated in each of 0.5, 1 and 2 mL of the culture, and thereby a trend line was plotted to compare the value with the dry cell weight in the 1 L of the culture (
[0100] As shown in
EXAMPLE 3
Pigment Analysis of Mutant
[0101] Single colonies were isolated from colonies developed after the treatment of a mutagenesis material and continuously cultured, and then pigment analysis was performed by HPLC for each colony.
[0102] Specifically, the isolated single colonies were cultured in a liquid medium under a condition of 100 mol photons/m.sup.2s for 5 days, and specific conditions were the same as those used in Example 1. Pigments were extracted from the harvested algal cells using 80% acetone, and the supernatant obtained by centrifugation was re-filtered through a nylon filter and then analyzed by HPLC.
[0103] Specifically, for pigment extraction, the total flow rate of a solvent was 1.2 mL per minute, from 0 minute to 15 minutes, Tris (pH 8.0) was 14%, acetonitrile was uniformly decreased from 84% to 0%, and methanol and ethyl acetate were 2% in the beginning and increased to 68% and 32%, respectively, up to 15 minutes. Afterward, for 3 minutes (from 15 minutes to 18 minutes), the above-mentioned ratio of the solvents was maintained, and then a post-run was performed for 1 minute (from 18 minutes to 19 minutes) with the initial ratio of the solvents and carried out for another 6 minutes. A pump was LC-20A Prominence (Shimadzu), a column was Waters Spherisorb S5 (DS1 4.6250 mm, 5 m Cartridge Column, USA), and a column temperature was maintained at 40 C. Data analysis was performed by a photodiode array detector (SPD-M20A, Shimadzu), and concentrations of carotenoid pigments including zeaxanthin detected at 445 nm and chlorophyll a detected at 670 nm were determined using a standard curve quantifying zeaxanthin and chlorophyll a, which were purchased from DHL (Agern Alle, Horsholm, Denmark).
[0104]
[0105] In addition, on day 2 (the point of time at which the algae reached the stationary phase) after the culture in 100 mL of a culture medium in 250 mL flasks under a light intensity of 100 mol photons/m.sup.2s, algae grown to a cell density of 110.sup.6 or algal cells were harvested from the culture, and then on the basis of 1 g dry cell weight (DCW), a comparison result of zeaxanthin contents is shown in
[0106] As shown in
[0107] As shown in
EXAMPLE 4
Confirmation of Zeaxanthin-Producing Ability in Isolated Mutant
[0108] An amount of zeaxanthin accumulated in a mutant isolated by quantitative analysis by visual observation and HPLC was compared with that accumulated in the base algae (Zea1).
[0109] Compared with the wild-type Dunaliella algae and the base algae (Zea1) algae, the mutant grown under the same light intensity condition (100 mol photons/m.sup.2s) did not have a great difference in size (
[0110] Particularly, although having a lower growth rate, the mutant of the present invention had a higher zeaxanthin content accumulated in algae per unit cell density under the same light intensity condition than the wild-type and the Zea1 algae, which indicates that the mutant can be used as xanthophyll-producing algae with much higher efficiency than the conventional xanthophyll-producing algae. Therefore, an experiment was performed to confirm whether the ability to produce zeaxanthin accumulated in the mutant of the present invention can be maintained after the culture.
[0111] To confirm a zeaxanthin-producing ability in the mutant, 110.sup.6 cells/mL were inoculated in 500 mL of a culture medium and cultured. Light intensity and shaking culture conditions are the same as described above. After inoculation, the cells were incubated for 14 days (11 to 12 days after reaching the stationary phase), and then harvested, followed by measuring the zeaxanthin content in the total pigments. The result is shown in
[0112] As shown in
EXAMPLE 5
Phylogenetic Analysis of Isolated Mutant
[0113] For phylogenetic analysis of the MP3 mutant of the present invention screened in Example 1, a microorganism was identified by sequencing of an ITS gene.
[0114] Specifically, for ITS sequencing, a PCR product of the ITS gene amplified by PCR was subjected to electrophoresis (
[0115] The analyzed sequences were aligned with ITS genes of some Dunaliella strains registered at NCBI (http://www.ncbi.nlm.nih.gov/). First, the ITS sequence of each strain was aligned to each other using the clustalW program, and a phylogenetic tree was built from the aligned sequences using an unweighted pair group method with arithmetic mean (UPGMA) algorithm in the MEGA6 program to perform comparative analysis of a phylogenetic relationship. At this time, the Dunaliella ITS sequence which was subjected to comparison was obtained from the NCBI gene bank, and details are as follows (in parentheses, gene bank code): D. tertiolecta A2 (U66956), D. tertiolecta UTEX999 (AF313434, AF313435), D. salina UTEX1644 (AF313428, AF313429), D. salina CONC006 (AF313424, AF313425), D. salina CONC007 (AF313426, AF313427), D. bardawil strain ATCC30861 (AF313430, AF313431), D. lateralis (AF313444, AF313445), and C. reinhardtii (U66954).
[0116] As shown in
[0117] Based on this, the screened mutant of the present invention was identified as Dunaliella sp., named Dunaliella sp. MP3, and granted accession number KCTC 12990BP from the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Bioscience and Biotechnology (KRIBB).