POLYMERS AND USES THEREOF IN MANUFACTURING OF 'LIVING' HEART VALVES

Abstract

The present invention relates to a polymer having a first monomer selected from the group consisting of: styrene, MMA, HEMA or MEMA and a second monomer selected from the group consisting of: GMA, DEAEA, DEAEMA, DMAA, BAEMA, 4-vinylpyridine, DMVBA, 1-vinylimidazole, DMAEA or a combination thereof as coating agent for a scaffold or a medical device, to promote cellular adhesion and/or cell growth or for the manufacture of yarns or threads. The polymer may further contain a third monomer selected from the group consisting of: BMA, DEGMEMA, DAAA and MMA. The invention also relates to a scaffold, a medical device, a yarn, a thread or a textile coated or manufactured with the polymers of the invention and relative methods.

Claims

1. (canceled)

2. (canceled)

3. (canceled)

4. The scaffold or a medical device of claim 18 wherein the polymer further comprises a third monomer selected from the group consisting of: BMA, DEGMEMA, DAAA and MMA.

5. The scaffold or a medical device of claim 18 wherein the polymer comprises monomers selected from the group consisting of: a)-styrene and DMAA, b)-MMA and GMA or DEAEMA or DMAEA, c)-MEMA and DEAEA or DEAEMA or BAEMA or 4-vinylpyridine or GMA, and d)-HEMA and BAEMA or DMVBA or 1-vinylimidazole or 4-vinylpyridine.

6. The scaffold or a medical device of claim 18 wherein the ratio between the first monomer and the second monomer is between 40:60 and 90:10.

7. The scaffold or a medical device of claim 6 wherein the ratio between the first monomer and the second monomer is between 50:50 and 90:10.

8. The scaffold or a medical device of claim 4 wherein the ratio between the first monomer, the second monomer and the third monomer is between 40:30:30 and 60:30:10.

9. The scaffold or a medical device of claim 18 wherein the polymer is functionalized.

10. The scaffold or a medical device of claim 9 wherein the functionalization is carried out by an amine selected from the group consisting of: DnHA, DBnA, TEDETA, Mpi, TMPDA, DEMEDA, TMEDA, Pyrle, MAEPy, BnMA, MnHA, DcHA, cHMA, MAn, DnBA and DnHA.

11. The scaffold or a medical device of claim 18 wherein the polymer is PA6, PA98, PA309, PA316, PA317, PA321, PA338, PA426, PA438 (Ranked with a score 3 according to screening results), PA104, PA111, PA112, PA134, PA167, PA176, PA181, PA187, PA255, PA285, PA295, PA296, PA318, PA319, PA324, PA326, PA329, PA354, PA364, PA506, PA512, PA516, PA531 (Ranked with a score 2 according to screening results) as defined in Table I.

12. (canceled)

13. (canceled)

14. The scaffold or a medical device of claim 18, wherein the medical device is implantable or the scaffold is bio-absorbable.

15. The scaffold or a medical device of claim 14 wherein the medical device is selected from the group consisting of: heart valve substitute, heart valve implant, heart valve bio-artificial tissue, and heart valve tissue scaffold.

16. The scaffold or a medical device of claim 14, wherein the medical device comprises polycaprolactone.

17. (canceled)

18. A scaffold or a medical device coated with or comprising a polymer comprising: a) a first monomer selected from the group consisting of: styrene, MMA, HEMA and MEMA; and b) a second monomer selected from the group consisting of: GMA, DEAEA, DEAEMA, DMAA, BAEMA, 4-vinylpyridine, DMVBA, 1-vinylimidazole, and DMAEA.

19. The medical device according to claim 18 wherein said device is a tissue engineered heart valve (TEHV) prosthesis.

20. A yarn or a thread manufactured with a polymer comprising: a) a first monomer selected from the group consisting of: styrene, MMA, HEMA and MEMA; and b) a second monomer selected from the group consisting of: GMA, DEAEA, DEAEMA, DMAA, BAEMA, 4-vinylpyridine, DMVBA, 1-vinylimidazole, and DMAEA.

21. A textile manufactured with the yarn or thread according to claim 20.

22. The scaffold or medical device according to claim 18, further comprising: a) living cells produced by in vitro incubation and/or b) additional components selected from the group consisting of growth factors, DNA, RNA, proteins, peptides and therapeutic agents for treatment of disease conditions wherein said cells are attached to the polymer.

23. (canceled)

24. A method to coat a scaffold or a medical device with a polymer comprising: a) a first monomer selected from the group consisting of: styrene, MMA, HEMA and MEMA; and b) a second monomer selected from the group consisting of: GMA, DEAEA, DEAEMA, DMAA, BAEMA, 4-vinylpyridine, DMVBA, 1-vinylimidazole, and DMAEA comprising coating said scaffold or medical device with said polymer by a method selected from the group consisting of: grafting, dipping, spraying, electrospinning or 3D printing.

25. The textile according to claim 21 manufactured by electrospinning and/or embroidery.

26. A method for repair or replacement of tissue comprising: providing the scaffold or medical device according to claim 18, and locating the said scaffold or medical device on or in the body of a subject.

27. A 3-D printed scaffold manufactured with a polymer comprising: a) a first monomer selected from the group consisting of: styrene, MMA, HEMA and MEMA; and b) a second monomer selected from the group consisting of: GMA, DEAEA, DEAEMA, DMAA, BAEMA, 4-vinylpyridine, DMVBA, 1-vinylimidazole, and DMAEA.

Description

[0074] The present invention will be described through non-limitative examples, with reference to the following figures:

[0075] FIG. 1. Experimental flowchart illustrating the main actions performed to derive valve interstitial cells from the human AoV (A), to manufacture the polymer arrays to perform the primary screening (8), to scale up the identified hits (C), and to transfer the PA98 in the 3D environment by the use of a perfusion system allowing dynamic cell seeding into a PA98-coated PCL scaffold (D).

[0076] FIG. 2. Results of the primary polymer array screening. Panel A indicates two representative images of each spot of the hit polymers covered by cells and stained with DAPI for nuclear staining (Blue fluorescence), with phalloidin-TRITC for actin stress fibers (Red fluorescence), and antibodies recognizing -smooth muscle actin (Green fluorescence). Panel B shows cellular quantification/spot for each of the identified hit PAs, based on nuclei counting.

[0077] FIG. 3: Secondary screening of hit polymers on spin-coated glass slides. Panel A indicates an immunofluorescence staining for -smooth muscle actin (Green fluorescence) and Collagen I (white fluorescence), in conjunction with nuclear staining (blue fluorescence) and stress fibers by phalloidin-TRITC staining (red fluorescence). The bar graph shows the number of cells attached to the polymer. (B) To show regulation of genes potentially involved in VICs pathologic differentiation, expression of genes involved in osteogenesis was analyzed by q-RT-PCR amplification in cells cultured on each of the selected polymers. Results are expressed as fold change gene expression in VICs cultured onto each of the polymers for the indicated periods vs. the expression level observed in the cells before the beginning of the culture (reference line at fold change=1). * indicates P<0.05 in the comparison day 7 vs. day 14 by unpaired Student's t-test (n4).

[0078] FIG. 4: (A) The graphs on the top indicate a time course of PCL scaffold weight loss caused by dipping into Acetone (left) and PA98 loading following incubation into solutions with increasing PA98 concentrations. IR spectra confirmed coating of PA98 on PCL scaffolds (dipping time approx. 1 sec). (B) Scanning Electron Microscopy images of the PCL scaffold loaded with 1% (w/v) PA98 solution. The coating procedure preserved the PCL porous structure.

[0079] FIG. 5: Characterization of the 3D scaffolds after static or dynamic VICs seeding into a perfusion bioreactor system. (A) MTT staining of the un-coated (UC) and Polymer G-coated (C) PCL scaffolds seeded with the cells with or without perfusion for 24 hrs and 7 days. Results clearly indicate a higher efficiency in cell retention into the coated/perfused scaffolds in comparison with the other conditions. (B) Cell quantification by nuclear counting of cells per microscopic frame in transversal sections of dynamically seeded un-coated and coated scaffolds at the various time points. Analysis by 2-ways ANOVA with Bonferroni post-hoc test indicated a P<0.01 statistical significance in the difference between the number of cells in PA98-coated vs. uncoated scaffolds at all times. The insert shows a confocal microscopy image of sections of PA98-coated and un-coated scaffold seeded with VICs and stained with phalloidin-TRITC (red fluorescence) and -smooth muscle actin (green fluorescence). (C) Expression analysis of -Smooth Muscle Actin, Collagen I/111 and Versican genes in 14 days 3D cultured VICs in the indicated conditions. Results are expressed as fold change gene expression in VICs cultured in PA G-coated and uncoated vs. the expression level observed in the cells before the beginning of the culture (reference line at fold change=1).

[0080] FIG. 6: Results of mass-spec analysis of proteins released by human VICs in uncoated or PA98-coated PCL scaffolds. (A) Principal component analysis of differentially expressed proteins in the three VICs seeded uncoated and PA98-coated scaffolds. As shown, a clear separation of each of the three technical replicates for each aortic VICs samples was found between the coated (PA98) and uncoated (UC) scaffolds, highlighting a fundamentally different release of extracellular proteins. (B) Real Time PCR amplification of Elastin and MFAP-4 mRNAs from VICs cultured into the uncoated and PA98-coated PCL scaffolds. Data are expressed as relative expression data based on delta-CT values to show the variation level of transcripts in cells in the initial cellular population vs. those present in the scaffolds at the different time points. Statistical analysis by 1 way Anova with Tukey post-hoc did not reveal significant differences of the Elastin and MFAP-4 mRNAs, suggesting that the increase in MFAP-4 protein expression in PA98-coated scaffold is mainly due to a post-translational process.

DETAILED DESCRIPTION OF THE INVENTION

Experimental Procedures

Polymer Microarrays Preparation

[0081] Glass slides were soaked in 1M NaOH for 4 hours and cleaned thoroughly with distilled water. The cleaned slides were rinsed with acetone to remove the water and dried in ambient conditions before immersing in acetonitrile (15 mL) containing 1% (3-aminopropyl)triethoxysilane for 2 hours. Subsequently, the slides were cleaned with acetone (315 ml) and then placed into an oven (100 C.) for 1 hour. The aminosilane treated slides were collected and dip-coated with 1% agarose aqueous solution under 60 C. The agarose coated slides were left in ambient conditions for 24 hours before drying in a vacuum oven (45 C.) overnight. Polymer microarrays, containing 384 polymers (Table I), each printed in quadruplicate, were fabricated as previously reported [21].

TABLE-US-00001 TABLE 1 Polymer identity, monomer composition and results of the array screening Ratio (mol) PA number Monomer (1) Monomer (2) Monomer (3) M (1) M (2) M (3) Funct Rank 1 St DEAA 90 10 0 4 St DMAA 90 10 0 5 St DMAA 70 30 0 6 St DMAA 50 50 3 7 St PAA 90 10 0 8 St PAA 70 30 0 9 St PAA 50 50 1 10 MMA DEAA 90 10 1 11 MMA DEAA 70 30 1 12 MMA DEAA 50 50 1 13 MMA DMAA 90 10 0 14 MMA DMAA 70 30 0 15 MMA DMAA 50 50 0 16 MMA PAA 90 10 0 17 MMA PAA 70 30 1 19 MEMA DEAA 90 10 0 20 MEMA DEAA 70 30 0 21 MEMA DEAA 50 50 0 22 MEMA DMAA 90 10 1 23 MEMA DMAA 70 30 1 24 MEMA DMAA 50 50 0 25 MEMA PAA 90 10 0 26 MEMA PAA 70 30 0 27 MEMA PAA 50 50 0 28 MEA DEAA 90 10 0 30 MEA DEAA 50 50 0 31 MFA DMAA 90 10 0 32 MEA DMAA 70 30 0 33 MEA DMAA 50 50 0 34 MEA PAA 90 10 0 35 MEA PAA 70 30 0 37 HEMA DEAA 90 10 0 38 HEMA DEAA 70 30 0 39 HEMA DEAA 50 50 0 40 HEMA DMAA 90 10 0 41 HEMA DMAA 70 30 0 42 HEMA DMAA 50 50 0 43 HEMA PAA 90 10 0 44 HEMA PAA 70 30 0 45 HEMA PAA 50 50 0 46 HPMA DEAA 90 10 0 47 HPMA DEAA 70 30 0 48 HPMA DEAA 50 50 0 49 HPMA DMAA 90 10 0 50 HPMA DMAA 70 30 0 51 HPMA DMAA 50 50 0 52 HPMA PAA 90 10 0 53 HPMA PAA 70 30 0 54 HPMA PAA 50 50 0 55 HBMA DEAA 90 10 1 56 HBMA DEAA 70 30 1 57 HBMA DEAA 50 50 0 58 HBMA DMAA 90 10 0 59 HBMA DMAA 70 30 0 61 HBMA PAA 90 10 0 62 HBMA PAA 70 30 1 63 HBMA PAA 50 50 0 97 MEMA DEAEMA 70 30 0 98 MEMA DEAEMA 50 50 3 99 MEMA DMAEMA 90 10 0 100 MEMA DMAEMA 70 30 0 101 MEMA DMAEMA 50 50 0 102 MEMA DEAEA 90 10 0 102 MEMA DEAEA 90 10 0 103 MEMA DEAEA 70 30 0 104 MEMA DEAEA 50 50 2 105 MEMA DMAEA 90 10 0 106 MEMA DMAEA 70 30 0 108 MEMA MTEMA 90 10 0 109 MEMA MTEMA 70 30 1 110 MEMA MTEMA 50 50 0 111 MEMA BAEMA 90 10 2 112 MEMA BAEMA 70 30 2 114 MEMA DMAPMAA 90 10 0 115 MEMA DMAPMAA 70 30 0 116 MEMA DMAPMAA 50 50 0 117 MEMA BACOEA 90 10 0 118 MEMA BACOEA 70 30 0 119 MEMA BACOEA 50 50 0 120 MEMA DMVBA 90 10 0 121 MEMA DMVBA 70 30 0 123 MEMA VAA 90 10 0 124 MEMA VAA 70 30 0 126 MEMA VI 90 10 0 127 MEMA VI 70 30 0 128 MEMA VI 50 50 1 129 MEMA VPNO 90 10 0 130 MEMA VPNO 70 30 0 131 MEMA VPNO 50 50 0 133 MEMA VP-4 70 30 0 134 MEMA VP-4 50 50 2 135 MEMA VP-2 90 10 0 136 MEMA VP-2 70 30 0 137 MEMA VP-2 50 50 1 138 MEMA DAAA 90 10 0 139 MEMA DAAA 70 30 1 140 MEMA DAAA 50 50 0 141 MEMA MNPMA 90 10 0 142 MEMA MNPMA 70 30 0 143 MEMA MNPMA 50 50 1 150 HEMA DEAEMA 90 10 0 152 HEMA DEAEMA 50 50 1 153 HEMA DMAEMA 90 10 0 156 HEMA DEAEA 90 10 0 157 HEMA DEAEA 70 30 0 158 HEMA DEAEA 50 50 0 159 HEMA DMAEA 90 10 0 160 HEMA DMAEA 70 30 0 161 HEMA DMAEA 50 50 0 162 HEMA MTEMA 90 10 0 163 HEMA MTEMA 70 30 1 164 HEMA MTEMA 50 50 0 165 HEMA BAEMA 90 10 0 167 HEMA BAEMA 50 50 2 168 HEMA DMAPMAA 90 10 1 169 HEMA DMAPMAA 70 30 0 170 HEMA DMAPMAA 50 50 0 171 HEMA BACOEA 90 10 1 172 HEMA BACOEA 70 30 0 173 HEMA BACOEA 50 50 1 174 HEMA DMVBA 90 10 0 175 HEMA DMVBA 70 30 0 175 HEMA DMVBA 70 30 0 176 HEMA DMVBA 50 50 2 177 HEMA VAA 90 10 1 178 HEMA VAA 70 30 0 179 HEMA VAA 50 50 0 180 HEMA VI 90 10 1 181 HEMA VI 70 30 2 182 HEMA VI 50 50 0 184 HEMA VPNO 70 30 0 185 HEMA VPNO 50 50 1 186 HEMA VP-4 90 10 0 187 HEMA VP-4 70 30 2 189 HEMA VP-2 90 10 1 190 HEMA VP-2 70 30 1 192 HEMA DAAA 90 10 1 193 HEMA DAAA 70 30 0 194 HEMA DAAA 50 50 1 195 HEMA MNPMA 90 10 0 196 HEMA MNPMA 70 30 0 197 HEMA MNPMA 50 50 0 199 MMA A-H 70 30 0 200 MMA A-H 50 50 0 201 MMA AES-H 90 10 0 202 MMA AES-H 70 30 1 203 MMA AES-H 50 50 0 205 MMA MA-H 70 30 0 206 MMA MA-H 50 50 0 207 MMA AAG-H 90 10 0 208 MMA AAG-H 70 30 0 209 MMA AAG-H 50 50 0 214 MEMA A-H 70 30 1 215 MEMA A-H 50 50 0 216 MEMA AES-H 90 10 1 218 MEMA AES-H 50 50 1 222 MEMA AAG-H 90 10 0 223 MEMA AAG-H 70 30 0 228 MMA A-H DEAEMA 70 20 10 1 229 MMA A-H DEAEMA 70 15 15 1 230 MMA A-H DEAEMA 70 10 20 1 231 MMA A-H DEAEA 70 20 10 0 232 MMA A-H DEAEA 70 15 15 0 233 MMA A-H DEAEA 70 10 20 0 234 MMA MA-H DEAEMA 70 20 10 0 235 MMA MA-H DEAEMA 70 15 15 0 236 MMA MA-H DEAEMA 70 10 20 0 237 MMA MA-H DEAEA 70 20 10 0 238 MMA MA-H DEAEA 70 15 15 0 240 MEMA A-H DEAEMA 70 20 10 0 243 MEMA A-H DEAEA 70 20 10 0 245 MEMA A-H DEAEA 70 10 20 0 246 MEMA MA-H DEAEMA 70 20 10 0 248 MEMA MA-H DEAEMA 70 10 20 0 249 MEMA MA-H DEAEA 70 20 10 0 251 MEMA MA-H DEAEA 70 10 20 0 252 MEMA GMA 90 10 0 255 MEMA GMA 90 10 DnBA 2 258 MEMA GMA 90 10 DnHA 0 260 MEMA GMA 50 50 DnHA 0 262 MEMA GMA 70 30 DcHA 0 264 MEMA GMA 90 10 DBnA 0 267 MEMA GMA 90 10 MnHA 0 268 MEMA GMA 70 30 MnHA 1 273 MEMA GMA 90 10 BnMA 0 279 MEMA GMA 90 10 Pyre 0 280 MEMA GMA 70 30 Pyre 0 281 MEMA GMA 50 50 Pyre 1 285 MEMA GMA 90 10 MAn 2 291 MEMA GMA 90 10 DEMEDA 0 294 MEMA GMA 90 10 TMPDA 1 295 MEMA GMA 70 30 TMPDA 2 296 MEMA GMA 50 50 TMPDA 2 303 MMA GMA 90 10 1 304 MMA GMA 70 30 0 305 MMA GMA 50 50 1 306 MMA GMA 90 10 DnBA 1 309 MMA GMA 90 10 DnHA 3 316 MMA GMA 70 30 DBnA 3 317 MMA GMA 50 50 DBnA 3 318 MMA GMA 90 10 MnHA 2 319 MMA GMA 70 30 MnHA 2 321 MMA GMA 90 10 cHMA 3 322 MMA GMA 70 30 cHMA 1 323 MMA GMA 50 50 cHMA 1 324 MMA GMA 90 10 BnMA 2 325 MMA GMA 70 30 BnMA 0 326 MMA GMA 50 50 BnMA 2 327 MMA GMA 90 10 MAEPy 0 329 MMA GMA 50 50 MAEPy 2 330 MMA GMA 90 10 Pyrle 0 331 MMA GMA 70 30 Pyrle 0 332 MMA GMA 50 50 Pyrle 0 336 MMA GMA 90 10 MAn 0 338 MMA GMA 50 50 MAn 3 339 MMA GMA 90 10 TMEDA 0 341 MMA GMA 50 50 TMEDA 0 342 MMA GMA 90 10 DEMEDA 1 343 MMA GMA 70 30 DEMEDA 0 345 MMA GMA 90 10 TMPDA 0 348 MMA GMA 90 10 Mpi 0 349 MMA GMA 70 30 Mpi 0 353 MMA GMA 50 50 TEDETA 0 354 MMA DEAEMA 90 10 2 355 MMA DEAEMA 70 30 1 356 MMA DEAEMA 50 50 1 357 MMA DMAEMA 90 10 1 359 MMA DMAEMA 50 50 0 360 MMA DEAEA 90 10 1 361 MMA DEAEA 70 30 1 363 MMA DMAEA 90 10 0 364 MMA DMAEA 70 30 2 365 MMA DMAEA 50 50 0 366 HPMA DEAEMA 90 10 0 367 HPMA DEAEMA 70 30 0 368 HPMA DEAEMA 50 50 0 369 HPMA DMAEMA 90 10 0 370 HPMA DMAEMA 70 30 0 371 HPMA DMAEMA 50 50 0 372 HPMA DEAEA 90 10 0 374 HPMA DEAEA 50 50 0 375 HPMA DMAEA 90 10 0 376 HPMA DMAEA 70 30 0 377 HPMA DMAEA 50 50 0 378 HBMA DEAEMA 90 10 1 380 HBMA DEAEMA 50 50 0 381 HBMA DMAEMA 90 10 1 382 HBMA DMAEMA 70 30 0 384 HBMA DEAEA 90 10 0 385 HBMA DEAEA 70 30 0 386 HBMA DEAEA 50 50 0 387 HBMA DMAEA 90 10 0 389 HBMA DMAEA 50 50 0 390 EMA DEAEMA 90 10 1 391 EMA DEAEMA 70 30 0 392 EMA DEAEMA 50 50 0 393 EMA DMAEMA 90 10 1 394 EMA DMAEMA 70 30 0 395 EMA DMAEMA 50 50 1 396 EMA DEAEA 90 10 1 397 EMA DEAEA 70 30 0 398 EMA DEAEA 50 50 0 399 EMA DMAEA 90 10 1 400 EMA DMAEA 70 30 1 401 EMA DMAEA 50 50 1 402 BMA DEAEMA 90 10 0 403 BMA DEAEMA 70 30 0 404 BMA DEAEMA 50 50 0 405 BMA DMAEMA 90 10 0 406 BMA DMAEMA 70 30 1 407 BMA DMAEMA 50 50 0 408 BMA DEAEA 90 10 1 410 BMA DEAEA 50 50 0 411 BMA DMAEA 90 10 1 412 BMA DMAEA 70 30 0 413 BMA DMAEA 50 50 0 414 MEMA DEAEMA MA 40 30 30 1 415 MEMA DEAEMA MA 60 10 30 0 416 MEMA DEAEMA MA 60 30 10 0 417 MEMA DEAEMA MA 80 10 10 0 418 MEMA DEAEA MA 40 30 30 0 419 MEMA DEAEA MA 60 10 30 1 420 MEMA DEAEA MA 60 30 10 0 421 MEMA DEAEA MA 80 10 10 0 422 MEMA DEAEMA BMA 40 30 30 0 423 MEMA DEAEMA BMA 60 10 30 0 424 MEMA DEAEMA BMA 60 30 10 1 425 MEMA DEAEMA BMA 80 10 10 0 426 MEMA DEAEA BMA 40 30 30 3 428 MEMA DEAEA BMA 60 30 10 0 429 MEMA DEAEA BMA 80 10 10 1 430 MEMA DEAEMA MEA 40 30 30 0 431 MEMA DEAEMA MEA 60 10 30 0 432 MEMA DEAEMA MEA 60 30 10 1 433 MEMA DEAEMA MEA 80 10 10 1 434 MEMA DEAEA MEA 40 30 30 0 435 MEMA DEAEA MEA 60 10 30 0 436 MEMA DEAEA MEA 60 30 10 1 437 MEMA DEAEA MEA 80 10 10 0 438 MEMA DEAEMA DEGMEMA 40 30 30 3 443 MEMA DEAEA DEGMEMA 60 10 30 0 444 MEMA DEAEA DEGMEMA 60 30 10 1 448 MEMA DEAEMA THFFA 60 30 10 1 450 MEMA DEAEA THFFA 40 30 30 0 452 MEMA DEAEA THFFA 60 30 10 0 453 MEMA DEAEA THFFA 80 10 10 0 458 MEMA DEAEA THFFMA 40 30 30 0 459 MEMA DEAEA THFFMA 60 10 30 1 460 MEMA DEAEA THFFMA 60 30 10 0 465 MEMA DEAEMA HEA 80 10 10 0 467 MEMA DEAEA HEA 60 10 30 0 468 MEMA DEAEA HEA 60 30 10 0 469 MEMA DEAEA HEA 80 10 10 0 470 MEMA DEAEMA HEMA 40 30 30 0 474 MEMA DEAEA HEMA 40 30 30 0 475 MEMA DEAEA HEMA 60 10 30 0 476 MEMA DEAEA HEMA 60 30 10 0 477 MEMA DEAEA HEMA 80 10 10 1 481 MEMA DEAEMA A-H 80 10 10 1 485 MEMA DEAEA A-H 80 10 10 0 493 MEMA DEAEA MA-H 80 10 10 0 496 MEMA DEAEMA DMAA 60 30 10 0 497 MEMA DEAEMA DMAA 80 10 10 0 500 MEMA DEAEA DMAA 60 30 10 0 501 MEMA DEAEA DMAA 80 10 10 0 502 MEMA DEAEMA DAAA 40 30 30 1 503 MEMA DEAEMA DAAA 60 10 30 0 506 MEMA DEAEA DAAA 40 30 30 2 507 MEMA DEAEA DAAA 60 10 30 1 508 MEMA DEAEA DAAA 60 30 10 0 509 MEMA DEAEA DAAA 80 10 10 1 511 MEMA DEAEMA MMA 60 10 30 0 512 MEMA DEAEMA MMA 60 30 10 2 513 MEMA DEAEMA MMA 80 10 10 1 514 MEMA DEAEA MMA 40 30 30 1 515 MEMA DEAEA MMA 60 10 30 0 516 MEMA DEAEA MMA 60 30 10 2 517 MEMA DEAEA MMA 80 10 10 1 518 MEMA DEAEMA St 40 30 30 0 519 MEMA DEAEMA St 60 10 30 1 520 MEMA DEAEMA St 60 30 10 1 522 MEMA DEAEA St 40 30 30 1 523 MEMA DEAEA St 60 10 30 0 525 MEMA DEAEMA 85 15 0 526 MEMA DEAEMA 80 20 0 527 MEMA DEAEMA 75 25 0 528 MEMA DEAEMA 70 30 0 529 MEMA DEAEMA 65 35 1 530 MEMA DEAEMA 60 40 0 531 MEMA DEAEMA 55 45 2 532 MEMA A-H DEAEMA 85 5 10 0 533 MEMA A-H DEAEMA 80 5 15 0 534 MEMA A-H DEAEMA 75 5 20 0 535 MEMA A-H DEAEMA 70 5 25 0 536 MEMA A-H DEAEMA 65 5 30 0 537 MEMA A-H DEAEMA 60 5 35 0 538 MEMA A-H DEAEMA 55 5 40 0 539 MEMA A-H DEAEMA 50 5 45 0 540 MEMA A-H DEAEMA 75 10 15 0 541 MEMA A-H DEAEMA 70 10 20 0 542 MEMA A-H DEAEMA 65 10 25 1 543 MEMA A-H DEAEMA 55 10 35 0 544 MEMA A-H DEAEMA 50 10 40 0 545 MEMA A-H DEAEMA 65 15 20 0 546 MEMA A-H DEAEMA 60 15 25 0 547 MEMA A-H DEAEMA 55 15 30 0 548 MEMA A-H DEAEMA 50 15 35 0 549 MEMA A-H DEAEMA 55 20 25 0 550 MEMA A-H DEAEMA 50 20 30 0 551 MEMA A-H DEAEMA 90 5 5 0 552 MEMA A-H DEAEMA 80 15 5 0 553 MEMA A-H DEAEMA 70 25 5 0 554 MEMA A-H DEAEMA 60 35 5 0 555 MEMA A-H DEAEMA 50 45 5 0 556 MEMA A-H DEAEMA 50 40 10 0 557 MEMA A-H DEAEMA 60 25 15 0 558 MEMA A-H DEAEMA 50 35 15 0 559 MEMA A-H DEAEMA 60 20 20 0 560 MEMA A-H DEAEMA 50 30 20 0 561 MEMA A-H DEAEMA 50 25 25 0 562 St GMA 90 10 0 563 St GMA 70 30 0 564 HBMA VP-2 50 50 0

TABLE-US-00002 TABLE II Nomenclature of the monomers Monomer Nomenclature Name AAG-H 2-acrylamidoglycolic acid AES-H mono-2-(acryloyoxy)ethyl succinate A-H acrylic acid BAEMA 2-(tert-butylamino)ethyl methacrylate BACOEA 2-[[(butylamino)carbonyl]oxy]ethyl acrylate BMA n-butyl methacrylate DAAA diacetone acrylamide DEAA diethylacrylamide DEAEA 2-(diethylamino)ethyl acrylate DEAEMA diethylaminoethyl methacrylate DEGMEMA di(ethyleneglycol) methyl ether methacrylate DMAA dimethyl acrylamide DMAPMAA N-[3-(dimethylamino)propyl] methacrylamide DMVBA N,N-dimethylvinylbenzylamine EMA ethyl methacrylate GMA glycidyl methacrylate HBMA hydroxybutyl methacrylate HEA 2-hydroxyethyl acrylate HEMA 2-hydroxyethyl methacrylate HPMA hydroxypropylmethacrylate MA methyl Acrylate MA-H methacrylic acid MEA 2-methoxyethyl acrylate MMA methyl methacrylate MEMA methoxyethyl methacrylate MTEMA 2-(methylthio)ethyl methacrylate MNPMA 2-methyl-2-nitropropyl methacrylate PAA N-isopropyl acrylamide St styrene THFFA tetrahydrofurfuryl acrylate THFFMA tetrahydrofurfuryl methacrylate VAA N-vinylacetamide VI 1-vinylimidazol VP-2 2-vinylpyridine VP-4 4-vinylpyridine VPNO 1-vinyl-2-pyrrolidinone

TABLE-US-00003 TABLE III Nomenclature of the amines use in the derivatized polymers Amine Nomenclature Name BnMA N-benzylmethylamine cHMA cyclohexanemethylamine DBnA dibenzylamine DcHA dicyclohexylamine DnHA di-n-hexylamine DEMEDA N,N-diethyl-N-methylethylenediamine DnBA di-n-butylamine MAEPy 2-(2-methylaminoethyl)pyridine MAn N-methylailine MnHA N-methylhexylamine Mpi 1-methylpiperazine Pyrle pyrrole TEDETA N,N,N,N-tetraethyldiethylenetriamine TMEDA N,N,N-trimethylethylenediamine TMPDA N,N,N-trimethyl-1,3-propanediamine

[0082] Solutions (1% w/v) of the polymers in N-methylpyrrolidone (NMP) were placed into microwell plates and then printed on agarose-coated slides using a contact printer (QArraymini, Genetix, UK) with 32 aQu solid pins (K2785, Genetix). The printing conditions were 5 stamps per spot, with a 100 sec.sup.3 inking timing and a 200 sec.sup.3 stamping time. The printed slides were dried in a vacuum oven (45 C.) overnight to remove the remaining NMP. Polymer microarrays were sterilized for 30 min under UV light before using for cell culture.

Human-Derived Aortic Valve Interstitial Cells Isolation and Culture

[0083] Primary human aortic valve interstitial cells VICs were isolated by enzymatic dissociation of surgically removed AoVs at the time of after surgical valve replacement. Samples were collected for research use, after approval by the Local Ethical committee, and upon informed consent of the patient. Briefly, the isolation protocol, as previously described in [22], started with the incubation of the healthy (non-calcific) portions of the leaflets for 5 minutes on shaker at 37 C. in Collagenase Type II solution (1000 U/ml, Worthington), to remove the endothelial layer. A second incubation for 2 hrs under the same conditions served for aVICs isolation. Cells were plated for ex-vivo amplification on a 1% gelatin coated plastic cell culture dishes (10 cm diameter), and cultured in a complete medium, made of DMEM (Lonza) supplemented with 150 U/ml penicillin/streptomycin (Sigma Aldrich), 2 mM L-glutamine (Sigma Aldrich) and 10% bovine serum (HyClone, Thermo Scientific). Cells were expanded for up to four passages before being employed for experiments.

Polymers Microarray Screening

[0084] Following expansion, aortic VICs isolated from 3 independent donors were seeded (310.sup.5 cells/array) and cultured for 72 h onto PAs microarrays in duplicate. The arrays were housed in an purpose-made manufactured polycarbonate chamber, designed to circumscribe an area around the array, optimizing the seeding efficiency and minimizing the volume of media. At the end of the culture period, arrays were fixed in 4% paraformaldehyde (4% PFA) for 20 minutes, washed in phosphate buffered saline (PBS) and stained for 4,6-diamidin-2-fenilindole (DAPI), phalloidin, vimentin, collagen type I and alpha smooth muscle actin (SMA). Immunofluorescence images were acquired using a Nikon Eclipse TE200 or a Zeiss Apotome fluorescence microscope (Carl Zeiss, Jena, Germany), through z-stack reconstruction. The adhesion of VICs on the different PAs after 72 hours of culture was evaluated using automated counting of the number of nuclei per spot: cell nuclei stained with DAPI were quantified by implementation of the Analyze Particles tool of ImageJ software (National Institute of Health, Bethesda, Md.). In order to derive a priority list of the materials to be implemented in a secondary screening, criteria to obtain a ranking of the PA success to induce cell adhesion were established. PAs were then classified by assigning a score=3 to PAs that promoted adhesion of the cells from all donors on at least 3 out of 4 materials replica spots averaged on all tested arrays; a score=2 to PAs promoting adhesion on at least 2 out of 4 materials replica spots; a score=1 to PAs promoting adhesion on at least 1 out of 4 materials replica spots, and a score=0 to all the others.

Scale-Up and Validation of Hit Polymers

[0085] Seven out of the nine hit polymers identified from microarray primary screening according to the criteria described above, were synthesized by free-radical polymerization and characterized by gel permeation chromatography (GPC) and infrared spectroscopy (IR). GPC was conducted on an Agilent 1100 instrument, fitted with a PLGel 5 m MIXED-C column (3007.5 mm), with NMP as the eluent (flow rate 1 mL min.sup.1). The GPC was pre-calibrated using polystyrene standards. IR analysis was conducted using a Brucker Tensor 27 spectrometer.

[0086] Polymers were spin-coated onto circular glass coverslips. Two sizes of cover slips were used, 19 mm and 32 mm, respectively dedicated to immunofluorescence and gene expression analysis. Polymer solutions in THF (2% w/v) were spin-coated at 2000 rpm for 10 seconds using a desktop spin coater (6708D, Speedline technologies). The coated coverslips were dried in a convection oven at 40 C. overnight and sterilized using UV light prior to using for cell culture and housed in either 6- or 12-well plates previously coated with agarose (1% w/v). Coated coverslips, before use, were sterilised with UV light for 30 min.

aVICs Culture onto 2-D Scale-Up Coated Coverslips

[0087] aVICs were seeded onto coated coverslips at a cell density of 2000 cell/mm.sup.2. Following 7 days of culture, immunofluorescence analysis (3 independent cell donors) were performed including staining for Phalloidin, Collagen type I, SMA and DAPI. Images were acquired by confocal microscopy (LSM 710; Carl Zeiss, Jena, Germany). Automated cell counting (ImageJ) of nuclei per frame (A=0.7 mm.sup.2) was performed, averaging the results of 3 frames per sample.

[0088] RNA was extracted from cells cultured on the scale-up system for 7 and 14 days, with Tripure reagent (Roche Diagnostics). Quantitative real-time PCR (qRT-PCR) amplifications were performed for GAPDH, BMP2, OPN, ALP, RUNX2 (primers details in Table2), using Power SYBR Green PCR Master Mix (Applied Biosystems) on a 7900 Fast Real-Time PCR System (Applied Biosystems). Gene expression levels are expressed in fold increase referred to housekeeping gene (GAPDH) at seeding.

TABLE-US-00004 TABLEIV PCRPrimers SEQ ID Gene Direction Sequence NOs: hALP Forward TCACTCTCCGAGATGGTGGT 1 hALP Reverse GTGCCCGTGGTCAATTCT 2 hRunx2 Forward TCTGGCCTTCCACTCTCAGT 3 hRunx2 Reverse GACTGGCGGGGTGTAAGTAA 4 hOPN Forward GAGGGCTTGGTTGTCAGC 5 hOPN Reverse CAATTCTCATGGTAGTGAGTTTTCC 6 hBMP2 Forward TGTATCGCAGGCACTCAGGTC 7 hBMP2 Reverse TTCCCACTCGTTTCTGGTAGTTCTT 8 hCOL Forward GGACACAGAGGTTTCAGTGG 9 I hCOL Reverse CCAGTAGCACCATCATTTCC 10 I hCOL Forward AGCTACGGCAATCCTGAACT 11 III hCOL Reverse GGGCCTTCTTTACATTTCCA 12 III hACTA2 Forward AGAGTTACGAGTTGCCTGATG 13 hACTA2 Reverse CTGTTGTAGGTGGTTTCATGGA 14 hVCAN Forward AACTTCCTACGTATGCACCTG 15 hVCAN Reverse AAGTGGCTCCATTACGACAG 16
Transfer in 3DScaffolds Coating with PA98

[0089] A Polycaprolactone (PCL) scaffold (Mimetix Electrospinning Company, Cambridge, UK) with a 2 mm thickness, a 2 cm diameter and 100 m pore size, was used for 3D experiments, either as supplied (uncoated) or after coating with PA98. After removing the backing paper, coating was performed by dipping the scaffolds in a solution of PA G dissolved in acetone and air dried into a polypropylene 48-well plates in a fume hood. Coating time and concentration of polymer solution were experimentally set to respectively circa 1 sec and 1% w/v, after evaluating scaffold integrity and polymer loading by scanning electron microscopy (SEM) and IR spectroscopy. SEM was conducted using a Hitachi 4700 II cold Field-emission Scanning Electron Microscope while IR analysis was conducted using a Brucker Tensor 27 spectrometer. Scaffolds, uncoated or coated under these optimized conditions, were sterilized by 72 hours incubation in BASE128 (AL.CHI.MIA s.r.l.), an EC certified decontamination solution containing an antibiotic/antifungal mixture (Gentamicin, Vancomycin, Cefotaxime and Amphotericin B) and approved for employment in Tissue Banking.

Transfer in 3DBioreactor-Assisted VICs Seeding and Culture

[0090] 8 mm diameter cylinders of uncoated and coated scaffolds were seeded (910.sup.3 cells/scaffold) and cultured statically or dynamically for 1, 7 and 14 days, with aVICs isolated from 5 independent donors. For static seeding, scaffolds were housed in agarose-coated multiwells and a small volume of cell suspension (50 l/scaffold, 1.510.sup.5 cells/scaffold) was slowly dispersed over the top surface. Cells were allowed to adhere to the scaffolds for 2 hours, before gently adding 2 ml of medium to cover the scaffold. Dynamic culture was performed using the U-CUP bioreactor (Cellec Biotek AG, Basel, CH), a previously described direct perfusion system [23]. In our experiment VICs (4.510.sup.5 cells/scaffold) suspended in 9 ml complete medium were perfusion-seeded into the scaffolds at a 3 ml/min flow rate for 16 hours [24]. Thereafter, scaffolds were either harvested (day 1 experimental time point) or, following complete medium renewal, further cultured under perfusion at a 0.3 ml/min flow rate for 7 or 14 days. Medium change was performed twice per week. At harvest, replicas of both static and perfused samples were rinsed in PBS and cut into two halves, in order to proceed with different tests.

[0091] For RNA extraction, cellularized scaffolds were incubated in 500 l Trizol reagent and RNA was isolated using the Direct-Zol RNA kit (Zhymo Research). Quantitative real-time PCR (qRT-PCR) amplifications were performed for GAPDH, COLI, COLIII, BMP2, OPN, ALP, RUNX2, ACTA2, VCAN (primers details in Table 1), using Power SYBR Green PCR Master Mix (Applied Biosystems) on a 7900 Fast Real-Time PCR System (Applied Biosystems). Gene expression levels are expressed in fold increase referred to housekeeping gene (GAPDH) at seeding.

[0092] Incubation of specimens for 3 h with 0.12 mM MTT (3(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Producer) was performed to qualitatively highlight cell distribution onto the scaffold. To perform histology and immunofluorescence analysis, after overnight fixation at 4 C. in PFA (4%), samples were incubated overnight at 4 C. in sucrose (15%), and, finally, included in a solution of sucrose (15%) and bovine skin gelatin (7.5%, Sigma Aldrich). Transversal cross-sections (10 m thickness), obtained by cryo-sectioning, were stained with DAPI, Phalloidin and SMA/Collagen I antibodies. Cell nuclei quantification was obtained by analyzing 3 transversal sections per each donor and condition (acquiring the whole section length).

Sample Preparation for Mass Spectrometry

[0093] Coated and uncoated scaffolds used for the culture of VICs from 3 different donors were cut in small pieces 1 mm2 and subsequently washed 3 times with PBS. In order to decellularize the scaffolds, the samples were incubated with 500 l of 0.25% v/v Triton X-100 (Sigma Aldrich) at 37 C. for 15 minutes with gentle agitation. After removal of the supernatant, containing cells, scaffold samples were vigorously washed 7 times with ice cold water to completely eliminate Triton X-100. 100 l of 25 mmol/L NH4HCO3 containing 0.1% w/v RapiGest SF were then added for tryptic digestion. Samples were reduced with 5 mmol/L TCEP (tris(2-carboxyethyl)phosphine), dissolved in 100 mmol/L NH4HCO3, at room temperature for 30 min, and then carbamidomethylated with 10 mmol/L iodacetamide for 30 min at room temperature. Digestion was performed overnight at 37 C. using 0.5 g of sequencing grade trypsin (Promega, Milan, Italy). After digestion, 2% v/v TFA was added to hydrolyse RapiGest SF and inactivate trypsin, and the solution was incubated at 37 C. for 40 min before being vortexed and centrifuged at 13,000 g for 10 minutes to eliminate RapiGest SF.

Label-Free LC-MSE Analysis

[0094] Tryptic digests from coated and uncoated samples were then prepared adding yeast alcohol dehydrogenase (ADH) digest and Hi3 E. coli standards (Waters Corporation, Milford, Mass., USA) at the final concentration of 12.5 fmol/l, as internal standards for molar amount estimation (Silva 2006) and quality controls.

[0095] Tryptic peptides separation was conducted with a TRIZAIC nanoTile (Waters Corporation, Milford, Mass., USA) using a nano-ACQUITY-UPLC System coupled to a SYNAPT-MS Mass Spectrometer equipped with a TRIZAIC source (Waters Corporation, Milford, Mass., USA). The TRIZAIC nanoTile used for this study, Acquity HSS T3, integrates a trapping column (5 m, 180 m20 mm) for desalting and an analytical column (1.8 m, 85 m100 mm) for peptide separation with an high level of reproducibility of retention time. Elution was performed at a flow rate of 550 nL/min by increasing the concentration of solvent B (0.1% formic acid in acetonitrile) from 3 to 40% in 90 min, using 0.1% formic acid in water as reversed phase solvent A[25]. 4 l of tryptic digest were analysed in triplicate for each biological sample. Calibration and lockmass correction were performed as previously described[26]. Precursor ion masses and their fragmentation spectra were acquired in MSE mode as previously described[26] in order to obtain a qualitative and quantitative analysis of proteins associated with coated and uncoated scaffolds.

[0096] The software Progenesis QI for proteomics (Version 2.0, Nonlinear Dynamics, Newcastle upon Tyne, UK) was used for the quantitative analysis of peptide features and protein identification. Analysis of the data by Progenesis QI included retention time alignment to a reference sample selected by the software, feature filtering (based on retention time and charge (>2)), normalization considering all features, peptide search and multivariate statistical analysis. The principle of the search algorithm has been previously described in detail (Li 2009). The following criteria were used for protein identification:1 missed cleavage, Carbamidomethyl cysteine fixed and methionine oxidation as variable modifications. A UniProt database (release 2015-3; number of human sequence entries, 20199; number of bovin sequence entries, 6870) was used for database searches.

[0097] Fold changes in the quantitative expression, p-value and Q-value were calculated with the statistical package included in Progenesis QI for proteomics, using only peptides uniquely associated to the proteins to quantify proteins that were part of a group. A p-value<0.05 was considered significant. The significance of the regulation level was determined at a 20% fold change, but only proteins quantified with at least 2 peptides were considered. The entire data set of differentially expressed proteins was further filtered, after manual inspection of the results, by considering only the proteins with the same modulation in at least two out of three biological replicates. The data set was also subjected to unsupervised PCA analysis.

Results

Polymer Array Screening Revealed a Selected Number of Polymers Compatible for Human Valve Interstitial Cells (VICs) Culture

[0098] Primary array screening allowed simultaneous evaluation of the adhesion of VICs on the 384 polymer library spotted onto the array. The average number of cells adhered on each polymer was employed as a quantitative criteria to select polymers promoting aVICs adhesion. Based on automated cell counting (ImageJ) performed on the nuclear staining by DAPI seven polymers reproducibly supported VICs adhesion by all the donors (FIG. 2A). As shown in FIG. 2B, the number of cells ranged between 183 to 606 (meanSE).

TABLE-US-00005 TABLE V Nomenclature and chemical composition of the selected hit polymers Ratio (mol) PA number Monomer (1) Monomer (2) Monomer (3) M (1) M (2) M (3) Functionalization PA98 MEMA DEAEMA 50 50 None PA309 MMA GMA 90 10 DnHA PA316 MMA GMA 70 30 DBnA PA317 MMA GMA 50 50 DBnA PA321 MMA GMA 90 10 cHMA PA338 MMA GMA 50 50 MAn PA426 MEMA DEAEA BMA 40 30 30 None

2D Scale Up

[0099] 7 hit polymers identified in the primary screening were then tested in a scale up experiment onto a series of glass slides coated with each of the selected polymers. This confirmed that all the selected polymers supported human VICs adhesion. The number of nuclei per frame, again quantified by automatic counting of DAPI-stained nuclei, is reported in FIG. 3A, with a representative immunofluorescence to detect cytoskeleton polymerization, expression of smooth muscle actin- (SMA) and Collagen I in polymer adhered VICs. This latter analysis was performed adopting the same photo-multiplication setting in confocal imaging, thus allowing detection of variable levels of the two markers, which suggests different degree of VIC myofibroblast conversion onto the selected polymers.

[0100] In order to detect whether culture onto the different polymers affected the expression of crucial genes involved in VIC conversion into osteogenic cells, the expression of the genes encoding for the bone morphogenetic protein 2 (BMP2), Alkaline phosphatase (ALP), Osteopontin (OPN) and the transcription factor Runx2 (RUNX2), were assessed by real time RT-PCR (FIG. 3B) at 7 and 14 days of culture onto the PAs-coated glass slides. These results were compared to each other and with the expression levels of the genes in cells cultured in standard culture plates. The results clearly indicated polymers (PA338, PA309, PA316, PA98) onto which VICs underwent a transient upregulation of the tested genes at 7 days followed by return to steady levels at day 14, and polymers that maintained higher levels of the genes at both times.

[0101] These data demonstrate the feasibility of polymers employment as novel materials to manufacture off-the-self tissue engineered heart valves by employing VICs.

Coating of a 3D PCL Scaffold with PA98

[0102] Based on the results of the immune-histochemistry and the Q-RT-PCR, PA98 was chosen as a reference material to perform functionalization of the 3D PCL scaffold and perform 3D culture of human VICs. Fast evaporating solvents, acetone and tetrahydrofuran (THF), were investigated for their ability to solubilize PA98. Although THF dissolved the scaffold immediately, acetone maintained the relative stability of the PCL material. Further tests were then conducted with acetone. This included dipping for decreasing amounts of time followed by weighing to assess the weight loss after overnight drying in a fume hood. Weight loss was determined to be 59.2%, 15.8% and 3.5% for 5, 2 and 1 minutes dipping, respectively (FIG. 4A). Due to the excessive weight loss suffered by the scaffolds, even with 1 minute dipping, further tests were conducted by dipping the scaffolds in acetone for either 10 sec or 5 sec and the average weight loss was determined to be 1.9% and 1.5% respectively, as shown in the table VI below (n=3).

TABLE-US-00006 TABLE VI Average weight loss Dipping Weight of Weight % weight time scaffold (gm) loss (gm) loss 10 secs 0.03262 0.00083 2.5 10 secs 0.03592 0.00076 2.1 10 secs 0.03367 0.00032 1.0 5 secs 0.03259 0.00067 2.1 5 secs 0.03370 0.00065 1.9 5 secs 0.03325 0.00022 0.7

[0103] Integrity of fibres within the scaffold was tested by comparing SEM images of dried scaffolds treated with acetone (dipping time 5 sec) or untreated scaffolds. This confirmed Acetone as a suitable solvent for coating. Since the porous structure of the scaffold is crucial for penetration and uniform distribution of cells during seeding with the bioreactor, the influence of concentration of polymer solution was then studied to avoid clogging of the mesh. PCL scaffolds were finally dip-coated for 1 sec with PA98 dissolved in acetone at 0.1%, 0.5%, or 1% (w/v) concentration, and dried (see table VII and FIG. 4A)

TABLE-US-00007 TABLE VII Scaffold preparation PA98 concentration Weight of Weight gain % polymer (w/v) scaffold (gm) (gm) loading 1.0% 0.03411 0.00545 16.0% 0.5% 0.03205 0.00248 7.7% 0.1% 0.03182 0.00011 0.3%

[0104] SEM revealed that, a gradient existed for the polymer loading within the scaffold for all the concentrations studied, with the bottom part of the scaffold containing more PA98 than the top part, even with a 1% polymer solution, the scaffolds retained their pores (FIG. 4B). After the SEM studies, in order to further reduce the dipping time during coating and minimize the possible PCL fibres damage, loading on the scaffolds was determined for a brief dipping time of approximately 1 sec. IR spectroscopy revealed that under these conditions, polymer loading was found to increase from 0.3% to 7.7% and 16%, respectively with 0.1%, 0.5% and 1% solutions respectively (FIG. 4A).

VICs Culture into the PA98 Coated 3D Scaffold

[0105] VICs were seeded into the PA98-coated scaffold either by static or dynamic seeding followed by culturing for a period up to 14 days. The efficiency of the two scaffold cellularization procedures was monitored by MTT staining of the scaffolds at 1, 7 and 14 days after the beginning of the culture (FIG. 5A). While static seeding only relied on the ability of VICs to invade the porous structure of the coated/uncoated PCL scaffolds, the application of a forced perfusion determined a more uniform distribution of the cells in depth into the 3D environment. This was evident from the higher MTT levels observed in the coated and uncoated scaffolds cellularized by the dynamic VICs seeding, particularly at day 7. Furthermore, although the untreated PCL was able to host VICs on its own, coating of the scaffold with PA98 increased VICs content at all times after seeding, as evaluated by nuclear counting in sections of cellularized scaffolds by forced perfusion (FIG. 5B). This confirms the indication of the coated PCL scaffolds to host VICs for artificial valve tissue engineering provided in previous studies [27, 28] and indicated an the increased colonization and uniformity of cellular distribution in the 3D environment coated with PA98.

[0106] A gene expression survey was performed to assess the expression of valve relevant genes in VICs seeded into the 3D scaffolds. This analysis included mRNAs encoding for the human SMA gene and for extracellular matrix components produced by VICs in the valve tissue such as Collagen I/111 and Versican Glycosamino-Glycan (GAG). As shown in FIG. 5C, none of these genes was major changed by seeding VICs in the 3D environment and by PA98 scaffold functionalization.

[0107] To explore the ability of the PA98-coated scaffold to promote deposition of extracellular matrix components inventors therefore performed a mass-spectrometry-based high-throughput and high-resolution quantification of the proteins secreted by VICs after 14 days culture on PA98-coated versus uncoated PCL scaffolds. This analysis was performed with the aim at deciphering the ability of the selected PA to promote matrix maturation inside the scaffold. The proteins released by the cells into PA98-coated and uncoated PCL scaffolds were analyzed by means of a label-free MS-based proteomic approach, LC-MSE, which allows both a qualitative and quantitative comparative analysis between coated and uncoated samples. Data processing compared a total of 1503 peptides corresponding to 100 human proteins and revealed that 12 of them were more abundant in coated scaffolds samples whereas 12 were less abundant, discriminating the two samples in the three biological replicates (FIG. 6A). Tables VIII and IX show, respectively, the list of the proteins identified in the PA98-coated and uncoated scaffolds ordered for fold change and statistical significance. As shown, the mostly upregulated protein corresponded to microfibril-associated glycoprotein 4 (MFAP-4), a protein that has been recently reported to be involved in extracellular fibril organization and elastic fibers assembly[29]. Interestingly, the increase of this protein in the PA98-coated scaffold was the result of a post-translational process, as the level of the MFAP-4 mRNA was not significantly upregulated (FIG. 6B). Given the important role of this protein for elastin fibers extracellular assembly, it is tempting to speculate that post-translational processing of the protein is affected by contact with the polyacrylate thus helping the VIC-mediated mature elastin deposition in the extracellular space of the scaffold. This last result, also corroborated by the finding the polymer induced a generalized higher deposition of other essential elastin-interacting molecules such as Fibronectin, Fibulin-2 and Emilin[30] in the scaffolds (Table X), suggests that coating conventional scaffolds with the selected PAs or even manufacturing scaffolds directly with the selected PAs, may instruct cells to organize valve-competent ECM molecules, thus helping a final maturation of the bioartificial tissue.

TABLE-US-00008 TABLE VIII Significantly upregulated proteins in PA98-coated vs C VIC-seeded scaffold. fold Peptides Max change UniProt used for Anova fold CV Description Accession quantitation Score P-value change (%) Microfibril-associated P55083 3/3 32.8 1.1.sup.-16 15.36 10.0 glycoprotein Annexin A1 P04083 13/14 116.0 2.19.sup.-10 1.48 6.0 Cathepsin B P07858 3/4 39.44 1.33.sup.-8 1.92 28.6 Neutral alpha-glucosidase Q14697 4/5 34.7 5.62.sup.-6 1.39 50.5 AB Actin-related protein 3 P61158 2/2 12.4 3.82.sup.-6 1.93 34.2 Extended synaptotagtnin-1 Q9BSJ8 2/3 16.5 0.000106 3.39 86.1 Pyruvate kinase PKM P14618 20/25 211.3 0.000951 1.42 14.2 Clathrin heavy chain 1 Q00610 2/18 111.8 0.01708 1.22 47.9 Guanine nucleotide-binding P63244 5/5 31.9 0.004361 1.30 23.1 protein subunit beta-2-like 1 ATP-citrate synthase P53396 2/2 12.6 0.005665 1.51 16.1 Ubiquitin-like modifier- P22314 3/7 43.55 0.007769 2.61 18.6 activating enzyme 1 Calreticulin P27797 2/5 36.04 0.019216 1.65 61.6

TABLE-US-00009 TABLE IX Significantly upregulated proteins in C vs PA98-coated VIC-seeded scaffold fold Peptides Max change UniProt used for Anova fold CV Description Accession quantification Score P-value change (%) Lamin-B1 P20700 7/5 31.6 2.46.sup.-11 2.25 10.9 Ubiquitin-40S ribosomal P62979 4/5 37.3 1.42.sup.-9 1.63 10.4 protein S27a Annexin A6 P08133 2/3 20.9 3.81.sup.-7 2.89 49.1 D-3-phosphoglycerate O43175 5/5 25.4 1.7.sup.-7 1.43 16.0 dehydrogenase ADP-ribosylation factor 3 P61204 4/9 63.1 0.000132 1.64 25.3 Cell division control protein P60953 2/2 13.0 0.000519 1.51 9.6 42 homolog Histone H1.4 P10412 2/2 13.4 0.00854 1.70 27.8 Histone H3.1 P68431 6/7 32.5 0.017908 2.30 54.4 Coagulation factor V P12259 3/13 101.8 0.030755 1.37 19.7 L-lactate dehydrogenase A P00338 2/4 26.3 0.042941 1.27 3.3 chain Histone H4 P62805 10/10 73.6 0.047149 2.38 83.3 Heterogeneous nuclear P22626 4/4 25.4 0.048413 1.81 38.5 ribonucleoproteins A2/B1

TABLE-US-00010 TABLE X Expression of Extracellular Matrix related Proteins in PA98-coated vs. C scaffolds. Anova Max fold Description P-value change ENTILIN-1 0.783877 1.14 Collagen alpha-3(VI) chain 0.517931 1.15 Vitronectin 0.187077 1.16 Collagen alpha-2(VI) chain 0.388854 1.20 Collagen alpha-1(VI) chain 0.501731 1.33 Fibronectin 0.159572 1.96 Microfibril-associated glycoprotein-4 1.10.sup.16 15.36

REFERENCES

[0108] 1. David, T. E., Surgical treatment of aortic valve disease. Nat Rev Cardiol, 2013. 10(7): p. 375-86. [0109] 2. Kheradvar, A., et al., Emerging Trends in Heart Valve Engineering: Part II. Novel and Standard Technologies for Aortic Valve Replacement. Annals of Biomedical Engineering, 2014: p. 1-14. [0110] 3. Forcillo, J., et al., Carpentier-Edwards Pericardial Valve in the Aortic Position: 25-Years Experience. Ann Thorac Surg, 2013. 96(2): p. 486-493. [0111] 4. Grabenwoger, M., et al., Impact of glutaraldehyde on calcification of pericardial bioprosthetic heart valve material. Ann Thorac Surg, 1996. 62(3): p. 772-7. [0112] 5. Siddiqui, R. F., J. R. Abraham, and J. Butany, Bioprosthetic heart valves: modes of failure. Histopathology, 2009. 55(2): p. 135-144. [0113] 6. Z. Konakci, K., et al., Alpha-Gal on bioprostheses: xenograft immune response in cardiac surgery. European Journal of Clinical Investigation, 2005. 35(1): p. 17-23. [0114] 7. Naso, F., et al., First quantification of alpha-Gal epitope in current glutaraldehyde fixed heart valve bioprostheses. Xenotransplantation, 2013. 20(4): p. 252-261. [0115] 8. Naso, F., et al., Alpha-Gal detectors in xenotransplantation research: a word of caution. Xenotransplantation, 2012. 19(4): p. 215-220. [0116] 9. Galili, U., The [alpha]-gal epitope and the anti-Gal antibody in xenotransplantation and in cancer immunotherapy. Immunol Cell Biol, 2005. 83(6): p. 674-686. [0117] 10. Hlsmann, J., et al., Transplantation material bovine pericardium: biomechanical and immunogenic characteristics after decellularization vs. glutaraldehyde-fixing. Xenotransplantation, 2012. 19(5): p. 286-297. [0118] 11. Breuer, C. K., et al., Application of tissue-engineering principles toward the development of a semilunar heart valve substitute. Tissue Eng, 2004. 10(11-12): p. 1725-36. [0119] 12. Balguid, A., et al., Stress related collagen ultrastructure in human aortic valves-implications for tissue engineering. Journal of Biomechanics, 2008. 41(12): p. 2612-2617. [0120] 13. Balguid, A., et al., The role of collagen cross-links in biomechanical behavior of human aortic heart valve leafletsrelevance for tissue engineering. Tissue Eng, 2007. 13(7): p. 1501-11. [0121] 14. Hammer, P. E., et al., Straightening of curved pattern of collagen fibers under load controls aortic valve shape. Journal of Biomechanics, 2014. 47(2): p. 341-346. [0122] 15. Sacks, M. S., F. J. Schoen, and J. E. Mayer, Bioengineering Challenges for Heart Valve Tissue Engineering. Annual Review of Biomedical Engineering, 2009. 11(1): p. 289-313. [0123] 16. MacGrogan, D., et al., How to Make a Heart Valve: From Embryonic Development to Bioengineering of Living Valve Substitutes. Cold Spring Harbor Perspectives in Medicine, 2014. 4(11). [0124] 17. Ghanbari, H., et al., Polymeric heart valves: new materials, emerging hopes. Trends in Biotechnology, 2009. 27(6): p. 359-367. [0125] 18. Fallahiarezoudar, E., et al., A review of: Application of synthetic scaffold in tissue engineering heart valves. Materials Science and Engineering: C, 2015. 48(0): p. 556-565. [0126] 19. Kheradvar, A., et al., Emerging Trends in Heart Valve Engineering: Part I. Solutions for Future. Annals of Biomedical Engineering, 2014: p. 1-11. [0127] 20. van Loosdregt, I. A. E. W., et al., Cell-mediated retraction versus hemodynamic loadingA delicate balance in tissue-engineered heart valves. Journal of Biomechanics, 2014. 47(9): p. 2064-2069. [0128] 21. Tourniaire, G., et al., Polymer microarrays for cellular adhesion. Chem Commun (Camb), 2006(20): p. 2118-20. [0129] 22. Santoro, R., et al., Feasibility of pig and human-derived aortic valve interstitial cells seeding on fixative free decellularized animal pericardium. J Biomed Mater Res B Appl Biomater, 2015. [0130] 23. Wendt, D., et al., Oscillating perfusion of cell suspensions through three-dimensional scaffolds enhances cell seeding efficiency and uniformity. Biotechnology and Bioengineering, 2003. 84(2): p. 205-214. [0131] 24. Santoro, R., et al., On-line monitoring of oxygen as a non-destructive method to quantify cells in engineered 3D tissue constructs. J Tissue Eng Regen Med, 2012. 6(9): p. 696-701. [0132] 25. Roverso, M., et al., A preliminary study on human placental tissue impaired by gestational diabetes: a comparison of gel-based versus gel-free proteomics approaches. Eur J Mass Spectrom (Chichester), 2016. 22(2): p. 71-82. [0133] 26. Brioschi, M., et al., A mass spectrometry-based workflow for the proteomic analysis of in vitro cultured cell subsets isolated by means of laser capture microdissection. Analytical and Bioanalytical Chemistry, 2014. 406(12): p. 2817-2825. [0134] 27. Van Lieshout, M., et al., A knitted, fibrin-covered polycaprolactone scaffold for tissue engineering of the aortic valve. Tissue Eng, 2006. 12(3): p. 481-7. [0135] 28. Sant, S., et al., Effect of biodegradation and de novo matrix synthesis on the mechanical properties of valvular interstitial cell-seeded polyglycerol sebacate-polycaprolactone scaffolds. Acta Biomaterialia, 2013. 9(4): p. 5963-5973. [0136] 29. Pilecki, B., et al., Characterization of Microfibrillar-associated Protein 4 (MFAP4) as a Tropoelastin- and Fibrillin-binding Protein Involved in Elastic Fiber Formation. J Biol Chem, 2016. 291(3): p. 1103-14. [0137] 30. Wagenseil, J. E. and R. P. Mecham, New insights into elastic fiber assembly. Birth Defects Res C Embryo Today, 2007. 81(4): p. 229-40.