Foliage blocking agent for precise regulation of expression of cadmium absorption and transportation-related gene in rice and application thereof

10420291 ยท 2019-09-24

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to the field of environmental protection, and in particular to a leaf surface barrier for accurately controlling cadmium absorption and transport related gene expression in rice, and an application thereof. The present invention comprises: reducing a raw material, i.e., selenious acid or selenite, by using ascorbic acid to generate a nanogel, and then emulsifying the nanogel for peptization to obtain a leaf surface barrier for accurately controlling cadmium absorption and transport related gene expression in rice; and then mixing the leaf surface barrier with a silica sol to obtain a composite selenium and silica sol leaf surface barrier. The present invention also provides a leaf surface barricading method for accurately controlling cadmium absorption and transport related gene expression in rice. By applying the leaf surface barrier, the silica sol or the composite selenium and silica sol leaf surface barrier having a particular atomization degree and a particular concentration by means of foliar spray during a particular growth period of rice and within a particular time, the cadmium accumulation in rice can be effectively reduced. Applying the present invention to a moderately or lightly polluted field can enable cadmium content in rice to satisfy the food hygiene standards, and therefore is significant for achieving the safe use of the large area of field polluted by heavy metal cadmium in China.

Claims

1. A selenium composite silica sol foliage blocking agent for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice, comprising a foliage blocking agent and an acidic silica sol; wherein the foliage blocking agent is prepared by the method comprising the steps of: (1) preparing a nano-sized selenium gel comprising adding an ascorbic acid solution into a selenium-containing solution in a water bath at 25-50 C., for 2-5 h, and separating and purifying products, so as to obtain a nano-sized selenium gel; and (2) dispersing the nano-sized selenium gel comprising adding an emulsifying agent is added to the nano-sized selenium gel prepared in step (1) under stirring, and adjusting the pH to 4.5-6.5, wherein the selenium composite silica sol foliage blocking agent for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice is obtained.

2. The selenium composite silica sol foliage blocking agent of claim 1, wherein the selenium-containing solution in step (1) comprises at least one of seleninic acid, sodium selenite and potassium selenite.

3. The selenium composite silica sol foliage blocking agent of claim 1, wherein a molar ratio between the ascorbic acid and selenium in step (1) is (1:1)-(1:3).

4. The selenium composite silica sol foliage blocking agent of claim 1, wherein a final emulsifying agent content in step (2) is 0.055% by mass; and the foliage blocking agent in step (2) has a selenium content of 0.152% by mass.

5. The selenium composite silica sol foliage blocking agent of claim 1, wherein the selenium composite silica sol foliage blocking agent has a silica content of 310% by mass; and a mass ratio between selenium and the silica in the selenium composite silica sol foliage blocking agent is (1:10)-(1:55).

6. The selenium composite silica sol foliage blocking agent of claim 1, wherein the acidic silica sol has a pH of 4.5-6.5, a silica content of 15%-20% by mass; and the method for preparing the acidic silica sol, comprises the steps of: adding a metallic silicon powder or a metal silicate to an alkaline solution in a water bath at 40-60 C., at a stirring speed of 0.55 m/s, so as to obtain an alkaline silicon-containing solution; passing the alkaline silicon-containing solution through a hydrogen-type weak acid cation exchange resin column at a speed of 110 mL/min, and controlling the pH value of the collection liquid at the column outlet to 4.56.5, so as to obtain an active acidic silica sol precursor; and heating the active acidic silica sol precursor to 4060 C. in a microwaver or water bath, maintaining temperature and stirring for 1030 min, then cooling for 3060 min, so as to prepare the acidic silica sol.

7. A foliage blocking method for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice, comprising the steps of: diluting the selenium composite silica sol foliage blocking agent of claim 6 to obtain diluted selenium composite silica sol foliage blocking agent, atomizing diluted selenium composite silica sol foliage blocking agent, and spraying the diluted selenium composite silica sol foliage blocking agent once on the rice leaf blades during the period from the rice tillering stage to the jointing stage, or from the heading to the filling stage, or once for each period, wherein the spraying is carried out in a sunny day or at 4-6 p.m. on a cloudy day; wherein silica content in the diluted selenium composite silica sol foliage blocking agent is controlled at 0.1%0.1% by mass; wherein a spraying dosage during the period from the tillering stage to the jointing stage is 80120 liters of the diluted selenium composite silica sol foliage blocking agent per mu; wherein a spraying dosage during the period from the heading stage to the filling stage is 100150 liters of the diluted selenium composite silica sol foliage blocking agent per mu; and wherein the silica sol is an acidic silica sol.

Description

DESCRIPTION OF FIGURES

(1) FIG. 1 is a transmission electron microscopic image of an acidic silica sol.

(2) FIG. 2 is a diagram showing the particle size distribution of the foliage blocking agent (selenium sol).

(3) FIG. 3 is a transmission electron microscopic image of the foliage blocking agent (selenium sol).

(4) FIG. 4 is a transmission electron microscopic image of the selenium composite silica sol foliage blocking agent.

(5) FIG. 5 is a diagram showing the particle size distribution of the selenium composite silica sol foliage blocking agent.

PARTICULAR EMBODIMENTS

(6) The present invention will be further described in details below in combination with the examples and accompanying drawings, but the embodiments of the present invention are not limited thereto.

(7) Method for culturing the suspension cell of rice (Oryza sativa L. Japonica) comprises the steps of: the matured and plump seeds of Oryza sativa L. Japonica were selected, and sterilized with 70% by volume of alcohol or 30% by mass of sodium hypochlorite; uniformly spread the seeds on the plates containing a solid culture medium with forceps, cultured in an incubator, in dark, at a culture temperature of 25 C., for a period of time, then taken out the hypocotyls with forceps, cultured on another solid culture medium, so as to obtain callus tissues. 10 g of the callus tissues were broken, added to the conical flasks containing a liquid culture medium (50 mL), cultured in a shaker at a temperature of 28 C., for about 1 month, so as to obtain the suspension cells of the rice.

Example 1. Preparation of Acidic Silica Sol

(8) (1). 200 mL water was metered, and added 0.8 g of sodium hydroxide, so as to formulate 0.1 M sodium hydroxide solution; actuated a stirrer up to a speed of 0.5 m/s, and heated to 40 C., then slowly added 116 g Na.sub.2SiO.sub.3, fully dissolved, then cooled to the room temperature, so as to formulate an alkaline silicon solution with a pH of 10; passed the alkaline silicon solution through 100 mL (wet volume) hydrogen-type weak acid cation resin exchange column at an uniform speed of 1 mL/min, and controlled the pH value of the collection liquid at the column outlet to 4.5, so as to obtain an active acidic silica sol precursor; stirred the active acidic silica sol precursor in a water bath and heated to 40 C., maintained the temperature and stirred for 30 minutes, stood, cooled and aged for 60 min, so as to obtain an acidic silica sol, for use; the acidic silica sol having a pH of 4.5, and a silica content of 18% by mass;

(9) (2) 200 mL water was metered, added 56 g potassium hydroxide, so as to formulate 5 M potassium hydroxide solution; actuated a stirrer up to a speed of 5 m/s, and heated to 60 C., then slowly added 110 g Li.sub.2SiO.sub.3, fully dissolved, then cooled to the room temperature, so as to prepare an alkaline silica solution with a pH of 12.5; passed the alkaline silica solution through 100 mL (wet volume) hydrogen-type weak acid cation resin exchange column at an uniform speed of 10 mL/min, and controlled the pH of the collection liquid at the column outlet to 6.5, so as to obtain an active acidic silica sol precursor; stirred the active acidic silica sol precursor in a water bath and heated to 60 C., maintained the temperature and stirred for 10 min, stood, cooled and aged for 30 min, so as to obtain an acidic silica sol, for use; the acidic silica sol having a pH of 6.5, and a silica content of 20% by mass;

(10) (3) 200 mL water was metered, added 7 g aqueous ammonia, so as to formulate 1M ammonium hydroxide solution; actuated a stirrer up to a speed of 2 m/s and heated to 45 C., then slowly added 90 g Na.sub.2SiO.sub.3, fully dissolved, then cooled to the room temperature, so as to prepare an alkaline silica solution with a pH of 11; passed the alkaline silica solution through 100 mL (wet volume) hydrogen-type weak acid cation resin exchange column at an uniform speed of 5 mL/min, controlled the pH value of the collection liquid at the column outlet to 5.5, so as to obtain an active acidic silica sol precursor; stirred the active acidic silica sol precursor in a water bath and heated to 45 C., maintained the temperature and stirred for 20 min, stood, cooled and aged for 45 min, so as to obtain an acidic silica sol, for use; the acidic silica sol having a pH of 5.5, and a silica content of 15% by mass, with a TEM image shown in FIG. 1.

Example 2. Preparation of Selenium Sol Foliage Blocking Agent

(11) (1) a selenious acid solution was formulated, and controlled the selenium content at 0.1% by mass;

(12) (2) 0.5% by mass of the ascorbic acid solution was added into the selenious acid solution prepared in step (1) in a water bath at 25 C., controlled the molar ratio between ascorbic acid and selenium to 1:1, and reacted for 2 h; then centrifuged in a centrifuge at 10000 g, for 10 min; followed by washing the precipitates three times with ultra-pure water, so as to obtain a nano-sized selenium gel;

(13) (3) the emulsifying agent, polyvinylpyrrolidone, was added to the nano-sized selenium gel prepared in step (2), under stirring, wherein the final emulsifying agent content was 0.05% by mass, and adjusted the pH to 4.5, so as to obtain a foliage blocking agent (selenium sol foliage blocking agent) for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice, wherein the selenium sol foliage blocking agent had a selenium content of 0.15% by mass.

Example 3. Preparation of Selenium Sol Foliage Blocking Agent

(14) (1) a sodium selenite solution was prepared, and controlled the selenium content at 5% by mass;

(15) (2) 10% by mass of the ascorbic acid solution was added to the sodium selenite solution prepared in step (1) in a water bath at 50 C., controlled the molar ratio between ascorbic acid and selenium to 1:3, and reacted for 5 h; then centrifuged in a centrifuge at 4000 g for 40 min, followed by washing the precipitates 3 times with ultra-pure water, so as to obtain a nano-sized selenium gel;

(16) (3) an emulsifying agent, Span-80, was added to the nano-sized selenium gel prepared in step (2), under stirring, wherein the final emulsifying agent content was 5% by mass, and adjusted the pH to 6.5, so as to obtain a foliage blocking agent (selenium sol foliage blocking agent) for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice, wherein the selenium sol foliage blocking agent had a selenium content of 2% by mass.

Example 4. Preparation of Selenium Sol Foliage Blocking Agent

(17) (1) a potassium selenite solution was formulated, and controlled the selenium content at 1.5% by mass;

(18) (2) 2.5% by mass of the ascorbic acid solution was added to the potassium selenite solution prepared in step (1) in a water bath at 50 C., controlled the molar ratio between ascorbic acid and selenium to 1:1.5, and reacted for 3 h; then centrifuged in a centrifuge at 5000 g for 30 min, followed by washing the precipitates 3 times with ultra-pure water, so as to obtain a nano-sized selenium gel;

(19) (3) an emulsifying agent, Tween-80, was added to the nano-sized selenium gel prepared in step (2), under stirring, wherein the final emulsifying agent content was 1.5% by mass, and adjusted the pH to 5.5, so as to obtain a foliage blocking agent (selenium sol foliage blocking agent) for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice, wherein the selenium sol foliage blocking agent had a selenium content of 1.5% by mass.

(20) (4) the selenium sol foliage blocking agent samples prepared in step (3) were carried out a particle size distribution analysis, the results showed that the average particle diameter was 17.351.4 nm, as shown FIG. 2; the prepared selenium sol foliage blocking agent samples were carried out a morphology analysis by TEM, the nano-sized selenium formed in the reaction system was a spherical particle, and uniformly dispersed, having an average particle diameter of about 15 nm, as shown in FIG. 3.

Example 5. Preparation of Selenium Composite Silica Sol Foliage Blocking Agent

(21) The selenium sol foliage blocking agent prepared in example 4 was mixed with the acidic silica sol, having a pH of 5.5, and silica content of 15% by mass, the acidic silica sol, having a pH of 4.5, and silica content of 18% by mass, and the acidic silica sol, having a pH of 6.5, and silica content of 20% by mass, prepared in example 1, respectively, wherein the volume ratio between the selenium sol foliage blocking agent and the silica sol was 1:1, 1:2 and 1:4 respectively, stirred for 30 min, so as to obtain a selenium composite silica sol foliage blocking agent for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice; the silica content in the prepared selenium composite silica sol foliage blocking agent was 7.5%, 6% and 4% by mass respectively, and the mass ratio between the selenium and silica were 1:10, 1:24 and 1:53 respectively. The prepared selenium composite silica sol foliage blocking agent samples having a silica content of 7.5% by mass were carried out a morphology analysis by TEM, as shown in FIG. 4, the nano-sized selenium formed in the reaction system was loaded on the surface of the nano-sized silica sphere, having a particle size of 4555 nm (FIG. 5).

Example 6. Precise Regulation of the Acidic Silica Sol on the Expression of the Cadmium Transport Gene in Rice Suspension Cell and Inhibition of the Same on the Cadmium Absorption

(22) The silica sol prepared in example 1 having a pH of 5.5 and a silica content of 15% by mass, was diluted to a silica content of 0.5% by mass, and used to treat the rice cells (Oryza sativa L. Japonica) for 24 h, then added various concentrations of cadmium, and continued to culture for 24 h, then extracted the RNA of the rice suspension cells, and carried out qRT-PCR analysis (the corresponding primers shown in table 14). The results showed that as compared with the blank control (CK, without addition of silica sol), at the same cadmium concentration, after treating with the silica sol, the expression levels of the genes OsLsi1, OsNramp5 and OsLCT1 in the rice cells were significantly reduced (table 1, table 2, table 3), and the expression level of the gene OsHMA3 was significantly increased (table 4). The proteins expressed by the genes OsLsi1 and OsNramp5 may be associated with the absorption of cadmium, the proteins expressed by the gene OsLsi1 may be associated with the transportation of cadmium from the phloem to the grains, the down-regulations of the expression of the three genes facilitated the reduction of the absorption of cadmium in rice and the reduction of the transportation of cadmium into the grains; and the protein expressed by gene OsHMA3 may have the functionality which was associated with the transportation of cadmium into the vacuoles, so as to reduce the transportation of the same into the xylem, and in turn reduce the transportation of cadmium from the roots to the above-ground part. After the silica sol was used to precisely regulate the above genes, the cadmium accumulation levels in the rice cells were significantly reduced, as compared with the controls, after treating with silica sols at 10, 20, 40 M Cd, the cadmium concentrations in the rice cells were reduced by 72.8%, 75.5% and 81.3% respectively (table 5).

(23) TABLE-US-00001 TABLE 1 The effects of the silica sol treatment on the expression levels of the transport gene OsLsi1 in the rice suspension cells Average reduction as Silica sol compared with the control Blank (CK) treatment (%) 0 4.13 0.81 3.66 0.75 11.4 Cd (10 M) 15.62 1.32 13.25 0.92 15.2 Cd (20 M) 19.85 1.25 16.43 0.75 17.2 Cd (40 M) 22.78 0.97 17.65 0.84 22.5

(24) TABLE-US-00002 TABLE 2 The effects of the silica sol treatment on the expression levels of the cadmium transport gene OsNramp5 in the rice suspension cells Average reduction as Silica sol compared with the control Blank (CK) treatment (%) 0 2.8 0.25 1.9 0.36 32.1 Cd (10 M) 4.2 0.32 3.5 0.29 16.7 Cd (20 M) 5.6 0.28 4.1 0.35 26.8 Cd (40 M) 6.8 0.45 4.6 0.42 32.4

(25) TABLE-US-00003 TABLE 3 The effects of the silica sol treatment on the expression levels of the cadmium transport gene OsLCT1 in rice suspension cells. Average reduction as compared with the Blank (CK) Silica sol treatment control (%) 0 1.85 0.09 1.43 0.06 22.7 Cd (10 M) 1.52 0.04 0.71 0.07 53.3 Cd (20 M) 1.44 0.04 0.58 0.05 59.7 Cd (40 M) 1.32 0.06 0.67 0.08 49.2

(26) TABLE-US-00004 TABLE 4 The effects of the silica sol treatment on the expression levels of the cadmium transport gene OsHMA3 in rice suspension cells Average increase as Silica sol compared with the control Blank (CK) treatment (%) 0 2.25 0.15 3.11 0.32 38.2 Cd (10 M) 1.84 0.18 3.07 0.21 66.8 Cd (20 M) 2.66 0.21 3.26 0.3 22.6 Cd (40 M) 3.05 0.26 3.64 0.31 19.3

(27) TABLE-US-00005 TABLE 5 The effects of the silica sol treatment on the cadmium contents in the rice cells (g kg.sup.1) Average reduction as Silica compared with the control Blank (CK) sol treatment (%) Cd (10 M) 9.2 0.8 2.5 0.6 72.8 Cd (20 M) 18.4 1.1 4.5 0.7 75.5 Cd (40 M) 36.4 6.8 6.8 0.9 81.3

Example 7. Precise Regulation of the Selenium Sol Foliage Blocking Agent on the Expression of the Cadmium Transport Gene in the Rice Suspension Cells and Inhibition of the Same on the Cadmium Absorption

(28) The selenium sol foliage blocking agents prepared in example 4 were diluted to various concentrations respectively (0.01%, 0.05%, 0.1%), and cultured the rice suspension cells (Oryza sativa L. Japonica) for 24 h, then added various concentrations of cadmium (10 M, 20 M and 40 M), and cultured for 24 h, extracted the RNA from the rice cells, and carried out reverse transcription, then detected the expression levels of the genes OsNramp5 and OsHMA3 (the corresponding primers shown in table 14). The results showed that (table 6, table 7), as compared with the blank (CK, without addition of selenium sol foliage blocking agent), the expression levels of the gene OsHMA3 in the rice suspension cells were up-regulated in duplications, and the expression levels of the gene OsNramp5 in the rice suspension cells were significantly suppressed; at high cadmium concentration (40 M), after treating with 0.05% selenium sol foliage blocking agent, the suppression effects on the expression of the gene OsNramp5 were optimal. The protein expressed by the gene OsNramp5 may be associated with the absorption of cadmium, and the protein expressed by the gene OsHMA3 may have the functionality which may be associated with the transportation of cadmium into the vacuoles, so as to reduce the transportation of the same into the xylem, and in turn reduce the transportation of cadmium from the roots to the above-ground part. After the selenium sol foliage blocking agent was used to precisely regulate the above genes, the cadmium accumulation levels in the rice cells were significantly reduced, and as compared with the control, at 10, 20, 40 M Cd, after treating with 0.05% selenium sol foliage blocking agent, the cadmium concentrations in the rice cells were reduced by 47.1%, 55.3% and 61.7% respectively (table 8).

(29) TABLE-US-00006 TABLE 6 The effects of the selenium sol foliage blocking agent on the expression levels of the cadmium transport protein OsNramp5 in the rice suspension cells. Blank Selenium Selenium Selenium (CK) (0.01%) (0.05%) (0.1%) 0 2.11 0.15 1.82 0.04 1.97 0.08 1.76 0.09 Cd (10 M) 4.23 0.28 1.96 0.09 1.34 0.06 0.84 0.04 Cd (20 M) 6.72 0.05 1.55 0.08 0.92 0.07 0.63 0.04 Cd (40 M) 7.96 0.08 1.34 0.05 0.85 0.08 1.55 0.06

(30) TABLE-US-00007 TABLE 7 The effects of the selenium sol foliage blocking agent on the expression levels of the cadmium transport protein OsHMA3 in the rice suspension cells Selenium Selenium Selenium Blank (CK) (0.01%) (0.05%) (0.1%) 0 1.21 0.15 1.56 0.18 1.85 0.18 2.54 0.21 Cd (10 M) 1.86 0.32 2.25 0.28 3.14 0.29 3.81 0.26 Cd (20 M) 2.26 0.25 2.81 0.28 3.62 0.28 4.97 0.28 Cd (40 M) 2.45 0.31 3.26 0.31 3.87 0.24 4.52 0.24

(31) TABLE-US-00008 TABLE 8 The effects of 0.05% selenium sol foliage blocking agent treatment on the cadmium contents in the rice cells (g kg.sup.1). Average reduction as Selenium compared with the control Blank (CK) (0.05%) (%) Cd (10 M) 8.7 0.5 4.6 0.4 47.1 Cd (20 M) 15.2 0.9 6.8 0.7 55.3 Cd (40 M) 29.8 3.2 11.4 1.2 61.7

Example 8. Precise Regulation of the Selenium Sol Foliage Blocking Agent, Silica Sol, and Selenium Composite Silica Sol Foliage Blocking Agent on the Expression of the Cadmium Transport Gene in Rice and Inhibition of the Same on the Cadmium Absorption Under Pot Culture Conditions

(32) The rice (a variety of YouYou 128) was cultured in Kimura culture medium for 3 weeks, then transferred into a culture solution containing 5 M Cd, and carried out the following treatments: (1) treatments with control (CK): 200 mL deionized water was sprayed on each pot; (2) treatments by spraying the silica sol foliage blocking agent on the leaf blades: 200 mL the diluted silica sol (the silica sol prepared in example 1, having a pH of 5.5 and a silica content of 15% by mass, then diluted to a silica content of 0.5% by mass) was sprayed on each pot; (3) treatments by spraying the selenium sol foliage blocking agent on the leaf blades: 200 mL the diluted selenium sol foliage blocking agent (prepared in example, then diluted to a selenium content of 0.05%) was sprayed on each pot; (4) treatments by spraying the selenium composite silica sol foliage blocking agent on the leaf blades: 200 mL the selenium composite silica sol foliage blocking agent was sprayed on each pot (prepared in example 5, then diluted to a silica content of 0.5% and a selenium content of 0.05%). After one week, the samples were collected, and tested the relative expression levels of the genes OsLsi1 and OsLsi2 in the roots (corresponding primers shown in table 14), and tested the cadmium contents in the stems and leaves. The results showed that all of the three sol foliage blocking agents can precisely inhibit the relative expression levels of the genes OsLsi1 and OsLsi2 (table 9), so as to reduce the cadmium contents in the rice stems and leaves. As compared with the control, after the treatments by spraying the silica sol, selenium sol and selenium composite silica sol on leaf blades, the cadmium accumulation levels in the above-ground part of rice were reduced by 63.8%, 51.6%, 66.1% respectively; and the selenium composite silica sol had the optimal effects in inhibiting the cadmium accumulation in the above-ground part of rice (table 10).

(33) TABLE-US-00009 TABLE 9 The effects of various foliage blocking materials on the relative expression levels of the genes OsLsi1 and OsLsi2 in the rice roots OsLsi1 OsLsi2 Control (CK) Relative expression level 1 0.0282 1 0.1263 Silica sol Relative expression level 0.485 0.118 0.629 0.125 Reduction as compared with control (%) 51.45 37.07 Selenium sol Relative expression level 0.486 0.103 0.326 0.030 Reduction as compared with control (%) 51.39 67.4 Selenium composite silica sol Relative expression level 0.451 0.078 0.314 0.078 Reduction as compared with control (%) 54.86 68.53

(34) TABLE-US-00010 TABLE 10 The effects of various foliage blocking materials on the cadmium accumulation levels in the rice stems and leaves Reduction as Cadmium level compared with control (mg/kg) (%) CK 3.45 0.47 Silica sol 1.25 0.11 63.8 Selenium sol 1.67 0.27 51.6 Selenium composite silica sol 1.17 0.09 66.1

Example 9. The Effects of the Selenium Sol Foliage Blocking Agent, Silica Sol and Selenium Composite Silica Sol Foliage Blocking Agents on the Reduction of the Cadmium Accumulation in the Rice Grains in the Field Conditions

(35) The test time was from April to November, 2014, the test site was located in a Cd contaminated rice field in Hongxing village, Dongtang town, Renhua county, Shaoguan city, Guangdong province, China. The surface soils were collected from this plot (030 cm) for analysis. The soils had a pH of about 5.86, a Cd content of about 1.85 mg kg.sup.1, and an As content of 18.20 mg kg.sup.1. This plot was a typical cadmium contaminated rice field resulting from mining. The rices to be tested were the early mature variety of WuYou 613 in 2014, and the late mature variety of WuFengYou 615.

(36) Four treatments were set for the tests as follows: (1) a blank control, (CK), i.e., spraying an equal amount of clean water; (2) spraying the silica sol foliage blocking agent (prepared in example 1, having a pH of 5.5 and a silica content of 15% by mass) on the leaf blades; (3) spraying the selenium sol foliage blocking agent (prepared in example 4) on the leaf blades; (4) spraying the selenium composite silica sol foliage blocking agent (prepared in example 5) on the leaf blades. Each treatment was repeated 3 times, arranged in random, tested 12 plots in total, wherein each plot had an area of 5*64=30 m.sup.2, and was ensured to be separately irrigated and drained.

(37) Spraying Technology:

(38) In the early mature rices, the blocking agents were sprayed twice for each of the treatments, once during the period from the tillering stage to the jointing stage, the other once during the period from the heading stage to the filling stage. During the period from the tillering stage to the jointing stage, the sprayed silica sol had a silica content of 0.1%, the selenium sol had a selenium content of 0.01%, and the selenium composite silica sol had a silica content of 0.1% (prepared in example 5, having a silica content of 7.5% by mass, a mass ratio between silica and selenium of 10:1), and during the period from heading stage to the filling stage, the sprayed silica sol had a silica content of 0.5%, and the selenium sol had a selenium content of 0.05%, the selenium composite silica sol had a silica content of 0.5% (prepared in example 5, having a silica content of 7.5% by mass, and a mass ratio between silica and selenium of 10:1). During the period from the tillering stage to the jointing stage, the spraying dosage for each of the blocking agents was 100 liters/mu, the spraying was carried out at 4:00 p.m. in a sunny day; during the period from the heading stage to the filling stage, the spraying dosage of each of the blocking agents was 150 liters/mu, the spraying was carried out at 6:00 p.m. in a cloudy day. During spraying, the atomized droplets were controlled to have a particle size of less than 1000 microns, and uniformly sprayed on both the front and back surfaces of the rice blade.

(39) In the late mature rice, the blocking agent was sprayed once for each of the treatments. The spraying was carried out during the period from the tillering stage to the jointing stage, and the sprayed silica sol had a silica content of 1%, the selenium sol had a selenium content of 0.1%, and the selenium composite silica sol had a silica content of 1% (prepared in example 5, having a silica content of 7.5% by mass, and a mass ratio between silica and selenium of 10:1); the spraying dosage for each of the blocking materials was 120 liters/mu, the spraying was carried out at 5:00 p.m. in a sunny day. During spraying, the atomized droplets were controlled to have a particle size of less than 1000 microns, and uniformly sprayed on both front and back surfaces of the rice blade.

(40) As shown in tables 11-12, after the treatments by various of foliage blocking agents, both the early and late mature rices in 2014 had an increased yield; wherein the early mature rice had much more increase level than that of the late mature rice, and after the treatment with the selenium composite silica sol, both the early and late mature rices had a significant increase level in rice yield, which was increased by 7.32% and 4.85% respectively as compared with the control.

(41) TABLE-US-00011 TABLE 11 The statistical results for the yields of the early mature rice in 2014 Plot yield (wet Plot average Dry field Yield yield, kilogram) yield per mu increase I II III (kilogram) (kilogram) (%) control 37 37.25 38.5 37.58a 647.2 Silica sol 38 39.25 40.25 39.17ab 674.6 4.23 Selenium sol 38 40.2 39.5 39.23ab 675.7 4.41 Selenium 40 41 40 40.33b 694.6 7.32 composite silica sol

(42) TABLE-US-00012 TABLE 12 The statistical results for the yields of the late mature rice in 2014 Plot yield (wet Plot average Dry yield Yield yield, kilogram) yield per mu increase I II III (kilogram) (kilogram) (%) Control 33.5 34.5 33.5 33.83a 585.5 Silica sol 32.5 37.5 34 34.6a 598.8 2.27 Selenium sol 33.7 34.7 35.1 34.5a 597.1 1.98 Selenium 34 38 34.25 35.43b 613.9 4.85 composite silica sol

(43) As shown in table 13, the treatments by spraying the foliage blocking agent can significantly reduce the cadmium content in rice. As compared with the control, after spraying the silica sol, selenium sol, and selenium composite silica sol foliage blocking agents, the cadmium contents in the early mature rices in 2014 were reduced by 64.3, 49.0 and 85.9% respectively, and the cadmium contents in the late mature rices were reduced by 34.2%, 28.8% and 46.4% respectively. Spraying the selenium composite silica sol foliage blocking agent had significantly better effects on the reduction of the cadmium content in rice over the silica sol and selenium sol foliage blocking agents; and spraying the foliage blocking agent twice during the rice growth phase had significantly better effects on reduction of the cadmium content in rice over solely spraying the same once. In the early mature rice in 2014, after spraying the selenium composite silica sol foliage blocking agent once for each of the periods from the tillering stage to the jointing stage, and from the heading stage to the filling stage, the cadmium content in rice can be reduced from 1.51 mg/kg in the control to 0.162 mg/kg, which had reached the Food Sanitation Standards. Therefore, the foliage blocking technology for precise regulation of the expression of the cadmium absorption and transportation-related gene in rice can achieve the safety of the rice production in the low-to-mediate contaminated rice field.

(44) TABLE-US-00013 TABLE 13 The effects of various foliage blocking materials on the cadmium accumulation levels in rice cadmium content in Cadmium content in early mature rice late mature rice Reduction as Reduction as Cadmium compared Cadmium compared content with control content with control (mg/kg) (%) (mg/kg) (%) Control 1.151 0.074 0.0 1.283 0.098 0.0 Silica sol 0.411 0.006 64.3 0.844 0.074 34.2 Selenium 0.587 0.014 49.0 0.914 0.076 28.8 sol Selenium 0.162 0.049 85.9 0.688 0.048 46.4 composite silica sol

(45) TABLE-US-00014 TABLE14 Theprimersforidentificationofthecadmium,siliconand arsenictransportation-relatedgenesinrice Genename Forwardprimer Reverseprimer OsNramp5 TGAGCTGCTCTGGGTGATTC TGCCAGCAGCCATAGGAAAA OsLCT1 TGGCGATCTTTGGAGGCTTT CGCCGAGGTCGATAAGAACA OsHMA3 AGAACAGCAGGTCGAAGACG ATTGCTCAAGGCCATCTGCT OSLsi1 CGGTGGATGTGATCGGAACCA CGTCGAACTTGTTGCTCGCCA OSLsi2 ATCTGGGACTTCATGGCCC ACGTTTGATGCGAGGTTGG

(46) The above examples are the preferred embodiments in the present invention, but the embodiments of the present invention are not limited thereto. Any other changes, modifications, alternatives, combinations, simplifications, made without departing from the spirit and principles of the present invention, should be the equivalent replacement mode, and included in the scope of protection of the present invention.