METHOD OF QUANTIFYING MUTANT ALLELE BURDEN OF TARGET GENE
20190292586 ยท 2019-09-26
Inventors
Cpc classification
C12Q2545/107
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
International classification
C12Q1/6876
CHEMISTRY; METALLURGY
Abstract
Disclosed herein is a method of quantifying a mutant allele burden of a target gene in a subject. The method includes providing a first plasmid that includes a mutant allele sequence and an internal control sequence, and a second plasmid that includes a wild-type allele sequence and the internal control sequence, and subjecting DNA of the subject to quantitative polymerase chain reaction to measure a mutant allele expression level of the target gene, so as to determine the mutant allele burden of the target gene in the subject based on a standard curve of the mutant allele burden of the target gene created by serial dilution of the first and second plasmids.
Claims
1. A method of quantifying a mutant allele burden of a target gene in a subject, comprising: providing a first plasmid that includes a mutant allele sequence located at a first region of the target gene, and an internal control sequence derived from the target gene and located at a second region of the target gene, the second region being different from the first region; providing a second plasmid that includes a wild-type allele sequence located at the first region of the target gene, and the internal control sequence; subjecting genomic DNA of the subject to a first quantitative polymerase chain reaction using a reaction mixture containing a mutant allele-specific primer pair and a first detectable probe for detecting the mutant allele sequence, and an internal control sequence-specific primer pair and a second detectable probe for detecting the internal control sequence, so as to measure a mutant allele expression level of the target gene; subjecting standard diluents of the first plasmid formed from serial dilution with the second plasmid to a second quantitative polymerase chain reaction using the reaction mixture, so as to create a standard curve of the mutant allele burden of the target gene; and correlating the measured mutant allele expression level of the target gene to the standard curve, so as to determine the mutant allele burden of the target gene in the subject.
2. The method as claimed in claim 1, wherein the mutant allele sequence has a nucleotide length that is substantially identical to that of the wild-type allele sequence, and the first plasmid has a nucleotide length that is substantially identical to that of the second plasmid.
3. The method as claimed in claim 1, wherein the reaction mixture for each of the first and second quantitative polymerase chain reaction further includes a blocking agent that hybridizes to the wild-type allele sequence of the target gene and that inhibits binding of at least one primer of the mutant allele-specific primer pair to the wild-type allele sequence of the target gene.
4. The method as claimed in claim 3, wherein the blocking agent is an oligonucleotide having a non-extendable moiety at 3-terminus, the non-extendable moiety being selected from the group consisting of peptide nucleic acid, locked nucleic acid, zip nucleic acid, bridged nucleic acid, threose nucleic acid, triazole nucleic acid, amino-C7, non-extendable nucleotide, minor groove binder, and combinations thereof.
5. The method as claimed in claim 4, wherein the blocking agent is an oligonucleotide having di-deoxynucleotide triphosphates at the 3 terminus thereof.
6. The method as claimed in claim 1, wherein the target gene is a disease-associated gene.
7. The method as claimed in claim 6, wherein the disease-associated gene is selected from the group consisting of cancer-associated genes, genes associated with a hereditary disease, and combinations thereof.
8. The method as claimed in claim 7, wherein the target gene is selected from the group consisting of JAK2, K-Ras, B-Raf, EGFR, and combinations thereof.
9. The method as claimed in claim 8, wherein the target gene is JAK2.
10. The method as claimed in claim 9, wherein the mutant allele sequence is JAK2 V617F.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Other features and advantages of the present disclosure will become apparent in the following detailed description of the embodiments with reference to the accompanying drawings, of which:
[0015]
[0016] represents partial JAK2 exon 21 as an internal control, JAK2 WT/V617F represents wild-type or mutant JAK2 exon 14, and JAK2 c.1849 G>T represents JAK2 V617F mutation position;
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
DETAILED DESCRIPTION
[0024] It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms apart of the common general knowledge in the art, in Taiwan or any other country.
[0025] For the purpose of this specification, it should be clearly understood that the word comprising means including but not limited to, and that the word comprise has a corresponding meaning.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the meaning as commonly understood by a person skilled in the art to which the present disclosure belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present disclosure. Indeed, the present disclosure is in no way limited to the methods and materials described. For clarity, the following definitions are used herein.
[0027] The terms nucleic acid, nucleic acid sequence, and nucleic acid fragment as used herein refer to a deoxyribonucleotide or ribonucleotide sequence in single-stranded or double-stranded form, and comprise naturally occurring nucleotides or artificial chemical mimics. The term nucleic acid as used herein is interchangeable with the terms gene, cDNA, mRNA, oligo-nucleotide, and polynucleotide in use.
[0028] Unless otherwise indicated, a nucleic acid sequence, in addition to the specific sequences described herein, also covers its complementary sequence, and the conservative analogs, related naturally occurring structural variants and/or synthetic non-naturally occurring analogs thereof, for example, homologous sequences having degenerative codon substitution, and conservative deletion, insertion, substitution, or addition. Specifically, degenerative codon substitution may be produced by, for instance, a nucleotide residue substitution at the third position of one or more selected codons in a nucleic acid sequence with other nucleotide residue(s).
[0029] As used herein, the term allele refers generally to alternative DNA sequences at the same physical locus on a segment of DNA, such as, for example, on homologous chromosomes. An allele can refer to DNA sequences which differ between the same physical locus found on homologous chromosomes within a single cell or organism or which differ at the same physical locus in multiple cells or organisms (allelic variant). In certain embodiments, an allele can correspond to a single nucleotide difference at a particular physical locus. In other embodiments, an allele can correspond to nucleotide (single or multiple) insertion or deletion.
[0030] The term wild-type as used herein refers to a gene or allele which has the characteristics of that gene or allele when isolated from a naturally occurring source. A wild-type gene or a wild-type allele is that which is most frequently observed in a population and is arbitrarily designated as the normal or wild-type form of the gene or allele.
[0031] As used herein, the term mutant or mutated refers to a gene or allele which displays modifications in sequence when compared to the wild-type gene or allele. The term mutation refers to a change in the sequence of nucleotides of a normally conserved nucleic acid sequence resulting in the formation of a mutants differentiated from the normal (unaltered) or wild type sequence. Mutations can generally be divided into two general classes, namely, base-pair substitutions (e.g. single nucleotide substitutions) and frame-shift mutations. The latter entail the insertion or deletion of one to several nucleotide pairs.
[0032] As used herein, the term allele burden or mutant allele burden refers to the ratio of mutant allele to the total allele (i.e. the combination of the mutant and wild-type alleles) in, for example, hematopoietic cells.
[0033] The term primer as used herein refers to a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis under appropriate conditions, in an appropriate buffer and at a suitable temperature. The appropriate length of a primer depends on the intended use of the primer, but typically ranges from 15 to 30 nucleotides. A primer sequence need not be exactly complementary to a template, but must be sufficiently complementary to hybridize with a template.
[0034] As used herein, the term primer pair means a set of primers including a 5 upstream primer, which hybridizes to the 5 end of the DNA sequence to be amplified and a 3 downstream primer, which hybridizes to the complement of the 3 end of the sequence to be amplified.
[0035] The term allele-specific primer as used herein refers to a primer that hybridizes to more than one variant of the target sequence, but is capable of discriminating between the variants of the target sequence in that only with one of the variants, the primer is efficiently extended by the nucleic acid polymerase under suitable conditions. With other variants of the target sequence, the extension is less efficient, inefficient or undetectable.
[0036] As used herein, the term probe refers to an oligonucleotide which hybridizes with a sequence in the target nucleic acid and is usually detectably labeled. The probe can have modifications, such as a 3-terminus modification that makes the probe non-extendable by nucleic acid polymerases, and one or more chromophores. An oligonucleotide with the same sequence may serve as a primer in one assay and a probe in a different assay.
[0037] As used herein, the term target gene, target sequence, target nucleic acid or target DNA refers to a portion of the nucleic acid sequence which is to be either amplified, detected or both.
[0038] The terms patient, subject and individual are used interchangeably herein, and mean a mammalian (e.g., human) subject to be treated and/or to obtain a biological sample therefrom.
[0039] As used herein, the term sample or clinical sample refers to any composition containing or presumed to contain nucleic acid. This includes a sample of tissue or fluid isolated from an individual, for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs and tumors, and also samples of in vitro cultures established from cells taken from an individual, including the formalin-fixed paraffin embedded tissues (FFPET) and nucleic acids isolated therefrom.
[0040] The term quantitative PCR or simply q-PCR as used herein is given the definition of a laboratory technique based on polymerase chain reaction (PCR), which is used to amplify and simultaneously detect or quantify a targeted nucleic acid molecule (e.g., a DNA molecule). In contrast to standard PCR where the reaction product is detected after amplification has ended, the key feature of q-PCR is that the nucleic acid molecule (e.g. DNA molecule or DNA fragment) is being detected during amplification as the reaction progresses in real time, and hence, the alternative name of q-PCR is real-time PCR. An amplified DNA molecule is detected in real time either by intercalation of non-specific fluorescent dyes with any double-stranded DNA, or sequence-specific DNA probes having oligonucleotides that are labelled with a fluorescent reporter (e.g., fluorescein-based dyes such as FAM, HEX, 2-chloro-7phenyl-1,4-dichloro-6-carboxy-fluorescein (VIC), tetrachlorofluorescein (TET), and 6-carboxy-4,5-dichloro-2,7-dimethoxyflyorescein (JOE), and rhodamine-based dyes such as 6-carboxy-X-rhodamine (ROX), tetramethylrhodamine (TAMRA) and sulforhodamine 101 acid chloride (Texas Red)) which permits detection only after hybridization of the probe with its complementary target sequence. It is known that when two DNA probes for detecting different DNA molecules are simultaneously used in a q-PCR assay, the fluorescent reporter labeled on the DNA probes should be different from one another. The fluorescent signals generated during amplification are detected by an appropriate optical detection system and are tracked from the moment the signals pass the background threshold till the reaction reaches plateau. The copy number of the target sequences can be estimated using either relative or absolute quantification strategy, typically by analyzing the shape of the obtained amplification curve (also known as a standard curve), or by determining when the fluorescent signals rises above a cycle threshold value (often called C.sub.t value). In relative quantification strategy, the target nucleic acid levels estimated in a given sample using the C.sub.t or standard curve analysis are expressed as relative to values obtained for the same target in another reference sample, for example, an untreated control sample. Conversely, in absolute quantification strategy, the q-PCR signal is related to input copy number using a standard curve, or can be calculated according to a digital PCR method. These and other q-PCR quantification strategies are well known to those skilled in the art and their calculation can differ depending on a given application and a q-PCR system.
[0041] As used herein, the term C.sub.t or C.sub.t value refers to cycle threshold and signifies the cycle of a q-PCR amplification assay in which fluorescent signal from a reporter or probe that is indicative of amplicon generation first becomes detectable above a background level. In certain embodiments, the C.sub.t is the cycle number at which the q-PCR amplification becomes exponential. In certain embodiments, the greater the quantity of target DNA in the starting material, the faster a significant increase in fluorescent signal will appear, yielding a lower C.sub.t.
[0042] As used herein, the term C.sub.t, delta C.sub.t or dC.sub.t refers to the difference in the numerical cycle number of PCR at which the signal passes the fixed threshold between two different samples or reactions. In certain embodiments, C.sub.t is the difference in numerical cycle number of PCR at which exponential amplification is reached between two different samples or reactions.
[0043] According to the present disclosure, a method of quantifying a mutant allele burden of a target gene in a subject includes:
[0044] providing a first plasmid that includes a mutant allele sequence located at a first region of the target gene, and an internal control sequence derived from the target gene and located at a second region of the target gene, the second region being different from the first region;
[0045] providing a second plasmid that includes a wild-type allele sequence located at the first region of the target gene, and the internal control sequence;
[0046] subjecting genomic DNA of the subject to a first quantitative polymerase chain reaction (q-PCR) using a reaction mixture containing a mutant allele-specific primer pair and a first detectable probe for detecting the mutant allele sequence, and an internal control sequence-specific primer pair and a second detectable probe for detecting the internal control sequence, so as to measure a mutant allele expression level of the target gene;
[0047] subjecting standard diluents of the first plasmid formed from serial dilution with the second plasmid to a second q-PCR using the reaction mixture, so as to create a standard curve of the mutant allele burden of the target gene; and
[0048] correlating the measured mutant allele expression level of the target gene to the standard curve, so as to determine the mutant allele burden of the target gene in the subject.
[0049] In certain embodiments, the mutant allele sequence has a nucleotide length that is substantially identical to that of the wild-type allele sequence, and the first plasmid has a nucleotide length that is substantially identical to that of the second plasmid.
[0050] According to the present disclosure, the reaction mixture for each of the first and second q-PCR may further include a blocking agent that hybridizes to a wild-type allele sequence of the target gene and that inhibits binding of at least one primer of the mutant allele-specific primer pair to the wild-type allele sequence of the target gene.
[0051] The term blocking agent and oligonucleotide blocker are used interchangeably herein, and can be designed to anneal to the same or opposing strand of what the allele-specific primer anneals to and can be modified with a blocking group (e.g., a non-extendable moiety) at its 3 terminal end, 5 terminal end and/or at an internal position near 3 end within the oligonucleotide blocker. Thus, an oligonucleotide blocker can be designed, for example, so as to tightly bind to a wild type allele (e.g., abundant allelic variant) in order to suppress amplification of the wild type allele while amplification is allowed to occur on the same or opposing strand comprising a mutant allele (e.g., rare allelic variant) by extension of the allele-specific primer. That is, the non-extendable moiety may increase the difference in the Tm between matched and mismatched target sequences and/or decrease mismatch priming efficiency, thereby improving assay specificity and/or selectivity.
[0052] In certain embodiments, the blocking agent is an oligonucleotide having a non-extendable moiety at 3-terminus. Examples of the non-extendable moiety include, but are not limited to peptide nucleic acid (PNA), locked nucleic acid (LNA), zip nucleic acid (ZNA), bridged nucleic acid (BNA), threose nucleic acid (TNA), triazole nucleic acid, amino-C7, non-extendable nucleotide, minor groove binder (MGB), and combinations thereof.
[0053] As used herein, the term non-extendable nucleotide refers to a nucleotide that blocks nucleic acid polymerization (e.g., blocks polymerase read-through). In some embodiments, the non-extendable nucleotide is a non-naturally occurring nucleotide or a dideoxynucleotide (e.g., 2,3-dideoxynucleotides (i.e., di-deoxynucleotide triphosphates (ddNTP), which may include ddGTP, ddATP, ddTTP and ddCTP)). In some embodiments, the non-naturally occurring nucleotide is isoC, isoG, deoxyuridine, 3-deoxyadenosine, 3-deoxythymidine, 3-deoxyguanosine, 3-deoxycytidine, inverted dT, 5-methyl-deoxycytidine, 2-fluoro, 8-aza-7-deaza-dA (ppA), 8-aza-7-deaza-dG (ppG), 2-deoxypseudoisocytidine (iso dC), 5-fluoro-2-deoxyuridine (fdU), and/or an otherwise naturally-occurring nucleotide inserted in an inverted orientation.
[0054] In an exemplary embodiment, the blocking agent is an oligonucleotide having di-deoxynucleotide triphosphates (ddNTP) at the 3 terminus thereof.
[0055] According to the present disclosure, the target gene may have one or more single-nucleotide polymorphisms within the gene. In certain embodiments, the target gene is a disease-associated gene, such as cancer-associated genes and genes associated with a hereditary disease.
[0056] Examples of the target gene may include, but are not limited to, JAK2, K-Ras, B-Raf, and EGFR. In an exemplary embodiment, the target gene is JAK2 and the mutant allele sequence is JAK2 V617F.
[0057] The present disclosure will be further described by way of the following examples. However, it should be understood that the following examples are intended solely for the purpose of illustration and should not be construed as limiting the disclosure in practice.
EXAMPLES
General Experimental Materials:
[0058] 1. Primers and probes used in the following examples were synthesized by Integrated DNA Technologies, Inc. (IDT), Iowa, USA.
2. Cell cultures
[0059] Human erythroleukemia (HEL) cell line (ATCC TIB-180) and essential thrombocytopenia (ET)-transformed acute myeloid leukemia (AML) cell line UKE-1 (GM23245) were respectively purchased from American Type Culture Collection (VA, USA) and Coriell Cell Repositories, Coriell Institute for Medical Research (NJ, USA). The cells of the respective type were incubated in a Petri dish containing RPMI-1640 (Gibco) supplemented with 15% FBS and 2 mM L-glutamine, followed by cultivation in an incubator with culture conditions set at 37 C. and 5% CO2. Medium change was performed every 2 days. Cell passage was performed when the cultured cells reached 70% of confluence.
3. Study subjects, blood sample collection and DNA extraction
[0060] The following experiments were approved by the Institutional Review Board of Chang-Gung Memorial Hospital, Chiayi, Taiwan. Patients with myeloproliferative neoplasms (MPN), who were followed and treated at Chang-Gung Memorial Hospital, Chiayi, Taiwan, and adult healthy individuals as controls were enrolled as study population. Each participants of this study provided a written informed consent in accordance with the Declaration of Helsinki for blood sample collection.
[0061] Peripheral venous blood collected from a respective one of the MPN patients and healthy individuals was placed into an EDTA-containing blood collection tube. Peripheral blood granulocytes were harvested using Ficoll-Hypaque density gradient centrifugation and were cryopreserved in RNAlater Stabilization Solution (Cat. No.: AM 7020, Thermo Fisher Scientific). Granulocytic DNA was extracted, and was purified using TRI Reagent (Cat. No.: T9424, Sigma-Aldrich), followed by dilution with diethylpyrocarbonate (DEPC)-treated d2H.sub.2O, so as to prepare a DNA test sample having a final concentration of 100 ng/L for further analysis.
General Experimental Procedures:
[0062] 1. Concerning the experimental methods and relevant techniques for DNA cloning as employed in this disclosure, such as DNA cleavage by restriction enzymes, DNA ligation with T4 DNA ligase, agarose gel electrophoresis, plasmid transformation, etc., reference may be made to the following textbook widely known in the art: Sambrook J. and Russell D. W. (2001), Molecular Cloning: a Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, New York. The aforesaid techniques can be readily performed by those skilled in the art based on their professional knowledge and experience.
2. Statistical analysis:
[0063] The intra- and inter-q-PCR assay variation was obtained by calculating coefficients of variation on allelic burden values using linear regression and/or Pearson's correlation analysis. Each statistical analysis was performed using the Statistical Package for the Social Sciences (SPSS) software version 17.0, purchased from SPSS Inc., Chicago, USA. The level of significance for each statistical analysis was set at 0.05.
Example 1. Construction of Recombinant Plasmids as Standards for Quantifying JAK2 V617F Mutant Allele Burden
[0064] To minimize copy number variation and to standardize JAK2 V617F allele burden quantification, a pair of recombinant plasmids of this disclosure was constructed as follows.
[0065] Since few somatic mutations exist in exon 21 of JAK2 gene, the applicant selected this region as an internal control. Using genomic DNA extracted from HEL cells using TRI Reagent as a template, a control PCR product (264 bp) having a partial DNA sequence of JAK2 exon 21 was obtained from PCR using a forward primer H_JAK2 clon_exon21_F and a reverse primer H_JAK2_clon_exon21_R as shown in Table 1. The resultant control PCR product was purified and then ligated into a cloning vector using yT &A cloning kit (Yeastern Biotech, Taipei, Taiwan) according to the manufacturer's instructions, so as to obtain a plasmid JAK2_Ctrl_yT&A. According to the sequencing analysis conducted by Sanger sequencing (Manufacturer: ABI; Model: 3730), partial JAK2 exon 21 having a nucleotide sequence as shown in SEQ ID NO: 3 was included in the plasmid JAK2_Ctrl_yT&A.
[0066] For detection of JAK2 V617F mutation, exon 14 of JAK2 was selected as a target region. Using a forward primer Sa/I-hJAK2_WT/V617F F and a reverse primer BamHI-hJAK2_WT/V617F R as shown in Table 1, a mutant PCR product (323 bps) having a mutant DNA sequence of JAK2 exon 14 and a wild-type PCR product (323 bps) having a wild-type DNA sequence of JAK2 exon 14 were obtained from PCR respectively using genomic DNA extracted from HEL cells as a mutant DNA template, and DNA extracted from peripheral blood granulocytes of healthy adult individuals as a wild-type DNA template. A respective one of the thus obtained mutant and wild-type PCR products was inserted into the JAK2_Ctrl_yT&A plasmid at the SalI and BamHI sites, so as to generate a corresponding one of a wild-type target recombinant plasmid JAK2_WT_Ctrl_yT&A (3306 bps) and a mutant target recombinant plasmid JAK2_V617_F_Ctrl_yT&A (3306 bps) having JAK2 V617F mutation as shown in
TABLE-US-00001 TABLE1 Targetgene Primer'snucleotidesequence SEQID region Primer (5.fwdarw.3) NO. Exon21of H_JAK2_clon_ cagtataatatggcagagtaaaacaata 1 HumanJAK2 exon21_F (NCBI H_JAK2_clon_ cctttattatctatgaaaacgtctagatga 2 accession exon21_R number: NM_004972.3) Exon14of BamHI-hJAK2_ gatatggatccggaccaaagcacattgtatcctcat 4 HumanJAK2 WT/V617F_F BamHI (NCBI SalI-hJAK2_ atatagtcgacgtcgacctgacacctagctgtga 5 accession WT/V617F_R SalI number: NM_004972.3) Note: The underlined nucleotides each represent the recognition site of a restriction enzyme as indicated below.
Example 2. Validation of the Accuracy of the Recombinant Plasmids of this Disclosure as Standards for Quantifying JAK2 V617F Mutant Allele Burden
Experimental Procedures:
[0067] The wild-type and mutant target recombinant plasmids JAK2_WT_Ctrl_yT&A and JAK2_V617F_Ctrl_yT&A obtained in Example 1, which respectively represents 0% and 100% JAK2 V617F mutant allele burden, were mixed at various proportions as shown in Table 2 below to obtain six recombinant plasmid mixtures that have a respective JAK2 V617F mutant allele burden (i.e., 100%, 50%, 10%, 1%, 0.1% and 0.01%) for serving as standard diluents for JAK2 V617F mutant allele.
TABLE-US-00002 TABLE 2 JAK2 V617 mutant allele burden (%) 100 50 10 1 0.1 0.01 JAK2_WT_Ctrl_yT&A (L) 0 50 90 99 99.9 99.99 JAK2_V617F_Ctrl_yT&A (L) 100 50 10 1 0.1 0.01
[0068] The JAK2 V617F mutation in the aforementioned recombinant plasmid mixtures was detected and determined using two commercially available kits, i.e., RGQ PCR kit (Qiagen, Germany) performed on the RGQ PCR system, and PrimePCR droplet Digital PCR Mutation Detection Assay (ddPCR) kit performed on the QX200 ddPCR system (Bio-Rad, CA, USA), according to the manufacturer's instructions. The thus calculated JAK2 V617F mutant allelle burdens in all of the recombinant plasmid mixtures measured by the Qiagen RGQ PCR kit and the Bio-Rad QX200 ddPCR kit were compared to each other, and then correlated with the expected values using linear regression.
Results:
[0069]
[0070] Taken together, these results indicate the reliability of the wild-type and mutant target recombinant plasmids of this disclosure in generating standard diluents of mutant allele for quantification of JAK2 V617F mutant allele burden.
Example 3. Quantification of JAK2 V617F Mutant Allele Burden in the Recombinant Plasmid Mixtures and in Clinical Samples by Quantitative Duplex PCR Assay
A. Creation of Standard Curves of JAK2 V617F Mutant Allele Burden
1. Plasmid-Based Standard Curves:
[0071] Seven recombinant plasmid mixtures (respectively having JAK2 V617F mutant allele burdens of 100%, 10%, 1%, 0.1%, 0.01%, 0.01% and 0%) were prepared according to the method described in Example 2. Each of these recombinant plasmid mixtures serving as DNA templates was subjected to quantitative duplex PCR assay, which was performed on a Rotor-Gene Q (RGQ) 5plex HRM Platform (Cat No.: 9001580, Qiagen, Germany) using the PCR reaction mixture and the reaction conditions shown in Table 3. The JAK2_exon 14 mutant allele-specific primers and probe, and the JAK2_exon 21-specific primers and probe listed in Table 4 were respectively designed to quantify the amount of JAK2 V617F mutant allele through the cycle threshold value of JAK2 V617F (i.e., C.sub.t.FAM) and the amount of JAK2_exon 21 through the cycle threshold value of JAK2_exon 21 (C.sub.t.HEX). Copy number normalization was performed based on the obtained Ct value with the equation:
C.sub.t=C.sub.t.FAMC.sub.t.HEX
TABLE-US-00003 TABLE 3 Contents Volume (L) DNA template (0.1 g/L) 1 JAK2 _exon 14 H_JAK2_V617_F (150 nM) 0.5 mutant allele- H_JAK2_V617_R (150 nM) 0.5 specific primers H_JAK2_probe_FAM (200 nM) 0.5 and probe JAK2_exon 21- H_JAK2_ref_ex21_F (150 nM) 0.5 specific primers H_JAK2_ref_ex21_R (150 nM) 0.5 and probe H_JAK2_ref_probe_HEX (200 nM) 0.5 GoTaq Probe qPCR Master Mix RA6100 (Promega) 10 DEPC-treated d.sub.2H.sub.2O. 6.0 Operation conditions: Denaturation at 95 C. for 10 min, followed by 40 cycles of the following reactions: denaturation at 95 C. for 15 sec, and primer annealing and extension at 60 C. for 1 min.
TABLE-US-00004 TABLE4 SEQID Primer/Probe Nucleotidesequence(5.fwdarw.3) NO. JAK2_exon14 H_JAK2_V617_F Ttatggacaacagtcaaacaacaattc 8 mutantallele- H_JAK2_V617_R Cttactctcgtctccacaaaa 9 specific H_JAK2_probe_FAM FAM-ttgtacttttttttttccttagtctttc 10 primersand tttgaagcagca-IABkFQ probe JAK2_exon21- H_JAK2_ref_ex21_F ggaatatttaccatatggaagtttacgagact 11 specific H_JAK2_ref_ex21_R caacacggttgcttcatctacagca 12 primersand H_JAK2_ref_probe_ HEX-acggatagatcacataaaacttctgcag 13 probe HEX tacaca-IABkFQ Note: FAM, HEX and IABkFQ respectively represent fluorescein, hexachloro-fluorescein and Iowa Black FQ.
[0072] To increase the specificity of JAK2 V617F detection and accurate quantification of the JAK2 V617F mutant allele burden, a refined quantitative duplex PCR assay (i.e., quantitative competitive allele-specific TaqMan duplex PCR (qCAST-Duplex PCR) assay) was conducted by further adding 0.2 L of an oligonucleotide blocker (SEQ ID No: 14), which is a JAK2 wild-type allele-specific blocker designed with a di-deoxycytidine at its 3 end (3-ddCTP) to inhibit the binding of the JAK2 exon 14 mutant allele-specific primers to the wild-type allele sequence of JAK2, into the q-PCR reaction mixture as shown in Table 3.
[0073] Afterwards, the thus obtained C.sub.t values of the recombinant plasmid mixtures in the presence and absence of the oligonucleotide blocker were respectively used to create the standard curves of the JAK2 V617F mutant allele burden (i.e., plasmid-based standard curves).
2. Cell-Based Standard Curve:
[0074] In comparison with the standard curves created by the recombinant plasmid mixtures in the presence of the oligonucleotide blocker as described above, two cell lines, i.e., HEL cells and UKE-1 cells, were used to create standard curves in quantifying JAK2 V617F mutation (i.e, cell-based standard curves) using either HCK gene or JAK2 gene as the internal control. The designation of cell-gene is used to represent the cellular origin of DNA (i.e., HEL cells or UKE-1 cells) and the internal control gene (i.e., HCK gene or JAK2 gene) of the four cell line-based standard curves thus obtained, i.e., HEL-JAK2, HEL-HCK, UKE-1-JAK2 and UKE-1-HCK.
[0075] To be specific, genomic DNA of HEL and UKE-1 cells was extracted and purified using TRI Reagent (Cat. No.: T9424, Sigma-Aldrich). The purified genomic DNA of the respective cell type was mixed with an appropriate amount of DNA from a healthy adult individual, so as to obtain five DNA standard diluents that have a respective one of JAK2 V617F mutant allele burdens (i.e., 100%, 50%, 10%, 1%, and 0.1%). Each of the standard diluents serving as DNA templates was subjected to the above-mentioned qCAST-Duplex PCR assay using the PCR reaction mixture and the reaction conditions shown in Table 3, in which JAK2 gene served as the internal control. When HCK gene served as the internal control, the JAK2 exon 21-specific primers and probe in Table 3 was replaced with HCK-specific primers and probe shown in Table 5, which were designed to quantify the amount of HCK amplicons C.sub.t.HEX).
TABLE-US-00005 TABLE5 SEQID Gene Primer/Probe Nucleotidesequence(5.fwdarw.3) NO. HCK-specific H_HCK_F tattagcaccatccataggaggctt 15 primersand H_HCK_R gttagggaaagtggagcggaag 16 probe H_HCK_probe_HEX HEX-taacgcgtccaccaaggatgcgaa- 17 IABkFQ
Results:
[0076]
[0077] As shown in
[0078] As shown in
[0079] The above results affirmed the unequivocal accuracy of using the plasmid mixtures to create a standard curve in quantifying JAK2 V617F mutant allele burden. In addition, by adding the oligonucleotide blocker, which impedes the binding of the JAK2 mutant allele-specific primers to the wild-type DNA template to reduce non-specific amplification, the sensitivity of the qCAST-Duplex PCR assay could be greatly improved.
[0080]
B. Quantification of JAK2 V617F Mutant Allele Burden in MPN Patients with Plasmid-Based or Cell-Based Standard Curves
[0081] To assess the accuracy of the standard curves obtained in section A of this example, five MPN patients, which includes four JAK2 V617F-positive patients (i.e., MPN 3, MPN 4, MPN 11 and MPN 15) and one JAK2 V617F-negative patient (i.e., MPN 34), were recruited to conduct a preliminary analysis. The DNA test sample of each MPN patient, which was prepared according to the procedures as described in the preceding section, entitled 3. Study population, blood sample collection and DNA extraction, of the General Experimental Materials, was subjected to the qCAST-Duplex PCR assay as described in section A of this example, which was performed in triplicates. The JAK2 V617F mutant allele burden of the respective patient was determined by correlating the obtained C.sub.t value with one of the plasmid-based standard curve (created in the presence of the oligonucleotide blocker) and the four cell-based standard curves created in section A of this example.
[0082] For the purpose of comparison, the JAK2 V617F mutant allele burdens of the five MPN patients were also determined using the Bio-Rad QX200 ddPCR kit as mentioned in Example 2.
[0083] Moreover, the DNA test samples from further recruited 32 MPN patients (25 having JAK2 mutation) were subjected to the same qCAST-Duplex PCR assay as described above. The JAK2V617F mutant allele burdens of each sample respectively determined based on the plasmid-based standard curve and cell-based standard curves (including HEL-HCK and UKE-1-HCK) were calculated, and were then analyzed using linear regression and Pearson's correlation analysis to determine the relationship therebetween.
Results:
[0084] Table 6 shows the JAK2 V617F mutant allele burdens in the five MPN patients determined by qCAST-Duplex PCR assay using the plasmid-based and cell-based standard curves, and by Bio-Rad QX200 ddPCR kit.
[0085] As shown in Table 6, when the plasmid-based standard curve and qCAST-Duplex PCR were used in quantifying JAK2 V617F mutant allele burden, the thus determined value in the respective sample was similar to that determined using Bio-Rad QX200 ddPCR PCR kit, and was also highly consistent with minimal variations. Furthermore, in the MPN patient deemed to be JAK2 V617F-negative (i.e., M34), the mutant allele burden thus determined was unequivocally below 0.01%, indicating use of qCAST-Duplex PCR assay and the plasmid-based standard curve can achieve a relatively lower detection limit for JAK2 V617F mutant allele burden. In contrast, when the cell-based standard curves were used along with qCAST-Duplex PCR to quantify JAK2 V617F mutant allele burden, overestimated JAK2 V617F mutant allele burdens with significant discrepancy were observed, suggesting that use of HEL or UKE-1 cells as a standard might lead to inconsistent data acquisition, and possibly false-positive results.
TABLE-US-00006 TABLE 6 JAK2 V617F mutant allele burden (%) qCAST-Duplex PCR MPN Plasmid-based Cell-based standard curve Bio-Rad QX200 patients standard curve HEL-HCK UKE-1-HCK HEL-JAK2 UKE-1-JAK2 ddPCR M03 45.324 0.025 171.513 87.172 57.748 21.265 24.151 2.852 50.154 7.47 43.712 0.413 M04 72.781 0.035 516.545 16.224 121.462 37.481 72.906 1.513 89.703 18.733 75.401 0.700 M11 0.085 0.212 0.076 0.232 0.080 0.032 0.002 0.051 0.0471 0.070 M15 92.219 0.041 634.357 4.241 123.569 37.514 111.335 26.401 98.221 12.422 97.122 0.901 M34 0.004 0.135 0.035 0.028 0.001 0.005 0.006 0.011 0.011 0.004 Note: Expression of data as a mean value only (i.e., without the sign) indicates that the standard deviation is less than 0.001.
[0086]
[0087] Taken together, these data indicate both HEL and UKE-1 cells are unreliable sources, being not useful genomic DNA standards for JAK2 V617F allele burden quantification. In contrast, reproducible and affirmative results in quantifying JAK2 V617F mutant allele burden can be obtained by virtue of the qCAST-Duplex PCR assay based on the standard curve created by the recombinant plasmids of this disclosure.
Example 4. Validation of the Accuracy of qCAST-Duplex PCR Assay Based on the Plasmid-Based Standard Curve for Quantification of JAK2 V617F Mutant Allele Burden in MPN Patients
Experimental Procedures:
[0088] To assess the sensitivity (detection limit) of the qCAST-Duplex PCR assay using the plasmid-based standard curve created in section A of Example 3, a random set of DNA mixtures from JAK2-mutated MPN patients were serially diluted with healthy adult individuals' DNA, so as to obtain 8 DNA test samples (i.e., S1, S2, S3, S4, S5, S6, S7 and S8) respectively with low JAK2V617F mutant allele burdens (i.e., 2%, 1%, 0.2%, 0.1%, 0.02%, 0.01%, 0.002%, and 0.001%). Each of the 8 DNA test samples was run in triplicates with the qCAST-Duplex PCR assay, and in duplicates with the Qiagen RGQ PCR kit.
[0089] In addition, 70 MPN patients (including 55 JAK2 V671-positive and 15 JAK2 V671-negative MPN patients) and 30 healthy adult individuals were enrolled for comprehensive analysis. The DNA test samples from those subjects were subjected to four commonly used sensitive assays, including Qiagen RGQ PCR kit, Bio-Rad QX200 ddPCR kit, competitive allele-specific TaqMan (CAST) PCR kit (Applied Biosystems (ABI), MA, USA) and multiplex PCR amplicon sequencing (detailed procedures are described below), and were also subjected to qCAST-Duplex PCR assay using the plasmid-based standard curve as described in section B of Example 3, so as to determine JAK2 V617F mutant allele burdens thereof. The results obtained by qCAST-Duplex PCR assay using the plasmid-based standard curve and those obtained by the commonly used sensitive assays were compared and analysed using linear regression and Pearson's correlation analysis, so as to assess the relationship therebetween.
[0090] For the multiplex PCR amplicon sequencing, exon sequences of 35 target genes (including JAK2) of Genome Reference Consortium Human Build 37 (GRCh37/hg19) were downloaded from University of California Santa Cruz (UCSC) Genome Browser. Each of the primers designed for the target genes contained a respective adaptor, and the expected maximal PCR product size was set at less than 300 bps. A micro-fluid-based method using Access Array system (Fluidigm, Calif., USA) was employed to construct the sequence library for each DNA samples, and paired-end 150 bps cycle high-throughput sequencing was performed using HiSeq 2500 system (Illumina, CA, USA). After data processing, mapping and variant calling were conducted using CLC Genomics Workbench (Qiagen, Germany). Identification of JAK2 V617F mutation was based on the criteria of more than 50 coverages and an allelic frequency of more than 1%.
Results:
[0091]
[0092] Table 7 shows the JAK2 V617F mutant allele burdens in the MPN patients and healthy adult individuals determined by the qCAST-Duplex PCR of this disclosure and the four commonly used sensitive assays.
[0093]
TABLE-US-00007 TABLE 7 Test subjects (total number), test result (number of test Multiplex subjects), or JAK2V617F qCAST- Bio-Rad Qiagen ABI PCR allele burden (%) Duplex QX200 RGQ CAST amplicon (number of test subjects) PCR ddPCR PCR PCR sequencing MPN patients 70 70 69 70 58 JAK2V617F (+) 55 (55/55) (49/55) (50/55) (32/36) .sup.>50% 23 (23/23) (22/22) (23/23) (17/18) 10-50% 20 (20/20) (20/20) (19/20) (13/13) 1-10% 4 (4/4) (4/4) (5/4) (1/1) 0.1-1% 1 (2/1) (1/2) (2/1) (0/1) 0.01-0.1% 7 (6/7) (2/7) (1/7) (0/3) JAK2V617F() 15 (15/15) (21/15) (20/15) (26/22) Healthy adults 30 8 4 25 n.d. >0.1% 0 0 0 0 n.d. >0.01% 0 0 0 0 n.d. None 30 4 4 25 n.d. Note: 1) The number in the parentheses denotes detected case number/expected case number. With limited availability in some of the assays, the number of DNA samples analyzed differs between the assays. 2) n.d. indicates no detection.
[0094] As shown in Table 7 and
[0095] In conclusion, by employing the qCAST-Duplex PCR assay and use of the recombinant plasmids as standards, the method of this disclosure can yield reproducible and affirmative results for the quantification of JAK2 V617F mutant allele burden, thereby improving the accuracy in molecular diagnostics of MPN.
[0096] All patents and references cited in this specification are incorporated herein in their entirety as reference. Where there is conflict, the descriptions in this case, including the definitions, shall prevail.
[0097] While the disclosure has been described in connection with what are considered the exemplary embodiments, it is understood that this disclosure is not limited to the disclosed embodiments but is intended to cover various arrangements included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements.