NON-HUMAN PRIMATE INDUCED PLURIPOTENT STEM CELL DERIVED HEPATOCYTES AND USES THEREOF
20190292518 ยท 2019-09-26
Assignee
Inventors
Cpc classification
C12N2500/92
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N2533/90
CHEMISTRY; METALLURGY
C12N2501/999
CHEMISTRY; METALLURGY
C12N2501/16
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
This application relates to non-human primate (NHP) induced pluripotent stem cell (IPSC)-derived hepatocytes and methods of producing the same. Moreover, this application relates to methods of using NHP IPSC-derived hepatocytes for drug screening, drug safety assessment and in models of infection.
Claims
1. A method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes, the method comprising: a) providing NHP pluripotent stem cells in a feeder-free culture in a chemically defined medium; b) contacting the pluripotent stem cells with a Wnt signalling activator to produce endodermal cells; c) contacting the endodermal cells with BMP4 and a fibroblast growth factor to produce immature NHP hepatocytes; and d) contacting the immature NHP hepatocytes with HGF, OncostatinM and Dexamethasone to produce NHP hepatocytes.
2. The method of claim 1, wherein the Wnt signalling activator is CP21.
3. The method of claim 1, wherein step b) comprises contacting the cells with Ly294002 and CP21 to induce differentiation.
4. The method of claim 1, wherein step b) comprises contacting the cells with LDN193189.
5. The method of claim 1, wherein step b) comprises contacting the cells with knock-out serum replacement (KSR) and DMSO.
6. The method of claim 1, wherein the fibroblast growth factor is FGF2 or FGF10.
7. The method of claim 1, wherein step c) comprises contacting the cells with BMP4, DMSO and FGF2 or FGF10.
8. The method of claim 1, wherein step d) comprises contacting the cells with a NOTCH signaling inhibitor.
9. The method of claim 1, wherein the NHP pluripotent stem cells of step a) are induced pluripotent stem cells (IPSCs).
10. The method of claim 1 wherein the NHP pluripotent stem cells are derived from a species selected from the group consisting of Cynomolgus monkey (Macaca fascicularis) and Rhesus monkey (Macaca mulatta).
11. A feeder-free NHP hepatocyte culture in a chemically defined medium.
12. A NHP hepatocyte obtained by the method according to claim 1.
13. A biobank of NHP hepatocytes obtained by the method according to claim 1.
14. Use of NHP hepatocytes or of a biobank of NHP hepatocytes as in vitro model for diseases caused by dysfunction of liver cells, wherein said NHP hepatocytes or biobank of NHP hepatocytes are obtained by the method according to claim 1.
15. Use of NHP hepatocytes or of a biobank of NHP hepatocytes as in vitro model for infection of liver cells, wherein said NHP hepatocytes or biobank of NHP hepatocytes are obtained by the method according to claim 1.
16. A method for testing the potential toxicity of a compound, the method comprising: (i) exposing one or more NHP hepatocytes prepared according to the method of claim 1 to the compound; and (ii) monitoring the one or more mature NHP hepatocytes for signs of toxicity.
17. An in vitro method for supporting the life cycle of a virus, the method comprising: exposing one or more NHP hepatocytes prepared according to the method of claim 1 to the virus, wherein the virus replicates within the one or more NHP hepatocytes.
18. Use of the cells of claim 1 for in vitro testing of toxicity of a compound.
19. A method of preparing an in vitro NHP assay, the method comprising: i) providing NHP hepatocytes prepared by the method of claim 1; ii) contacting the NHP hepatocytes for between about 1 and about 3 hours with Accutase to detach the NHP hepatocytes; iii replating the detached NHP hepatocytes in a suitable assay format.
20. The method of claim 19, wherein the detached NHP hepatocytes are enriched for SCARBI-positive cells before replating.
21. (canceled)
Description
SHORT DESCRIPTION OF THE FIGURES
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
DETAILED DESCRIPTION
[0073] As used herein, the term defined medium or chemically defined medium refers to a cell culture medium in which all individual constituents and their respective concentrations are known. Defined media may contain recombinant and chemically defined constituents.
[0074] As used herein the terms differentiating and differentiation refers to one or more steps to convert a less-differentiated cell into a somatic cell, for example to convert a pluripotent stem cell into a hepatocyte. Hepatocytes derived from human IPSCs can be generated according to protocols known in the art (see e.g., Hannan, Segeritz, Touboul, Ludovic. Nature Protocols. 2013; 8: 430-437). Differentiation of a NHP PSCs, in particular NHP IPSCs, into NHP hepatocytes is achieved by the method described herein.
[0075] Expression of marker means that a certain gene is transcribed into mRNA and usually is subsequently translated into a protein (its gene product) which exerts a certain function in a cell. The expression of a marker can be detected and quantified on the RNA level or on the protein level by methods known in the art. Preferred herein is the detection of the expression of a marker on the protein level, e.g., by testing for the presence of a certain protein with antibodies binding to the marker. Expression markers can be used to determine the identity of a cell type. PSC cell markers are known in the art and may e.g., comprise Ecat1, Esg1, Nanog, Eras, Gdf3, Fgf4, Cripto, Cax1, Zfp296, Slc2a3 and Nat1, Oct4 and Sox2.
[0076] As used herein, the term feeder free refers to cell culture that does not employ the use of feeder cultures. Feeders are cells of a different cell type and/or from a different species as the cells to be cultured that serve to provide nutritional and/or structural support for the cultured cells. Examples of feeder cultures are mouse embryonic fibroblasts (MEFs). As an example, a feeder-free NHP hepatocyte culture is free of feeder cells, e.g., MEFs. The absence of feeder cells can be determined according to methods known in the art, e.g. by measuring feeder cells specific gene expression by real time PCR.
[0077] The term hepatocyte or HEP as used herein refers to a cell which is similar to or identical to a cell of the main parenchymal tissue of the liver. Likewise, the term NHP hepatocyte or NHP HEP refers to a non-human primate hepatocyte or non-human PSC-derived hepatocyte. The term immature hepatocyte as used herein refers to a cell which is more similar to a fetal hepatocyte regarding its marker expression (e.g., AFP expression instead of ALB) but which expresses markers associated with cellular and/or metabolic functions of hepatocytes and which adopts a hepatocyte cell shape as described herein.
[0078] As used herein, the term hepatocyte maturation medium refers to a defined medium that comprises MT medium supplemented with 20 ng/ml HGF, 20 ng/ml Oncostatin M, 100 nM dexamethasone and 0.5% DMSO.
[0079] High-throughput screening as used herein shall be understood to mean that a relatively large number of different disease model conditions and/or chemical compounds can be analyzed and compared with the novel assay described herein. Typical such high-throughput screening is performed in multi-well microtiter plates, e.g., in a 96 well plate or a 384 well plate or a plates with 1536 or 3456 wells.
[0080] As used herein, the term MT medium or MT basal medium or MT basic medium refers to a defined medium that contains Dulbecco's Modified Eagle Medium with Ham's F12 Nutrient Mixture (DMEM/F12) with 2.5 mM GlutaMAX, 7 g/ml insulin, 450 M monothioglycerole, lx Lipid concentrate, 5 mg/ml BSA, 14 ng/ml sodium selenite, 1 non-essential amino acids, 2 mg/ml heparin, 15 g/ml transferrin, and 220 M ascorbic acid-2-phosphate.
[0081] As used herein, the term MT complete medium refers to MT medium that contains 15 ng/ml bFGF (FGF2) and 10 ng/ml ActivinA.
[0082] The term non-human primate or NHP as used herein refers to species belonging to the order of primates with the exception of Homo sapiens. In particular, NHP species according to the methods disclosed in the present invention include but are not limited to Pan troglodytes, Pan paniscus, Hylobates lar, Gorilla gorilla, Pongo abelii, Pongo pygmaeus, Cercopithecus mitis, Cercopithicus neglectus, Chlorocebus aethiops, Chlorocebus sabaeus, Colobus guereza, Lophocebus aterrimus, Macaca arctoides, Macaca assamensis, Macaca fascicularis, Macaca fuscata, Macaca mulatta, Macaca nemestrina, Macaca silenus, Mandrillus leucophaeus, Mandrillus sphinx, Macaca thibetana, Papio anubis, Papio cynocephalus, Papio hamadryas, Papio papio, Papio ursinus, Presbytis entellus, Theropithecus gelada, Aotus azarae, Aotus nancymaae, Aotus nigriceps, Aotus trivirgatus, Aotus vociferans, Ateles belzebuth, Ateles fusciceps, Callithrix jacchus, Callicebus moloch, Cebuella pygmaea, Cebus apella, Leontopithecus rosalia, Pithecia pithecia, Saguinus fuscicollis, Saguinus geoffroyi, Saguinus labiatus, Saguinus mystax, Saguinus oedipus, Saimiri sciureus.
[0083] Pluripotency medium as used herein refers to any chemically defined medium useful for the attachment of the NHP pluripotent stem cells as single cells while maintaining their pluripotency and are well known in the art.
[0084] The term stem cell as used herein refers to a cell that has the ability for self-renewal and differentiation. An undifferentiated stem cell as used herein refers to a stem cell that has not undergone differentiation. As used herein, pluripotent stem cells or PSC refers to stem cells that can give rise to cell types of the three germlayers (endoderm, ectoderm, mesoderm) as well as the germline. Pluripotent stem cells (PSCs) include but are not limited to NHP embryonic stem cells (NHP ESCs) and NHP induced pluripotent stem cells (NHP IPSCs).
[0085] The term sorting or cell sorting as used herein refers to separating various cells of a cell population based on their properties such as cell surface marker expression.
[0086] The present disclosure relates generally to non-human primate (NHP) pluripotent stem cell-derived hepatocytes and methods of producing the same. The disclosure further relates to use of these NHP hepatocytes for in vitro drug screening, safety assessment and models of infection.
[0087] Prior studies reported hepatocyte differentiation of NHP embryonic stem cells (Table 1). In general, these strategies are based on feeder-cultured stem cells and differentiation methods using embryoid body formation and chemically undefined media. All of these parameters render the resulting cells unsuitable for drug development due to high variability and introduction of undefined factors. Furthermore, current attempts to differentiate NHP stem cells into hepatocytes suffer from low efficiencies and do not provide strategies to enrich and replate NHP hepatocytes in formats suitable for drug candidate screening applications.
[0088] Presented herein are robust and efficient methods to derive hepatocytes from NHP pluripotent stem cells (PSCs), in particular NHP induced pluripotent stem cells (IPSCs). Further, the inventors developed strategies for sorting and replating the obtained NHP hepatocytes which are prerequisites for using the NHP hepatocytes as in vitro screening model in drug development. Moreover, the data presented herein demonstrate that the NHP hepatocytes obtained by the method of the invention are suitable for use as in vitro models to assess drug induced liver injury or to model infections with primate-specific pathogens.
[0089] This system provides a valuable tool for drug development as it represents the first NHP in vitro system that does not require sacrifice of animals. Moreover, it allows analysis of NHP responsiveness to pathogens or drugs prior to in vivo studies enabling prioritization of drug candidates. As the corresponding human hepatocytes are available, NHP hepatocytes obtained by the methods as described herein can be used for inter-species comparison and more precise translation of preclinical findings to human.
[0090] Accordingly, the present invention provides for a method of differentiating non-human primate (NHP) pluripotent cells, specifically NHP induced pluripotent cells, into NHP hepatocytes. This method comprises the steps of:
[0091] a) providing NHP pluripotent stem cells in a feeder-free culture in a chemically defined medium;
[0092] b) contacting the pluripotent stem cells with a Wnt signalling activator to produce endodermal cells;
[0093] c) contacting the endodermal cells with BMP4 and FGF2 or FGF10 to produce immature NHP hepatocytes; and
[0094] d) contacting the immature NHP hepatocytes with HGF, OncostatinM and Dexamethasone to produce NHP hepatocytes.
[0095] NHP IPSCs can be obtained by reprogramming of somatic cells, e.g. by transduction of defined factors by methods known in the art. Somatic cells transduced with e.g., Oct3/4, Sox2, c-Myc and Klf4 and cultured under ES cell culture conditions acquire properties of ES cells such as morphology, growth rate, potential of unlimited selfrenewal and pluripotency and express ES cell marker genes (see e.g. Takahashi, Yamanaka, Cell. 2006 Aug. 25; 126(4):663-76). Suitable sources of somatic cells are for example, fibroblast cells, keratinocytes or adipocytes obtained by skin biopsy. Other somatic cells suitable as a source for IPSCs are leucocytes cells obtained from blood samples or epithelial cells or other cells obtained from blood or urine samples and reprogrammed to IPSCs by the methods known in the art as described herein. The NHP somatic cells can be obtained from a healthy individual or from a diseased individual. NHP IPSCs have the capacity to develop into cells of the endodermal, ectodermal and mesodermal lineage. In one embodiment provided is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes, wherein the NHP pluripotent stem cells of step a) are induced pluripotent stem cells (IPSC).
[0096] In one embodiment the NHP pluripotent stem cells are derived from a species selected from the group consisting of Cynomolgus monkey (Macaca fascicularis) and Rhesus monkey (Macaca mulatta). In one preferred embodiment the NHP pluripotent stem cells are derived from Cynomolgus monkey (Macaca fascicularis).
[0097] In one embodiment the NHP pluripotent stem cells of step a) are provided as single cells and/or in a monolayer of cells. This is opposed to culturing cell clumps or embryoid bodies which constitute less defined formations with various three dimensional structuring. A single cell layer as provided herein is a defined film of cells on an adhesive substrate. In combination with the defined media conditions as described herein a robust and repeatable cell culture system is provided.
[0098] In one embodiment the NHP pluripotent stem cells are provided on growth-factor reduced MATRIGEL (BD Bioscience). MATRIGEL is a mixture of gelatinous proteins secreted by Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells and is used as a cell culture support to mimic complex extracellular environment as found in many tissues, as e.g., in hepatic tissue. MATRIGEL is suitable for coating of cell culturing surfaces or embedding cells in sandwich cultures. Other cell culture support media suitable for culturing cells derived from the hepatic lineage are collagen and laminin.
[0099] In one embodiment, the NHP pluripotent cells are provided at a density of about 10000-80000 cells/cm.sup.2. In further embodiments, the NHP pluripotent cells are provided at a density of about 20000-70000 cells/cm.sup.2 or about 30000-60000 cells/cm.sup.2. In one embodiment, the NHP pluripotent cells are provided at a density of about 40000-50000 cells/cm.sup.2. In one embodiment the NHP pluripotent stem cells are provided at a density of about 45000 cells/cm.sup.2. In one embodiment, IPSCs are provided at a density of about 45000 cells/cm.sup.2, i.e. a high density. The inventors of the present method found that providing the cells at a high density increases the efficiency of endodermal and subsequent hepatic differentiation. Optimal initial cell plating density for NHP pluripotent stem cells for maximum hepatocyte yield may be determined for different cell lines.
[0100] The cell culturing conditions for differentiating NHP hepatocytes as described herein are chemically defined which means that all individual constituents and their respective concentrations are known. A defined basic medium is supplemented with defined compounds to induce differentiation of the PSCs according to the different steps of the method as described herein. In one embodiment the basic medium is the same for all steps of the method as described herein. In other embodiments, the basic medium is changed after completion of one step of the method and/or after a defined time point. In a preferred embodiment, the basic medium contains Dulbecco's Modified Eagle Medium with Ham's F12 Nutrient Mixture (DMEM/F12) and GlutaMAX supplemented with 1-50 g/ml insulin, 100-1000 M monothioglycerole, 0.5-2 Lipid concentrate, 2-20 mg/ml BSA, 10-20 ng/ml sodium selenite, 0.5-2 non-essential amino acids, 1-5 mg/ml heparin, 5-50 g/ml transferrin, and 100-500 M ascorbic acid-2-phosphate. In one embodiment the chemically defined medium is MT medium.
[0101] The present invention provides a method to produce NHP hepatocytes derived from NHP PSCs in a feeder free cell culture format and in chemically defined media.
[0102] In one embodiment, the NHP pluripotent cells are cultivated under conditions permitting stable growth and/or duplication times. For example, the cells are grown in pluripotency medium and passaged several times. In one embodiment, the pluripotency medium is a fully-defined, i.e., serum free, medium comprising a small molecule inhibitor of the Rho-associated coiled-coil forming protein serine/threonine kinase (ROCK) family of protein kinases (herein referred to as ROCK kinase inhibitor).
[0103] In one embodiment the ROCK kinase inhibitor is selected from the group of 1-(5-Isoquinolinesulfonyl) homopiperazine), N-Benzyl-2-(pyrimidin-4-ylamino) thiazole-4-carboxamide) and (+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclo-hexanecarboxamide dihydrochloride). Further ROCK kinase inhibitors useful herein are Fasudil (1-(5-Isoquinolinesulfonyl)homopiperazine), Thiazovivin (N-Benzyl-2-(pyrimidin-4-10 ylamino)thiazole-4-carboxamide) and Y27632 ((+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclo-hexanecarboxamide dihydrochloride, e.g., Catalogue Number: 1254 from Tocris bioscience). In a preferred embodiment the ROCK kinase inhibitor is Y27632. In one embodiment, the pluripotency medium is a serum free medium comprising 2 to 20 M Y27632, preferably 5 to 10 M Y27632. In a preferred embodiment the pluripotency medium is a serum free medium comprising 10 M Rock kinase inhibitor Y27632. In another embodiment the pluripotency medium is a serum free medium comprising 2 to 20 M Fasudil. In another embodiment the pluripotency medium is a serum free medium comprising 0.2 to 10 M Thiazovivin.
[0104] NHP PSCs can be expanded infinitely and adapted to large scale cultures suitable for high-throughput screening settings required in drug development and safety testing. Furthermore, NHP PSCs hold great potential for disease modeling and regenerative medicine. NHP PSCs share many physiological similarities with human PSCs and can be used to study neurodegenerative disorders, autoimmune diseases and infection diseases. Importantly, the availability of NHP IPSCs and human IPSCs allows direct comparison of disease or treatment models between NHP and human provided that the IPSCs can be efficiently differentiated into the disease model cell type needed. The methods as disclosed herein can be used to efficiently differentiate NHP PSCs, in particular NHP IPSCs, into NHP hepatocytes.
[0105] In one embodiment the NHP PSCs are exposed to ActivinA and FGF-2 prior to differentiation. In one embodiment the NHP pluripotent cells are provided in a chemically defined medium comprising FGF2 and ActivinA. In one embodiment, the defined medium of step a) of the methods comprises 0.3-15 ng/ml ActivinA and 0.3-20 ng/ml FGF-2, preferably 0.3-10 ng/ml ActivinA and 0.3-15 ng/ml FGF-2. In one embodiment the NHP pluripotent cells are provided at a density of about 45000 cells/cm.sup.2 on growth-factor reduced MATRIGEL-coated plates in MT basic medium supplemented with 15 ng/ml FGF2, 10 ng/ml ActivinA and 10 M ROCK kinase inhibitor Y-27632.
[0106] In one embodiment the NHP PSCs are washed with a suitable buffer or medium prior to initializing differentiation, to remove any dead cells. Preferably the media are changed in between each step, e.g., the medium is removed, by aspiration or centrifuging the cells and discarding the supernatant and then the medium used in the subsequent step is added to the cells. In one embodiment the cells are washed with a suitable buffer or medium prior to adding the medium of the subsequent step to remove any dead cells and any residual medium or growth factors or cytokines applied in the previous step. Buffers or media useful for washing the cells are known in the art. One example of a suitable buffer for washing the cells is, e.g., phosphate buffered saline (PBS).
[0107] To initialize differentiation, the cells are incubated in a defined medium comprising a Wnt pathway activator. In one embodiment, the Wnt pathway activator is compound 21 (3-(3-Amino-phenyl)-4-(1-methyl-1H-indol-3-yl)-pyrrole-2,5-dione, also referred to as compound 21 or CP21 herein; see e.g., L. Gong et al; Bioorganic & Medicinal Chemistry Letters 20 (2010), 1693-1696). In several parallel differentiation experiments using different cell densities (30000 to 75000/cm.sup.2) and various CP21 concentrations (0 to 2 M) it was found that using a cell density of 45000/cm.sup.2 and a CP21 concentration of 1 M resulted in the most efficient differentiation of pluripotent stem cells into hepatocytes. CP21 concentrations above 2 M showed decreased cell viability. As prior art protocols require higher concentrations of other modulators of the Wnt pathway (e.g., BIO or CHIR99021) for efficient differentiation this confirms that CP21 is a very potent compound in inducing Wnt signaling.
[0108] In one embodiment, the Wnt activator used in step b) of the methods for differentiating NHP pluripotent stem cells into NHP hepatocytes described herein is a compound of formula
##STR00001##
[0109] In one embodiment, the defined medium of step b) of the differentiation methods comprises 0.1 to 10 M CP21, preferably 0.5 to 5 M CP21. In one preferred embodiment step b) the medium comprises 1 M CP21.
[0110] In one embodiment step b) comprises contacting the cells for 12 to 96 hours, preferably for 24 to 72 hours, with a defined medium comprising CP21.
[0111] In one preferred embodiment step b) comprises contacting the cells for 72 hours with a defined medium comprising CP21.
[0112] The hepatocyte or hepatocyte-like identity can be assessed with expression markers associated with cellular and/or metabolic functions of hepatocytes. The expression markers associated with hepatocyte identity can be expressed at a lower level in hepatocytes derived from PSCs compared to the expression level in primary hepatocytes or liver tissue. The normalized expression level of hepatocyte expression markers in PSC-derived hepatocytes can be 10000 lower, or 1000 lower, or 100 lower, or 10 lower, or 2 lower compared to the expression level of the respective markers in primary hepatocytes or liver tissue. The fold change of expression level of hepatocyte expression markers between PSC-derived hepatocytes and primary hepatocytes can be different for different expression markers. Normalization can be achieved by relating the absolute expression level of a given marker to a suitable house-keeping gene, e.g., GAPDH. Expression markers include but are not limited to hepatocyte specific or hepatocyte characteristic markers related to metabolic functions, protein synthesis, protein storage, transformation of carbohydrates, synthesis of cholesterol, synthesis of bile salts and phospholipids, detoxification, modification and excretion of exogenous and endogenous substances. Typical markers include but are not limited to HNF4a, AFP, ALB, A1AT, SCARB1. Hepatocytes and hepatocyte-like cells are considered to represent cells committed to the same cell lineage expressing similar phenotypic markers. Furthermore, the hepatocyte identity can also be assessed by functional characterization including but not limited to morphology, glycogen and lipid storage.
[0113] In one embodiment provided is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes as described herein, wherein step b) comprises Ly294002. Ly294002 is a PI3K inhibitor and has been shown to support the differentiation of definitive endoderm. In one embodiment, the defined medium of step b) of the method as disclosed herein comprises 0.5 to 100 M Ly294002, preferably 1 to 20 M Ly294002. In one preferred embodiment step b) the medium comprises 10 M Ly294002.
[0114] In one embodiment provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes as described herein, wherein step b) comprises contacting the cells with Ly294002, and CP21 to induce differentiation.
[0115] In one embodiment the medium of step b) comprises 100 ng/ml ActivinA, 10 M Ly294002 and 1 M CP21. In one embodiment the cells are incubated with said medium for 3 days, for 2 days, preferentially for 1 day to induce differentiation. Accordingly, provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes as described herein, wherein step b) comprises contacting the cells with a chemically defined medium comprising 100 ng/ml ActivinA, 10 M Ly294002 and 1 M CP21, in particular for 1 day.
[0116] In one embodiment the medium of step b) comprises LDN193189. LDN193189 is an ALK2/3 inhibitor blocking BMP signaling which prevents mesoderm formation. Hepatocytes are from the endodermal lineage, blocking mesoderm formation therefore improves the yield of cells committing to the endodermal lineage. In one aspect of the invention the addition of LDN193189 to the defined medium improves hepatocyte differentiation. In one embodiment, the defined medium of step b) of the methods as described herein comprises 0.1 to 10 M LDN193189, preferably 0.2 to 2 M LDN193189. In one preferred embodiment step b) the medium comprises 0.25 M LDN193189.
[0117] In one embodiment step b) comprises contacting the cells for 24 to 96 hours, preferably for 72 hours with a chemically defined medium comprising the Wnt signaling activator CP21. In a further embodiment step b) comprises contacting the cells for about 24 hours with ActivinA, Ly294002 and CP21 followed by contacting the cells for about 48 hours with ActivinA, LDN193189 and CP21. In a particular embodiment, provided is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes as described herein, wherein step b) comprises contacting the cells with a chemically defined medium comprising 100 ng/ml ActivinA, 0.25 M LDN193189 and 1 M CP21 on day 2 and 3 of differentiation.
[0118] In one embodiment step b) comprises contacting the cells with a chemically defined medium comprising 50 ng/ml or 100 ng/ml ActivinA on day 4 of differentiation.
[0119] In a further embodiment step b) comprises contacting the cells with knock-out serum replacement (KSR). KSR is a defined serum-free formulation comprising amino acids, vitamins, trace elements, transferrin, insulin and lipid-rich albumin and is used as source of nutrients for various cell types. In specific embodiments, the cells are contacted with 0.1 to 10% KSR, with 1 to 5% KSR, preferentially with 2% KSR. In one embodiment step b) comprises contacting the cells for 1 to 6 days, or 3 to 5 days, preferably for 5 days with a chemically defined medium comprising 2% knock-out serum replacement (KSR).
[0120] In a further embodiment the cells are contacted with DMSO. In further embodiments, the cells are contacted with 0.1 to 2% DMSO, with 0.2 to 1% DMSO, preferentially with 0.5% DMSO.
[0121] In a further embodiment step b) comprises contacting the cells with 2% knock-out serum replacement (KSR) and DMSO. In one embodiment step b) comprises contacting the cells for 24 to 72 hours, preferably for 48 hours with a chemically defined medium comprising 2% knock-out serum replacement (KSR) and 0.5% DMSO.
[0122] In a further embodiment step b) comprises contacting the cells for about 24 to 72 hours, preferably for about 48 hours with a chemically defined medium comprising ActivinA, KSR and DMSO. In a particular embodiment, provided is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes as described herein, wherein step b) comprises contacting the cells with a chemically defined medium comprising 50 ng/ml or 100 ng/ml ActivinA, 2% knock-out serum replacement (KSR) and 0.5% DMSO on day 5 and day 6 of differentiation.
[0123] The present invention discloses a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes, wherein the NHP pluripotent stem cells are differentiated in a first step to endodermal cells by contacting the cells with defined factors in defined media as described herein. The endodermal cells can be further differentiated to hepatic endoderm and immature NHP hepatocytes by contacting the cells with defined factors in defined media as described herein.
[0124] In one embodiment differentiation of endodermal cells to hepatic endoderm is induced by contacting the cells with bone morphogenetic protein, preferably BMP4 or BMP2 and a fibroblast growth factor, preferably FGF2. BMP4 is involved in bone and cartilage development. In one embodiment combined activation of BMP and FGF signaling is used to differentiate endodermal cells into the hepatic lineage. In one embodiment FGF signaling is induced by a fibroblast growth factor. In one embodiment provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes as described herein wherein the fibroblast growth factor of step c) is FGF2 or FGF10. In one embodiment provided is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes as described herein, wherein step c) comprises contacting the cells with BMP4, and FGF2 or FGF10. In one embodiment step c) comprises contacting the cells for 3 to 5 days, preferably for 4 days with a chemically defined medium comprising BMP4, and FGF2 or FGF10. In specific embodiments, the cells are contacted with about 1 to 50 ng/ml BMP4, with about 2 to 20 ng/ml BMP4, preferentially with 10 ng/ml BMP4. In specific embodiments, the cells are contacted with about 1 to 50 ng/ml FGF2 or FGF10, with about 2 to 20 ng/ml FGF2 or FGF10, preferentially with about 10 ng/ml FGF2 or FGF10. In further embodiments, the cells are contacted with about 0.1 to 2% DMSO, with about 0.2 to 1% DMSO, preferentially with 0.5% DMSO.
[0125] In a further embodiment step c) comprises contacting the cells for about 24 to 72 hours, preferably for about 48 hours with KSR, BMP4, FGF2 or FGF10, and DMSO. In a particular embodiment, provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes, wherein step c) comprises contacting the cells with a chemically defined medium comprising 2% KSR, 10 ng/ml BMP4, 10 ng/ml FGF2 or FGF10 and 0.5% DMSO on day 7 to day 10 of differentiation.
[0126] Accordingly, the present invention discloses a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes, comprising in one step the differentiation of hepatic endoderm cells to immature NHP hepatocytes by contacting the cells with defined factors in defined media as described herein. The immature NHP hepatocytes can be further differentiated to NHP hepatocytes by contacting the cells with defined factors in defined media as described herein.
[0127] In one embodiment differentiation of immature NHP hepatocytes to NHP hepatocytes is promoted by contacting the cells with HGF, Oncostatin M and dexamethasone. In one embodiment provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes, wherein step d) comprises contacting the cells with HGF, Oncostatin M and dexamethasone. In one embodiment step d) comprises contacting the cells for about 3 to 25 days, for about 4 to 20 days, preferably for 18 days with a chemically defined medium comprising HGF, Oncostatin M and dexamethasone.
[0128] In specific embodiments, the cells are contacted with about 1 to 100 ng/ml HGF, with about 5 to 50 ng/ml HGF, preferentially with 20 ng/ml HGF. In further specific embodiments, the cells are contacted with about 1 to 100 ng/ml Oncostatin M, with about 5 to 50 ng/ml Oncostatin M, preferentially with 20 ng/ml Oncostatin M. In further specific embodiments, the cells are contacted with about 5 to 500 ng/ml dexamethasone, with about 20 to 200 ng/ml dexamethasone, preferentially with 100 ng/ml dexamethasone. In further specific embodiments, the cells are contacted with about 0.1 to 2% DMSO, with about 0.2 to 1% DMSO, preferentially with 0.5% DMSO.
[0129] In a further embodiment step d) comprises contacting the cells for about 3 to 25 days, for about 5 to 20 days, preferably for 18 days with HGF, Oncostatin M, dexamethasone and DMSO. In a particular embodiment, provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes, wherein step d) comprises contacting the cells with a chemically defined medium comprising 20 ng/ml HGF, 20 ng/ml Oncostatin M, 100 nM dexamethasone and 0.5% DMSO from day 11 to day 28 of differentiation.
[0130] In one embodiment step d) comprises contacting the cells with a NOTCH signaling inhibitor. Inhibiting NOTCH signaling inhibits the formation of cholangiocytes (bile duct cells). In a particular embodiment, the NOTCH signaling inhibitor is N[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT). DAPT is a -secreatse inhibitor and thus inhibits NOTCH signaling. In one embodiment step d) comprises contacting the cells for about 3 to 7 days, for about 4 to 6 days, preferably for 5 days with a chemically defined medium comprising DAPT. In specific embodiments, the cells are contacted with about 0.1 to 10 M DAPT, with about 0.2 to 2 M DAPT, preferentially with 1 M DAPT. In a particular embodiment, provided is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes, wherein step d) comprises contacting the cells with a chemically defined medium comprising 1 M DAPT from day 11 to day 15 of differentiation. In a particular embodiment, provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes, wherein step d) comprises contacting the cells with a chemically defined medium comprising 1 M DAPT from day 11 to day 15 of differentiation.
[0131] In one embodiment the medium is changed every day from day 1 to day 15 and thereafter every second day. In a further embodiment the chemically defined medium is changed to a different chemically defined medium at a defined time point e.g., after completion of one of the steps a), b), c) or d) of the provided method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes. In one embodiment the chemically defined medium of the steps a), b), c) or d) of the provided method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes is MT medium. In one embodiment the chemically defined medium of the steps a), b), c) or d) of the provided method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes is MT complete medium. In one embodiment, provided is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes, wherein step b) and c) comprises changing the chemically defined medium to RPMI1640 supplemented with B27 and non-essential amino acids from day 3 to day 10 of differentiation. In one embodiment, provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes, wherein step d) comprises changing the chemically defined medium to HBM medium comprising SingleQuots (Lonza) from day 11 to day 28 of differentiation. In one embodiment the chemically defined medium is MT basic medium. In another embodiment the chemically defined medium is changed to RPMI1640 from day 3 to day 10 of differentiation.
[0132] Provided herein is a method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes. The differentiation state of the NHP hepatocytes can be assessed by testing their capacity to upregulate expression and/or metabolic activity of metabolic enzymes upon treatment with enzyme-inducing drugs. In one embodiment the upregulation of CYP450 enzymes upon treatment with Rifampicin is tested. Uptake and release of rifampicin indicates the presence of hepatocyte specific transporter proteins. Accordingly, in one embodiment the cells are contacted with rifampicin to assess the differentiation state of the cells. In further embodiments the differentiation state of NHP hepatocytes and/or the hepatocyte identity is confirmed by measuring the expression level of metabolic enzymes, in particular CYP450 enzymes. In one embodiment the NHP hepatocytes express CYP450 enzymes as determined by mRNA expression. In one embodiment the expression level of CYP450 enzymes is measured by quantitative real time PCR. In one embodiment the NHP hepatocytes upregulate metabolic enzymes, in particular CYP450 enzymes. In further embodiments the CYP450 enzymes are selected from the group consisting of CYP2B6, CYP3A4, CYP3A7, CYP3A5 and CYP1A2.
[0133] The differentiation state of cells obtained by the methods as described herein can also be assessed by measuring cell surface markers specific for hepatocytes. Cell surface markers specific for hepatocytes are known in the art and described herein and can be measured e.g., using flow cytometry or immunocytochemical or immunofluorescent staining of cells. In one embodiment the NHP hepatocytes express at least one hepatic marker selected from AFP, ALB, MAT as determined by immunofluorescent staining.
[0134] In one embodiment, the hepatocyte identity is confirmed by the presence of intracellular lipid vesicles, which is indicative of lipid storage. Accordingly, in one embodiment, NHP hepatocytes comprise lipid vesicles. Lipid vesicles can by stained using the Bodipy neutral lipid dye as described herein. In one embodiment, the hepatocyte identity is confirmed using the PAS staining as described herein indicative for glycogen storage in hepatocytes. In one embodiment, NHP hepatocytes exhibiting glycogen storage are provided. In a further embodiment hepatocyte identity is assessed by evaluating the capacity of uptake of indocyanine green which is indicative for the presence of hepatocyte specific transporters as described herein. In one embodiment the NHP hepatocytes take up and release indocyanin green in an in vitro assay.
[0135] The innovative method of the present invention provided NHP hepatocytes derived from NHP PSCs, in particular from NHP IPSCs. NHP IPSCs can be generated from cells of healthy or diseased NHP individuals by methods known in the art, wherein the NHP IPSCs are differentiated into NHP hepatocytes using the method described herein. In one embodiment of the present invention provided is a method for generating NHP individual specific hepatocytes.
[0136] In one embodiment method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes further comprises step e) detaching and f) replating the cells. Previous attempts to replate hepatocytes produced from NHP pluripotent cells in vitro have failed. One of skill in the art can appreciate the advantageous efficiency of being able to replate the NHP hepatocytes, especially for application of these cells in drug screening. The NHP hepatocytes produced by the methods described herein can thereby be used in cultures of various formats and assays of various scale as described herein, which is important for research, development and commercial uses.
[0137] Accordingly, provided herein is a method of preparing an in vitro NHP hepatocyte assay, the method comprising the steps of:
[0138] i) providing NHP hepatocytes prepared by the method as described herein;
[0139] ii) contacting the NHP hepatocytes for between about 1 and about 3 hours with Accutase to detach the NHP hepatocytes;
[0140] iii) replating the detached NHP hepatocytes in a suitable assay format.
[0141] Replating can be used to further increase the purity of the NHP hepatocytes, especially if used in conjunction with cell sorting as described herein. In one embodiment said method further comprises sorting of NHP hepatocytes. Prior to sorting the cells are enzymatically dissociated as described herein. Methods of cell sorting based on phenotypic markers such as cell size, enzymatic activity or cell surface expression of one or more marker, or a combination thereof, are well known in the art and can be used in combination with the methods described herein to enrich for cells expressing a defined marker on the cell surface, in particular for cells expressing a hepatocyte marker on the cell surface. Accordingly provided herein is a method of preparing an in vitro NHP hepatocyte assay, wherein the detached NHP hepatocytes are enriched for cells expressing a hepatocyte marker on the cell surface.
[0142] Examples of cell sorting methods include flow cytometry including fluorescence activated cell sorting (FACS) and magnetic activated cell sorting (MACS). In a preferred embodiment, NHP hepatocytes expressing the cell surface marker SCARB1 are enriched. In another preferred embodiment the hepatocyte marker used in the replating step as disclosed herein is SCARB1. The methods described herein for the first time identify SCARB1 as suitable marker for enriching NHP hepatocytes. Flow cytometry analysis presented herein demonstrated that SCARB1 positive cells in a culture can be enriched from less than 40% to up to 60% or more of the total cells, specifically, from less than 20% to up to 80% or more of the total cells. The majority of cells in the SCARB1 positive fraction show typical hepatocyte morphology. Gene expression analysis of sorted and unsorted cells reveal higher expression levels of hepatocyte-specific genes in SCARB1 positive compared to SCARB1 negative cells confirming the usefulness of SCARB1 as a marker for enrichment of hepatocytes.
[0143] Accordingly provided is a method for purifying hepatocytes using magnetic associated cell sorting (MACS) of cells expressing the surface marker SCARB1. This method enriches hepatocytes, e.g., for replating into culture vessel formats suitable for screening applications, e.g., high-throughput candidate drug compound screening. For this purpose, coating matrices enabling long-term culture of hepatocytes e.g., to assess chronic drug toxicity are provided herein. The enriched NHP hepatocytes obtained by the method as described herein can be replated onto laminin, collagen or preferably on matrigel. In one embodiment the NHP hepatocytes are replated in as a matrigel sandwich culture as described herein.
[0144] In a particular embodiment of the present invention provided is a method for differentiating NHP pluripotent stem cells into NHP hepatocytes, the method comprising the steps of:
[0145] a) providing NHP pluripotent stem cells in a feeder-free culture in a chemically defined medium;
[0146] b) contacting the pluripotent stem cells with a Wnt signalling activator to produce endodermal cells;
[0147] c) contacting the endodermal cells with BMP4 and FGF2 or FGF10 to produce immature NHP hepatocytes; and
[0148] d) contacting the immature NHP hepatocytes with HGF, OncostatinM and Dexamethasone to produce NHP hepatocytes;
[0149] e) contacting the NHP hepatocytes for between about 1 and about 3 hours with Accutase to detach the NHP hepatocytes, wherein the detached NHP hepatocytes are enriched for SCARBI-positive cells; and
[0150] f) replating the detached NHP hepatocytes in a suitable assay format.
[0151] Importantly, the method of the present invention provides NHP hepatocytes with an increased yield of cells with hepatocyte identity as described herein. Hepatocyte identity can be assessed using methods as described herein. The innovative methods presented herein are suitable to differentiate NHP pluripotent stem cells, such as NHP IPSCs, into hepatocytes with a yield of more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, preferably more than 80% of total cells. In one embodiment, NHP-IPSC-derived hepatocytes produced by the methods described herein are provided with a yield of more than 10% SCARBI-positive cells, more than 20% SCARBI-positive cells, more than 30% SCARBI-positive cells, more than 40% SCARBI-positive cells, more than 50% SCARBI-positive cells, more than 60% SCARBI-positive cells, more than 70% SCARBI-positive cells, preferably more than 80% SCARBI-positive cells of total cells in culture. These NHP-IPSC-derived hepatocytes display characteristic hepatocyte morphology as well as gene and protein expression of hepatocyte-specific markers, in particular CYP enzymes. On the functional level, provided are cells that show storage of lipids and glycogen, transporter activity and drug-induced upregulation of CYP enzyme expression.
[0152] In one embodiment provided is a feeder-free NHP hepatocyte culture in a chemically defined medium. In one embodiment provided is a NHP hepatocyte obtained by a method as described herein. NHP hepatocytes derived from healthy or diseased individuals represent a predictive in vitro model to study the pathophysiology of diseases like e.g., fatty liver and liver cirrhosis and/or for primate specific pathogens like e.g., Hepatitis viruses.
[0153] The media used in the presented methods is fully defined. The absence of undefined components is important to ensure reproducibility and robustness of the method as described herein. Accordingly, the NHP hepatocytes derived from the method of the present invention are well suitable for compound screening and disease modeling.
[0154] In a further aspect, the generation of a BioBank of NHP hepatocytes is envisaged. In one embodiment provided is a biobank of NHP hepatocytes obtained by a method as described herein. In one embodiment, a BioBank comprising different populations of hepatocytes obtained from different NHP individuals is generated. The NHP individuals may be healthy or diseased. In one aspect, a BioBank of NHP hepatocytes derived from different NHP individuals is used to model genetic variation among NHP populations, particularly regarding drug metabolism. The term BioBank as used herein means a library of biological samples taken from different individuals or species. The hepatocytes obtained by the method as described herein can be cryopreserved in storing them in liquid nitrogen in the presence of a cryoprotective agent such as DMSO. The archived collection of specimen and associated data is intended for research purposes with the aim of studying the pathophysiology of diseases or for drug discovery and toxicity screening as described herein.
[0155] NHP-PSC-derived hepatocytes present a physiologically relevant in vitro liver system for various applications in research and development, e.g., drug discovery and screening. Said in vitro liver system is scalable and therefore suitable for high-throughput screening without the need to sacrifice animals. Furthermore, the provided method is robust and reproducible since the same lineages or even one clone of PSCs can be used to produce any suitable number of hepatocytes. PSCs can be readily frozen and stored over long periods of time also accounting for the reproducibility of the system.
[0156] In a further embodiment, the NHP PSC-derived hepatocytes described herein for use in drug development is provided. In one embodiment, use of the NHP PSC-derived hepatocytes for assessing drug toxicity is provided. The NHP hepatocytes provided according to the method as described herein can be contacted with a compound to be tested for hepatotoxicity and the NHP hepatocytes assesses for viability after a defined incubation time with the test compound. In one embodiment provided is a method for testing the potential toxicity of a compound, the method comprising the steps of: (i) exposing one or more NHP hepatocytes prepared according to the method as described herein to the compound; and (ii) monitoring the one or more mature NHP hepatocytes for signs of toxicity. In a further embodiment provided is a method for testing the potential toxicity of a compound, the method comprising the steps of: (i) exposing one or more hepatocytes prepared according to the method as described herein to the compound, whereby the compound is metabolized by the hepatocytes; (ii) contacting the resulting metabolite of the compound with one or more non-hepatocyte cells; and (iii) monitoring the one or more non-hepatocyte cells for any metabolite-induced changes.
[0157] In yet a further embodiment the NHP PSC-derived hepatocytes described herein are used as a model to evaluate toxicity, off targets and/or efficacy of therapeutic modalities based on antisense therapy (e.g., LNAs). For therapies or therapy strategies related or targeted to specific DNA sequences NHPs are often the only relevant species because of the high sequence homology to human (about 98%). Accordingly, provided is a method to evaluate toxicity, off targets and/or efficacy of LNAs for use in human therapy, wherein the NHP sequence targeted by a specific LNA has a sequence homology to the respective human sequence of at least 95%, at least 96%, at least 97% at least 98% or at least 99%.
[0158] In one embodiment, use of the NHP PSC-derived hepatocytes for in vitro infection model is provided. NHP hepatocytes produced with the methods described herein can be infected with pathogens with a high host specificity for primates (human and non-human primates) or with NHP specific pathogens that can be used as surrogate model for related human-specific pathogens. In a specific embodiment NHP hepatocytes are infected with a virus selected from the group consisting of Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, particularly as in vitro model for liver infection.
[0159] In one embodiment provided is the use of the NHP hepatocytes obtained by a method as described herein or of the biobank as described herein as in vitro model for diseases caused by dysfunction of liver cells. In a further embodiment provided is the use of the NHP hepatocytes obtained by a method as described herein or of the biobank as described herein as in vitro model for infection of liver cells. In one embodiment the infection is selected from the group consisting of viral infection, bacterial infection, fungal infection, or parasitic infection. In a particular embodiment the viral infection is selected from the group consisting of Hepatitis A virus infection, Hepatitis B virus infection, Hepatitis C virus infection. In a preferred embodiment the viral infection is a Hepatitis B virus infection.
[0160] In a further embodiment the hepatocytes obtained by this method can be used as a host system to model viral life cycle, e.g. viral entry, viral replication and viral release. Provided is an in vitro method for supporting the life cycle of a virus, the method comprising the step of exposing one or more NHP hepatocytes prepared according to the method as described herein to the virus, wherein the virus replicates within the one or more NHP hepatocytes. Accordingly, the cells of the present invention can be used as in vitro infection model of a virus.
[0161] In another embodiment the hepatocytes obtained by this method are used for screening and evaluating new targets and compounds for treatment of liver diseases, e.g., those mentioned herein. In one embodiment, the hepatocytes obtained by the methods described herein are derived from diseased subjects. Differentiating hepatocytes from diseased subjects represents a unique opportunity to early evaluate drug safety in a non-human primate background paradigm. In another embodiment the hepatocytes obtained by this method are used as an in vitro model of the liver. In another embodiment the hepatocytes obtained by this method are used to model a human disease by introducing one or several mutations associated with a diseased state in humans or by using and PSC lineage comprising the one or more human disease-related mutations and differentiating the PSCs to NHP hepatocytes as described herein.
[0162] In another embodiment the hepatocytes obtained by this method are used to prepare an in vitro NHP hepatocyte assay. Said in vitro NHP hepatocyte assay is scalable and therefore suitable for high-throughput screening without the need to sacrifice animals. Furthermore, the provided method is robust and reproducible as the same PSCs can be reused or frozen aliquots of defined PSCs can be used consecutively to ensure assay homology. Importantly, data generated with the IPSC-derived hepatocytes obtained by the methods as described herein can be directly compared to results generated with human IPSC-derived hepatocytes as described herein. In one embodiment provided is a method for direct inter-species comparison in the same in vitro assay system and subsequent analysis of species-specific responses.
[0163] Any of the above embodiments may be used singly or in combination.
EXEMPLARY EMBODIMENTS
[0164] 1. A method for differentiating non-human primate (NHP) pluripotent stem cells into NHP hepatocytes, the method comprising the steps of: [0165] a) providing NHP pluripotent stem cells in a feeder-free culture in a chemically defined medium; [0166] b) contacting the pluripotent stem cells with a Wnt signalling activator to produce endodermal cells; [0167] c) contacting the endodermal cells with BMP4 and a fibroblast growth factor to produce immature NHP hepatocytes; and [0168] d) contacting the immature NHP hepatocytes with HGF, OncostatinM and Dexamethasone to produce NHP hepatocytes. [0169] 2. The method of embodiment 1, wherein the chemically defined medium is MT medium. [0170] 3. The method of any one of embodiments 1 and 2, wherein the NHP pluripotent stem cells are provided in a chemically defined medium comprising FGF2 and ActivinA. [0171] 4. The method of any one of embodiments 1 to 3, wherein the NHP pluripotent stem cells are provided on growth-factor reduced MATRIGEL. [0172] 5. The method of any one of embodiments 1 to 4, wherein the NHP pluripotent stem cells are provided at a density of about 45000 cells/cm.sup.2. [0173] 6. The method of any one of embodiments 1 to 5, wherein the NHP pluripotent cells are provided at a density of 45000 cells/cm.sup.2 on growth-factor reduced MATRIGEL-coated plates in MT basic medium supplemented with 15 ng/ml FGF2, 10 ng/ml ActivinA and 10 M ROCK kinase inhibitor Y-27632. [0174] 7. The method of any one of embodiments 1 to 6, wherein the medium is changed every day from day 1 to day 16 and thereafter every second day. [0175] 8. The method of any one of embodiments 1 to 7, wherein step b) and c) comprise contacting the cells with RPMI1640 comprising B27 and NEAA from day 3 to day 10 of differentiation. [0176] 9. The method of any one of embodiments 1 to 8, wherein the Wnt signalling activator is CP21 [0177] 10. The method of any one of embodiments 1 to 9, wherein step b) comprises contacting the cells with Ly294002 and CP21 to induce differentiation. [0178] 11. The method of any one of embodiments 1 to 10, wherein step b) comprises contacting the cells with a chemically defined medium comprising 100 ng/ml ActivinA, 10 M Ly294002 and 1 M CP21 on day 1. [0179] 12. The method of any one of embodiments 1 to 11, wherein step b) comprises contacting the cells with LDN193189. [0180] 13. The method of any one of embodiments 1 to 12, wherein step b) comprises contacting the cells with a chemically defined medium comprising 100 ng/ml ActivinA, 0.25 M LDN193189 and 1 M CP21 on day 2 and day 3 of differentiation. [0181] 14. The method of any one of embodiments 1 to 13, wherein step b) comprises contacting the cells with a chemically defined medium comprising 50 ng/ml or 100 ng/ml ActivinA on day 4 of differentiation. [0182] 15. The method of any one of embodiments 1 to 14, wherein step b) comprises contacting the cells with knock-out serum replacement (KSR) and DMSO. [0183] 16. The method of any one of embodiments 1 to 15, wherein step b) comprises contacting the cells with a chemically defined medium comprising 50 ng/ml or 100 ng/ml ActivinA, 2% knock-out serum replacement (KSR) and 0.5% DMSO from day 5 and day 6 of differentiation. [0184] 17. The method of any one of embodiments 1 to 16, wherein the fibroblast growth factor of step c) is FGF2 or FGF10. [0185] 18. The method of any one of embodiments 1 to 17, wherein step c) comprises contacting the cells with BMP4, DMSO and FGF2 or FGF10. [0186] 19. The method of any one of embodiments 1 to 18, wherein step c) comprises contacting the cells with a chemically defined medium comprising 2% KSR, 10 ng/ml BMP4, 10 ng/ml FGF2 or FGF10, and 0.5% DMSO from day 7 to day 10 of differentiation. [0187] 20. The method of any one of embodiments 1 to 19, wherein step d) comprises contacting the cells with a chemically defined medium comprising 20 ng/ml HGF, 20 ng/ml Oncostatin M, 100 nM dexamethasone and 0.5% DMSO from day 11 to day 28 of differentiation. [0188] 21. The method of any one of embodiments 1 to 20, wherein step d) comprises contacting the cells with a NOTCH signaling inhibitor. [0189] 22. The method of any one of embodiments 1 to 21, wherein step d) comprises contacting the cells with a chemically defined medium comprising 1 M DAPT from day 11 to day 15 of differentiation. [0190] 23. The method of any one of embodiments 1 to 22, wherein step d) comprises changing the chemically defined medium to HBM medium comprising SingleQuots (Lonza) from day 11 to day 28 of differentiation. [0191] 24. The method of any one of embodiments 1 to 23, wherein the cells take up and release rifampicin indicating the presence of hepatocyte specific transporter proteins. [0192] 25. The method of embodiments 1 to 24, wherein the NHP hepatocytes upregulate metabolic enzymes. [0193] 26. The method of any one of embodiments 1 to 25, wherein the NHP hepatocytes comprise lipid vesicles. [0194] 27. The method of any one of embodiments 1 to 26, wherein the NHP hepatocytes express at least one hepatic marker selected from the group consisting of AFP, ALB and IAT. [0195] 28. The method of any one of embodiments 1 to 27, wherein the NHP hepatocytes take up and release indocyanin green in an in vitro assay. [0196] 29. The method of any one of embodiments 1 to 28, wherein the NHP hepatocytes express CYP450 enzymes. [0197] 30. The method of any one of embodiments 1 to 29, wherein the NHP pluripotent stem cells of step a) are induced pluripotent stem cells (IPSCs). [0198] 31. The method of any one of embodiments 1 to 30 wherein the NHP pluripotent stem cells are derived from a species selected from the group consisting of Cynomolgus monkey (Macaca fascicularis) and Rhesus monkey (Macaca mulatta). [0199] 32. A feeder-free NHP hepatocyte culture in a chemically defined medium. [0200] 33. A NHP hepatocyte obtained by a method according to any one of embodiments 1 to 31. [0201] 34. A biobank of NHP hepatocytes obtained by a method according to any one of embodiments 1 to 31. [0202] 35. Use of the NHP hepatocytes obtained by a method according to any one of embodiments 1 to 31 or of the biobank of embodiment 34 as in vitro model for diseases caused by dysfunction of liver cells. [0203] 36. Use of the NHP hepatocytes obtained by a method according to any one of embodiments 1 to 31 or of the biobank of embodiment 34 as in vitro model for infection of liver cells. [0204] 37. The use of embodiment 36, wherein infection is selected from the group consisting of viral infection, bacterial infection, fungal infection, or parasitic infection. [0205] 38. The use of embodiment 37, wherein the viral infection is selected from the group consisting of Hepatitis A virus infection, Hepatitis B virus infection, Hepatitis C virus infection, Eppstein Barr virus infection. [0206] 39. The use of embodiment 38, wherein the viral infection is a Hepatitis B virus infection. [0207] 40. A method for testing the potential toxicity of a compound, the method comprising the steps of: (i) exposing one or more NHP hepatocytes prepared according to the method of any one of embodiments 1 to 31 to the compound; and (ii) monitoring the one or more mature NHP hepatocytes for signs of toxicity. [0208] 41. A method for testing the potential toxicity of a compound, the method comprising the steps of: (i) exposing one or more NHP hepatocytes prepared according to the method of any one of embodiments 1 to 31 to the compound, whereby the compound is metabolized by the NHP hepatocytes; (ii) contacting the resulting metabolite of the compound with one or more non-hepatocyte cells; and (iii) monitoring the one or more non-hepatocyte cells for any metabolite-induced changes. [0209] 42. An in vitro method for supporting the life cycle of a virus, the method comprising the step of exposing one or more NHP hepatocytes prepared according to the method of any one of embodiments 1 to 31 to the virus, wherein the virus replicates within the one or more NHP hepatocytes. [0210] 43. Use of any of the cells of any one of the embodiments 1 to 31 for in vitro testing of toxicity of a compound. [0211] 44. Use of any of the cells of any one of the embodiments 1 to 31 as in vitro infection model of a virus. [0212] 45. A method of preparing an in vitro NHP assay, the method comprising the steps of: [0213] i) providing NHP hepatocytes prepared by the method of any one of embodiments 1 to 31; [0214] ii) contacting the NHP hepatocytes for between about 1 and about 3 hours with Accutase to detach the NHP hepatocytes; [0215] iii) replating the detached NHP hepatocytes in a suitable assay format. [0216] 46. The method of embodiment 45, wherein the detached NHP hepatocytes are enriched for SCARBI-positive cells before replating. [0217] 47. The method of embodiment 46, wherein the cells are enriched using fluorescence activated or magnetic-activated cell sorting. [0218] 48. The method of any one of embodiments 45 to 47, wherein the NHP hepatocytes are replated onto laminin, collagen or matrigel. [0219] 49. The method of any one of embodiments 45 to 47, wherein the NHP hepatocytes are replated as a matrigel sandwich culture. [0220] 50. The methods and used essentially as described herein.
EXAMPLES
[0221] The following are non-limiting examples of compositions and methods of the invention. It is understood that various other embodiments may be practiced, given the general description provided above.
General Methods
Cell Culture
[0222] Cynomolgus fibroblast-derived IPSCs were cultured on MATRIGEL (BD Bioscience)-coated plates in MT basic medium (DMEM/F12+Glutamax with insulin 7 g/ml, monothioglycerole 450 M, 1 Lipid concentrate (Thermo Fisher), BSA 5 mg/ml, sodium selenite 14 ng/ml, lx non-essential amino acids, heparin 2 mg/ml, transferrin 15 g/ml, 220 M ascorbic acid-2-phosphate) with the addition of bFGF 15 ng/ml and ActivinA 10 ng/ml (MT complete medium) at 37 C. and 5% CO.sub.2. Cells were passaged every 2-4 days incubating using Gentle Cell Dissociation Reagent (GCD).
[0223] Detachment of cells for passaging was performed either with Accutase (StemCell Technologies) for 1 to 3 minutes at 37 C. or Gentle Cell Dissociation (GCD, StemCell Technologies) for 7 minutes at RT, dependent whether single cells or cells in colonies were needed.
[0224] For dissociation with Accutase, cells were washed with PBS, Accutase was added for 1 to 3 minutes at 37 C. and inactivated with the same volume of MT basic medium and cells were collected. After centrifugation for 5 minutes at 200 g, cells were resuspended in MT complete medium with 10 M Rock-inhibitor Y-27632 and seeded.
[0225] For detachment with GCD, cells were washed with PBS, GCD was added for 7 minutes at RT and removed afterwards. Cells were carefully resuspended in MT complete medium and seeded.
Hepatocyte Differentiation of Cynomolgus IPSCs
[0226] Cynomolgus IPSCs were seeded at d0 in a density of 45000 cells/cm.sup.2 on growth-factor reduced MATRIGEL (BD Bioscience)-coated plates in MT basic medium+15 ng/ml FGF2, 10 ng/ml ActivinA and 10 M Rock-Inhibitor Y-27632. Generally, media change was performed every day until day 16 and afterwards every second day. Basic medium for differentiation was MT basic medium (DMEM/F12+Glutamax with insulin 7 g/ml, monothioglycerole 450 M, 1 Lipid concentrate, BSA 5 mg/ml, sodium selenite 14 ng/ml, 1 non-essential amino acids, heparin 2 mg/ml, transferrin 15 g/ml, 220 M ascorbic acid-2-phosphate) or changing to RPMI1640 medium+B27 1:50+non-essential amino acids 1:100 from day 3 of differentiation onwards. On day 1 of differentiation, medium was changed to MT basic medium with 100 ng/ml ActivinA, 10 M Ly294002 and 1 M CP21 (Roche GSK3 inhibitor). Then, cells were treated for two days with 100 ng/ml ActivinA, 0.25 M LDN193189 and 1 M CP21. At day 4, the medium was changed for three days to the supplements 50 ng/ml ActivinA, 2% knock-out serum replacement (KSR) and 0.5% DMSO. The protocol was modified to a prolonged step of high ActivinA which consisted of 100 ng/ml ActivinA at day 4 of differentiation. To induce hepatic specification, cells were maintained for four days in medium supplemented with 2% KSR, 10 ng/ml BMP4, 10 ng/ml FGF2 or FGF10 and 0.5% DMSO. From day 11 onwards, hepatocyte-like cells were cultured in hepatocyte maturation medium consisting of MT medium supplemented with 20 ng/ml HGF, 20 ng/ml Oncostatin M, 100 nM dexamethasone and 0.5% DMSO. Modification included the addition of 1 M DAPT between day 11 and day 20. Further modifications included the change of the basis medium for maturation at day 11 to HBM medium+SingleQuots (Lonza).
Immunofluorescence Staining and Flow Cytometry Analysis
[0227] Cells were fixed with 4% PFA and then permeabilized with 0.1% TritonX in PBS (including Ca2+ and Mg2+). After blocking with 0.1% TritonX in SuperBlock, cells were stained with primary antibodies for 1 to 2 hours at RT or overnight at 4 C. The used antibodies are depicted in Table 2. Subsequently, cells were washed and stained with secondary antibodies conjugated to Alexa488 (1:1000), Alexa555 (1:1000), and Alexa647 (1:200) (all from molecular probes) for 1 to 2 hours at RT or overnight at 4 C. Nuclei were stained with Hoechst 1:1000 (Molecular Probes) for 5 minutes. Between incubations, samples were washed with PBS (including Ca2+ and Mg2+). Cells were imaged using a Zeiss inverted microscope. Images were analyzed using ImageJ software. Quantifications of staining was performed using an Operetta imaging system and the Harmony image analysis software (PerkinElmer).
TABLE-US-00002 TABLE 2 List of primary antibodies and their dilution used for immunofluorescence staining. antigen supplier species catalog number dilution OCT3/4 SantaCruz goat sc-8629 1:200 SOX2 millpore rabbit AB5603 1:500 SOX1 SantaCruz goat sc-17318 1:250 NANOG SantaCruz rabbit sc-33759 1:100 FOXA2 abcam rabbit ab40874 1:500 SOX17 R&D Systems goat AF1924 1:500 AFP sigma mouse A8452 1:250 1AT Dako rabbit A0012 1:2000/1:5000 ALB Cedarlane mouse CL2513A 1:500
[0228] For flow cytometry, cells were detached with Accutase and stained for 15 minutes at 4 C., dark in 100 l MACS running buffer (Miltenyi biotec) containing primary antibodies (Table 3): 5 l anti-CXCR4, 5 l anti-Thrombomodulin, 10 l anti-KDR, or 2.5 l anti-CD238 per 0.510.sup.6 cells, for more than 0.510.sup.6 cells the double amount of antibody was used. Afterwards, cells were washed with MACS running buffer, and resuspended in 500 l MACS running buffer. Flow cytometry was performed using a BD FACS Canto, and data were analyzed with FlowJo software.
TABLE-US-00003 TABLE 3 Antibodies used for flow cytometry analysis and MACS sorting. antigen conjugate supplier catalog number SCARB1 PE Biolegend 363204 ASGR1 PE CD184/CXCR4 APC Biolegend 306510 CD309/KDR PE Miltenyi Biotec 130-093-598
Replating
[0229] At day 21 of differentiation, immature hepatocytes were dissociated with different reagents for the time indicated in
[0230] At day 22 of differentiation, detachment with each dissociation reagent was performed with each one well differentiated with DAPT (Calbiochem) or without the addition of DAPT. GFR-MG 1:40 was added to the medium just before plating on collagen-coated wells. Each 1 well was detached with trypsin 0.25% for 15 minutes, resuspended after addition of 500 l PBS (without Ca.sup.2+ and Mg.sup.2+), centrifuged and replated. The same procedure was performed with Accutase for 1 hour. Each 1 well was detached with Accutase for 1 hour, resuspended after addition of 500 l PBS (without Ca.sup.2+ and Mg.sup.2+), centrifuged and replated on uncoated 24-well plates. Cells were allowed to attach for 1 hour, the supernatant was taken and cells plated on collagen-coated wells with addition of GFR-MG. Cells in uncoated wells were cultivated as well.
[0231] For all previously mentioned replating experiments, cells were transferred at a ratio 2:1 regarding growth area of the cell culture dishes (e.g., hepatocytes from 26 wells were transferred to 1 6 well). Every other day, 50% of medium was exchanged with hepatocyte maturation medium.
[0232] The following differentiation was performed in B6 plates. Cells were dissociated with one of the following conditions: Accutase for 1 hour, trypsin 0.25% for 15 minutes, or manual isolation of hepatocyte colonies. Cells were transferred at a ratio 2:1 as described above. For the first media change, GFR-MG was added 1:40 to the medium. Medium change was performed every day.
Magnetic-Activated Cell Sorting
[0233] Magnetic-activated cell sorting (MACS) of SCARB1-positive cells was performed at day 22 or day 29 of hepatocyte differentiation. Cells were detached with Accutase, filtered through a 100 m cell strainer, centrifuged and resuspended in cold MACS running buffer for counting. After centrifugation at 200 rpm for 5 minutes, cells were resuspended in 95 l buffer supplemented with 5 l anti-SCARB1-PE antibody per 110.sup.6 cells and incubated for 15 minutes, dark, at 4 C. Cells were washed by addition of 10 volume of MACS running buffer and centrifuged. The cells were resuspended in 80 l cold MACS running buffer and 20 l anti-PE microbeads (Miltenyi Biotec) per 110.sup.7 cells and incubated for 15 minutes, dark. Cells were washed by addition of 10 volume MACS running buffer, centrifuged, resuspended in 500 l buffer, filtered through a 70 m cell strainer and subjected to MACS using an autoMACSpro separator (Miltenyi). All fractions were counted, 110.sup.5 cells per sample subjected to flow cytometry analysis and the SCARB1+cells were seeded on plates in differentiation medium of day 22/29 at a density of 100000 to 200000 cells/cm.sup.2. The following coating procedures were used: Laminin 521 (20 g/ml), Collagen (10 g/cm2), and growth factor reduced MATRIGEL (1:20 dilution). Plates were centrifuged for 3 minutes at 300 rpm to enhance attachment of cells. MATRIGEL sandwich coating was performed 24 hours after seeding. Medium was removed from the cells and replaced by cold hepatocyte maturation medium containing GFR-MG at a dilution of 1:20. Cells were incubated at 37 C., 5% CO.sub.2 for 1 hour, then 2 volume of prewarmed hepatocyte maturation medium was added
Staining of Differentiated Hepatocytes
[0234] BODIPY Staining
[0235] Staining of lipid droplets in differentiated hepatocytes was performed with Bodipy neutral lipid dye (Invitrogen, D3922). The Bodipy solution was diluted 1:1000 in medium and incubated for 20 minutes on the cells at 37 C. Cells were washed 1 with PBS and Bodipy fluorescence was analyzed using a fluorescence microscope.
[0236] PAS Staining
[0237] Cells on day 28-30 of differentiation were fixed with 4% paraformaldehyde in water for 10 minutes and washed 1 with double distilled water. Afterwards, the cells were stained with PAS staining kit (Sigma-Aldrich): 5 minutes with 1% periodic acid solution, washed 5 times with double distilled water, 15 minutes incubation with Schiff's solution and washed with tap water for 5 times.
[0238] Indocyanine Green Uptake
[0239] The indocyanine green powder (ICG, Sigma) was freshly dissolved in DMSO at 100 mg/ml, then added to the culture medium of differentiated hepatocytes to a final concentration of 1 mg/ml. After incubation at 37 C. for 60 minutes, the medium with ICG was discarded, the cells were washed 3 times with PBS and new culture medium was added. The cellular uptake of ICG was examined by microscopy. To monitor the release of the ICG, the wells were cultured for an additional 24 hours.
Gene Expression Analysis of CYP-P450 Enzymes
[0240] Primary cynomolgus hepatocytes were cultured in Williams E Medium supplemented with 5% FBS, 0.5% Penicillin/Streptomycin, human recombinant insulin 6.25 g/ml, human transferrin 6.25 g/ml, selenous acid 6.25 g/ml, BSA 1.25 mg/ml, linoleic acid 5.35 g/ml, GlutaMAX 2 mM, HEPES pH 7.4 15 mM, 0.1 M dexamethasone in DMSO, the day before assay performance. Primary hepatocytes and hepatocytes derived from cynomolgus IPSCs were treated with DMSO, Rifampicin, dexamethasone and subjected to CYP assay and RNA isolation for qRT-PCR.
[0241] CYP-P450Glo Assay
[0242] To determine the CYP-P450 activity cells derived from cynomolgous IPSCs, the cells of the hepatocyte differentiation as well as primary cynomolgous hepatocytes as positive control were cultured in 24-well plates. Cells were treated with DMSO 1:200, 25 M Rifampicin or 50 M dexamethasone in culture medium (MT basic without supplements) for 24 hours. Subsequently, the CYP activity was measured with the P450 Glo assay Kit (Promega) for CYP3A4 activity according to the manufacturer's instructions and the luminescence was measured. The cell treatment was performed in duplicates and the second plate was subjected to RNA isolation.
[0243] Gene Expression Analysis
[0244] Cells were lysed in 350 l RLT lysis buffer (Qiagen) supplemented with -Mercaptoethanol 1:100 per 1 well of a 24-well plate and RNA was isolated with RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions including the optional DNAse digest step and elution with 30 l water. Transcription to cDNA was performed with Transcriptor first strand DNA synthesis Kit (Roche) according to the manufacturer's instructions for Procedure B including the optional denaturation step.
[0245] Primers (forward and reverse) and probes (UPL) for qRT-PCR are depicted in Table 4. The UPL probes are commercially available probes from Roche Diagnostics (lifescience.roche.com).
[0246] The qPCR was performed in 384-well plates with 10 l reaction volume. Each 5.6 ng cDNA or control RNA was used per sample in combination with each 0.4 M forward and reverse primer, 0.2 M UPL probe and 1 LightCycler 480 Probes Master. The experiment was performed in technical triplicates. The Roche LightCycler-480 system was run with the program shown in Table 5.
TABLE-US-00004 TABLE4 Taqmanprimersandprobesusedforgeneexpression analysisofCYP-P450enzymes. Gene primerforward/reverse UPLprobe GAPDH gaaggtgaaggtcggagtca UPL147 aaccatgtagttgaggtcaatgaa CYP2B6 gaagcttttatccccttctcct UPL35 gggtgtcagatcgatgtcttc CYP3A4 tgtgttggtgagaaatctgagg UPL38 ctgtaggccccaaagaca CYP3A7 gtgctggtgagaaatctgagg UPL38 ctgtaggccccaaagacg CYP3A5 ggagttccgccctgaaag UPL56 tccagttccaaagggtgtgt CYP1A2 taatatcaagcacttgcctctaca UPL53 ccctgagcacccagaatacc ALB gatgtcttcctgggcatgtt UPL146 tggcttcgtatgccttgg
TABLE-US-00005 TABLE 5 LightCycler program for qRT-PCR analysis. Temper- Acq. Ramp Program Cycles Analysis ature Mode Time C./s Pre-Incubation 1 None 95 C. None 10 min 4.8 Amplification 50 Quanti- 95 C. None 10 sec 4.8 fication 60 C. None 30 sec 2.5 72 C. Single 5 sec 4.8 Cooling 1 None 40 C. 1 min 2.5
Hepatotoxicity Assay
[0247] NHP-IPSC-derived hepatocytes were enriched using MACS and replated in matrigel sandwich condition as described above. To assess cell response to hepatotoxic compounds cells were treated with 100 M troglitazone (Sigma) for 24 hours. Cell viability was measured using the WST-1 reagent (Sigma). 10 l WST-1 reagent were added directly to the medium (1:10 dilution) and cells were incubated for 4 hours at 37 C., 5% CO.sub.2. Plates were stirred for 15 seconds and absorbance at 405 nm was measured.
Example 1
Establishing a Protocol for the Generation of Hepatocytes from NHP-IPSCs
[0248] Culture Conditions for Feeder-Free Cultivation of NHP-IPSCs
[0249] To differentiate NHP-IPSCs into hepatocytes we tested a standard protocol to derive hepatocytes from human pluripotent stem cells. This protocol was developed for human pluripotent stem cells cultured in feeder-free conditions. (Cell Stem Cell. 2013 Feb. 7; 12(2):238-51. doi: 10.1016/j.stem.2012.11.011. Epub 2012 Dec. 13. A TALEN genome-editing system for generating human stem cell-based disease models. Ding Q1 & Cowan C A et al.). However, in these culture conditions, NHP-IPSCs did not commit towards the endoderm but differentiated to the neural lineage. Neural commitment of cynomolgus IPSCs was also already observed in standard culture conditions used for human pluripotent stem cells. Thus, culture conditions for differentiation as well as for pluripotent cells established for human IPSCs are not appropriate for NHP-IPSCs and differentiation protocols need to fulfill different criteria for NHP cells than for human cells. First, we developed feeder-free culture conditions for NHP-IPSCs by modifying a culture system established for monkey embryonic stem cells. Ono, T. et al. A single-cell and feeder-free culture system for monkey embryonic stem cells. PLoS One 9, e88346, doi:10.1371/journal.pone.0088346 (2014). In this study, a defined medium (MT medium) was used in combination with collagen coating. We combined MT medium with MATRIGEL coating as this combination proved most suitable to culture NHP-IPSCs in the pluripotent state as indicated by immunostaining for the pluripotency markers OCT4, SOX2, NANOG and negative staining for the neuroectodermal marker SOX1 (
[0250] Endoderm Induction in NHP-IPSCs
[0251] In vivo, hepatocytes arise from the endodermal lineage which differentiates into hepatic endoderm and further into hepatocytes. To derive hepatocytes from pluripotent stem cells, efficient endoderm induction is a crucial step. In human PSCs, endoderm formation can be induced by high concentrations of ActivinA in defined medium conditions. However, as these conditions did not show the expected effects in NHP-IPSC, we tested various combinations of growth factors, basic media and cell densities to induce endoderm commitment in monkey stem cells. Importantly, as monkey IPSCs seem to have a bias towards ectoderm commitment, we tested activation of Wnt signaling to inhibit ectoderm and enhance endoderm formation. Additionally, we analyzed the effect of MT basic medium on endoderm commitment as standard media used for human cells (e.g., RPMI) appeared to promote ectoderm formation in monkey cells.
[0252] Endoderm specification was analyzed by determining the number of cells positive for the endodermal markers FOXA2 and SOX17 on day 4 and day 7 of differentiation. Regarding the seeding cell number, the best results were obtained when using 45000 cells/cm.sup.2 with about 53% SOX17 and FOXA2 double positive cells for differentiation in RPMI medium as basic medium and 63% double positive cells for differentiation in MT medium as basic medium. This cell density was used in further experiments assessing the impact of different media compositions on endoderm formation (
[0253] Next, we sought to assess the optimal conditions for hepatic endoderm specification as well as hepatocyte differentiation. Again, we focused on identifying the ideal media compositions for NHP-IPSCs, as previous experiments had shown that media established for human cells (e.g., HBM medium) were not suitable.
[0254] Thus, the differentiation was performed in either MT medium or RPMI medium and the maturation in either MT medium or HBM medium (
[0255] Expression of 1AT and AFP at day 15 of differentiation as well as ALB at day 21 was used as marker for hepatocyte commitment and maturation, respectively. The comparison of the different media combinations showed the highest number of positive cells in the conditions MT/MT and RPMI/MT. Only few cells were stained in the conditions MT/HBM and RPMI/HBM indicating that HBM medium which is developed for human hepatocytes is not suitable for NHP cells (
[0256] This was also confirmed by analyzing the morphology of differentiated cells at day 28 of differentiation. Large areas of hepatocytes were present in MT/MT and RPMI/MT conditions which can be recognized by their morphology and the presence of lipid droplets. In MT/HBM and RPMI/HBM conditions almost no hepatocytes were generated, instead cells formed displayed fibroblast-like morphology or formed cyst-like structures (
Example 2
Optimization of Hepatocyte Differentiation
[0257] Having determined the ideal seeding number and the media combination MT/MT as best conditions for hepatocyte commitment, we sought to further optimize the protocol by testing various combinations of growth factors and small molecules in the protocol.
[0258] Thus, we tested the impact of prolonged addition of high ActivinA which has been shown to increase the amount of cells with endoderm commitment. Second, FGF10 treatment instead of FGF2 addition was tested as it has been reported that FGF10 can improve hepatocyte differentiation. Ogawa, et al., Development. 2013; 140: 3285-3296 Third, the Notch signaling is involved in bile duct formation (Jin, et al. Dongwuxue Yanjiu 2011; 32: 391-395; Wang, T. et al. Cell Tissue Res. 2014; 357: 173-184) and addition of DAPT to inhibit Notch signaling might prevent formation of cholangiocyte-like cells and therefore addition of DAPT from day 11 to day 20 was tested as well.
[0259] Cells were differentiated using combinations of all three modifications (
[0260] The results show that FGF2 treatment resulted in more ALB positive cells than FGF10 treatment. Comparison of high and low ActivinA treatment in combination with FGF2 showed that there were more hepatocyte-like cells for prolonged high ActivinA treatment. DAPT treatment from day 11 to day 20 of differentiation did not induce a significant increase in differentiation efficiency. However, it was observed that cells were more homogenously distributed after addition of DAPT. Analysis of the ALB stained area showed that the Act100/FGF2/+DAPT condition had the lowest variance between the three replicates. Therefore, this combination was determined as most efficient approach for hepatocyte differentiation leading to about 20% SCARB1 positive cells.
Example 3
Characterization of NHP-IPSC Derived Hepatocytes
[0261] As previously shown in Example 1, NHP-IPSC-derived hepatocytes displayed hepatocyte morphology and expressed characteristic markers such as AFP, ALB, and 1AT. To further characterize the cells, we analyzed their capacity of typical hepatic functions (
[0262] Last, we analyzed the expression of CYP450 enzymes as these proteins are responsible for numerous metabolic activities of hepatocytes. We treated the cells with Rifampicin and Dexamethasone which are both known to induce expression of CYP enzymes. Quantitative real time PCR revealed that CYP mRNAs were upregulated in differentiated cells compared to undifferentiated NHP-IPSCs albeit expression levels were lower than in primary hepatocytes (
[0263] Treatment with Rifampicin resulted in an increase in CYP mRNA expression in both primary and IPSC-derived hepatocytes while Dexamethasone induced CYP expression only in primary cells (
[0264] In summary, these findings show that NHP-IPSC-derived cells display key feature of hepatocytes, such as lipid and glycogen storage, transporter activity and expression of CYP enzymes.
Example 4
Replating and Sorting Strategies
[0265] Stem cell-derived somatic cell types have a great potential as in vitro system for drug screening, especially if the corresponding primary cell type is not available or only in limited quantities as it is the case for hepatocytes. However, drug screening requires the availability of cells in suitable plate formats. For this purpose, we tested different strategies to replate hepatocytes derived from NHP-IPSCs. As mature hepatocytes are sensitive cells growing in dense clusters, replating approaches should enable efficient detachment of cells while not affecting their viability. After testing of various dissociation reagents, most conditions did not result in subsequent cell attachment or attachment of other cells but not hepatocytes. Only dissociation with Accutase for 3 hours and dissociation with 0.05% trypsin for 3 hours led to attachment of hepatocytes which expressed Albumin (
[0266] Another requirement for efficient application of cell models in drug screening is the generation of a pure culture of the desired cell type. For this purpose, we sought to identify hepatocyte-specific surface proteins that could be used for cell sorting strategies. For human cells, it has been shown that ASGR1 can be used as surface marker to enrich for hepatocytes (Basma, H. et al. Gastroenterology. 2009; 136: 990-999). However, no ASGR1 positive cells could be detected in NHP cells at day 22 and day 28 of differentiation making it necessary to identify other suitable surface antigens (
[0267] Thus, we performed magnetic associated cell sorting of NHP-IPSC derived cells. Flow cytometry analysis revealed that this strategy led to an enrichment of SCARB1 positive cells from 20% up to 80% (
[0268] Next, we sought to identify conditions allowing culture of IPSC-hepatocytes after replating for at least 5 to 7 days to ensure feasibility of this cell system for various assays. We tested different coating strategies known to be suitable for hepatic cell types, namely Laminin, Collagen and MATRIGEL sandwich culture (see material and methods for details). Cells attached on all matrices tested, however, in MATRIGEL sandwich culture, cell morphology was better compared to other matrices (
Example 5
Application of NHP-IPSC Derived Hepatocytes as In Vitro System
[0269] Stem cell-derived hepatocytes represent a promising in vitro system for basic and translational research as well as for drug development. Important applications are analysis of drug-induced liver injury or the as model systems for infections with liver-specific pathogens. Currently, primary hepatocytes are used for this purposes, however, they are linked to various disadvantages like their limited availability and the variability between different donors/batches. Several studies report successful implementation of human stem cell-derived hepatocytes as in vitro systems, however, for NHPs primary cells are currently the only option.
[0270] To assess the feasibility of NHP IPSC-derived hepatocytes as model system for drug-induced liver injury, we treated the hepatocytes with Troglitazone, a small molecule with known hepatotoxic effects. After 24 hours, a decrease in cell viability was detected in Troglitazone-treated NHP IPSC-derived hepatocytes compared to control cells (
[0271] Next, we sought to evaluate the feasibility of NHP IPSC-derived hepatocytes as in vitro system for liver injury induced by oligonucleotides developed for antisense therapy. Oligonucleotide therapy can cause severe hepatocyte toxicity because the oligonucleotides accumulate in the liver. There is a need for relevant in vitro systems to model these effects to evaluate oligonucleotide candidates prior to in vivo studies. Thus, NHP IPSC-derived hepatocytes were treated with oligonucleotides which are known to be toxic in mice. In vivo toxicity could be reproduced in NHP IPSC-derived hepatocytes suggesting these cells as relevant model to evaluate oligonucleotide safety in NHPs. Importantly, these effects could not be modeled in NHP primary hepatocytes potentially due to the fact that these cells de-differentiate rapidly in culture. This underlines the advantages of the IPSC-based hepatocyte system as it allows unlimited supply of cells responsive to oligonucleotide toxicity in vitro.
[0272] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention. The disclosures of all patent and scientific literature cited herein are expressly incorporated in their entirety by reference.