PROCESS FOR THE PRODUCTION OF METHYL METHACRYLATE

20190284587 ยท 2019-09-19

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a process for the production of methyl methacrylate. The process of the present invention comprises the steps of: a) providing a microorganism in a fermentation medium, under conditions which said microorganism will produce a C.sub.3-C.sub.12 methacrylate ester; b) providing an organic phase in contact with the fermentation medium, said organic phase including C.sub.3-C.sub.12 methacrylate ester in a higher concentration than that in the fermentation medium; c) removing organic phase containing the said C.sub.3-C.sub.12 methacrylate ester from contact with the fermentation medium; and d) transesterifying the removed C.sub.3-C.sub.12 methacrylate ester with methanol, optionally after separation from the organic phase, to produce methyl methacrylate.

    Claims

    1. A process for the production of methyl methacrylate (MMA), the process comprising the steps of: a) providing a microorganism in a fermentation medium, under conditions which said microorganism will produce a C.sub.3-C.sub.12 methacrylate ester; b) providing an organic phase in contact with the fermentation medium, said organic phase including C.sub.3-C.sub.12 methacrylate ester in a higher concentration than that in the fermentation medium; c) removing organic phase containing the said C.sub.3-C.sub.12 methacrylate ester from contact with the fermentation medium; and d) transesterifying the removed C.sub.3-C.sub.12 methacrylate with methanol, optionally after separation from the organic phase, to produce methyl methacrylate.

    2. The process according to claim 1 wherein the methacrylate ester is selected from a C.sub.3-C.sub.12 alkyl, hydroxyalkyl, alkenyl, alkylaryl or alkenylaryl methacrylate ester.

    3. The process according to claim 1, wherein the methacrylate ester is selected from n-propyl, isopropyl, isobutyl, n-butyl, t-butyl, isopentyl, hexyl, cyclohexyl, heptyl, octyl, 2-ethylhexyl, decyl, dodecyl, hydroxyethyl, hydroxypropyl, isobornyl, allyl or cinnamyl methacrylate.

    4. The process according to claim 1, where the microorganism comprises E. coli, Corynebacterium glutamicum, Pseudomonas fluorescens or Pseudomonas putida.

    5. The process according to claim 1, wherein the microorganism is genetically modified to produce more C.sub.3-C.sub.12 methacrylate ester than a wildtype.

    6. The process according to claim 1, wherein the microorganism expresses one or more enzymes which can convert isobutyryl-CoA to methacrylyl-CoA.

    7. The process according to claim 1, wherein the microorganism expresses one or more enzymes which can convert methacrylyl-CoA to a C.sub.3-C.sub.12 methacrylate ester.

    8. The process according to claim 1, wherein the microorganism expresses an oxidase, dehydrogenase or oxidoreductase enzyme and an alcohol acyltransferase enzyme.

    9. The process according to claim 8, wherein the oxidase is an acyl CoA oxidase.

    10. The process according to claim 8, wherein the oxidase is ACX4 from Arabidopsis thaliana.

    11. The process according to claim 1, wherein the microorganism expresses one or more enzymes which can convert 2-ketoisovaleric acid to isobutyryl-CoA.

    12. The process according to claim 11, wherein the enzyme comprises a branched chain keto acid dehydrogenase enzyme complex or an oxidoreductase enzyme.

    13. The process according to claim 12, wherein the branched chain keto acid dehydrogenase enzyme complex comprises branched chain keto acid dehydrogenase (BCKD) from P. putida, BCKD from Bacillus subtilis, BCKD from P. aeuruginosa, BCKD from A. thaliana, BCKD from Streptomyces coelicolor or BCKD from Thermus thermophiles.

    14. The process according to claim 1, wherein the transesterification of step d) takes place in the presence of methanol and a catalyst.

    15. The process of claim 14, wherein the catalyst is a basic catalyst.

    16. The process of claim 14, wherein the catalyst is selected from metal oxide, hydroxide, carbonate, acetate (ethanoate), oxalate, alkoxide, hydrogencarbonate, a quaternary ammonium compound of one of the above, an alkyl or phenyl amine, diazabicycloundecene and diazabicyclononane.

    17. The process of claim 14, wherein the catalyst is selected from one or more of the following: LiOH, NaOH, KOH, Mg(OH).sub.2, Ca(OH).sub.2, Ba(OH).sub.2, CsOH, Sr(OH).sub.2, RbOH, NH.sub.4OH, Li.sub.2CO.sub.3, Na.sub.2CO.sub.3, K.sub.2CO.sub.3, Rb.sub.2CO.sub.3, Cs.sub.2CO.sub.3, MgCO.sub.3, CaCO.sub.3, SrCO.sub.3, BaCO.sub.3, (NH.sub.4).sub.2CO.sub.3, LiHCO.sub.3, NaHCO.sub.3, KHCO.sub.3, RbHCO.sub.3, CsHCO.sub.3, Mg(HCO.sub.3).sub.2, Ca(HCO.sub.3).sub.2, Sr(HCO.sub.3).sub.2, Ba(HCO.sub.3).sub.2, NH.sub.4HCO.sub.3, Li.sub.2O, Na.sub.2O, K.sub.2O, Rb.sub.2O, Cs.sub.2O, MgO, CaO, SrO, BaO, Li(OR.sup.1), Na(OR.sup.1), K(OR.sup.1), Rb(OR.sup.1), Cs(OR.sup.1), Mg(OR.sup.1).sub.2, Ca(OR.sup.1).sub.2, Sr(OR.sup.1).sub.2, Ba(OR).sub.2, NH.sub.4(OR.sup.1) where R.sup.1 is any C1 to C6 branched, unbranched or cyclic alkyl group, being optionally substituted with one or more functional groups; NH.sub.4(R.sup.2CO.sub.2), Li(R.sup.2CO.sub.2), Na(R.sup.2CO.sub.2), K(R.sup.2CO.sub.2), Rb(R.sup.2CO.sub.2), Cs(R.sup.2CO.sub.2), Mg(R.sup.2CO.sub.2).sub.2, Ca(R.sup.2CO.sub.2).sub.2, Sr(R.sup.2CO.sub.2).sub.2 or Ba(R.sup.2CO.sub.2).sub.2, where R.sup.2CO.sub.2 is acetate; (NH.sub.4).sub.2(CO.sub.2R.sup.3CO.sub.2), Li.sub.2(CO.sub.2R.sup.3CO.sub.2), Na.sub.2(CO.sub.2R.sup.3CO.sub.2), K.sub.2(CO.sub.2R.sup.3CO.sub.2), Rb.sub.2(CO.sub.2R.sup.3CO.sub.2), Cs.sub.2(CO.sub.2R.sup.3CO.sub.2), Mg(CO.sub.2R.sup.3CO.sub.2), Ca(CO.sub.2R.sup.3CO.sub.2), Sr(CO.sub.2R.sup.3CO.sub.2), Ba(CO.sub.2R.sup.3CO.sub.2), (NH.sub.4).sub.2(CO.sub.2R.sup.3CO.sub.2), where CO.sub.2R.sup.3CO.sub.2 is oxalate; methylamine, ethylamine, propylamine, butylamine, pentylamine, hexylamine, cyclohexylamine, aniline; R.sub.4NOH where R is methyl, ethyl propyl, butyl; diazabicycloundecene and diazabicyclononane.

    18. The process according to claim 14, wherein the catalyst is selected from a Group I or Group II metal salt.

    19. The process of claim 14, wherein the catalyst is selected from Group I or Group II metal oxide, hydroxide, carbonate, acetate, oxalate, alkoxide and hydrogencarbonate.

    20. The process according to claim 14, wherein the catalyst is a Group I metal salt.

    21. The process according to claim 14, wherein the catalyst is a Group I methoxide.

    22. The process according to claim 14, wherein the catalyst is a homogeneous catalyst.

    23. The process according to claim 14, wherein the catalyst is selected from the group consisting of sodium methoxide, lithium methoxide, potassium methoxide, sodium hydroxide, lithium hydroxide, potassium hydroxide and mixtures thereof.

    24. The process according to claim 1, wherein the transesterification of step d) takes place in conditions where the mol % water with respect to the catalyst is less than or equal to 50%.

    25. The process of claim 1, further comprising wherein a step of drying the organic phase is carried out prior to the transesterification of step d).

    26. The process according to claim 1, wherein the transesterification of step d) takes place in the absence of water.

    27. The process according to claim 1, wherein the titre of C.sub.3-C.sub.12 methacrylate ester in the fermentation medium is approximately 220 mg/l.

    28. The process according to claim 1, wherein the organic phase provided in step b) is provided by the C.sub.3-C.sub.12 methacrylate ester produced by the microorganism.

    29. The process according to claim 1, wherein the organic phase provided in step b) comprises an external organic solvent in contact with the fermentation medium.

    30. The process according to claim 29, wherein the organic solvent is biocompatible.

    31. The process according to claim 29, wherein the organic solvent has a log P.sub.o/w value of greater than or equal to 3.0.

    32. The process according to claim 29, wherein the solvent is selected from the group consisting of tributyrin, isopropylbenzene, n-propylbenzene, cycloheptane, hexane, heptane, cyclooctane, isooctane, 1,4-diisopropylbenzene, octane, nonane, decane, undecane, dodecane and mixtures thereof.

    33. The process according to claim 1, further comprising purifying the C.sub.3-C.sub.12 methacrylate ester in the said organic phase.

    Description

    DETAILED DESCRIPTION OF THE INVENTION

    [0138] The present invention will now be further described with reference to the following figures which show:

    [0139] FIG. 1: The structure of plasmid pMMA121 for expression of the Arabidopsis thaliana ACX4 protein in E. coli.

    [0140] FIG. 2: The production of methacrylyl-CoA from isobutyryl-CoA using the Arabidopsis thaliana ACX4 protein produced from recombinant E. coli.

    [0141] FIG. 3: SDS-PAGE analysis of fractions of the recombinant E. coli containing the Arabidopsis thaliana ACX4 protein.

    [0142] FIG. 4: The structure of plasmids pWA008, pMMA133 and pMMA134 for the expression of Apple AAT (MpAAT1), ACX4 from Arabidopsis thaliana, and bkdA1, bkdA2, bkdB and IpdV: BCKAD complex genes from Pseudomonas aeruginosa PA01 strain in recombinant E. coli.

    [0143] FIG. 5: The production of butyl methacrylate from 2-ketoisovalerate and butanol by HPLC analysis of a sample of the culture of recombinant E. coli production expressing plasmid pMMA134. .square-solid., 2-ketoisovalerate (2-OIV); .box-tangle-solidup., isobutyric acid (IBA); .diamond-solid., butyl methacrylate (BMA); and x, methacrylic acid (MAA).

    [0144] FIG. 6: Conversion of n-BMA to MMA versus reaction temperature using sodium methoxide as catalyst.

    [0145] FIG. 7: Conversion of n-BMA to MMA versus reaction temperature using lithium hydroxide as catalyst.

    [0146] FIG. 8: Conversion of n-BMA to MMA versus time at a reaction temperature using lithium hydroxide as catalyst.

    [0147] FIG. 9: Change in conversion of nBMA to MMA with time in a reaction catalysed by lithium methoxide.

    [0148] FIG. 10: Plot of conversion to MMA against time for the transesterification reaction of nBMA upon further addition of methanol and nBMA after an initial transesterification reaction catalysed by LiOH and LiOMe.

    [0149] FIG. 11: Plot of conversion to MMA against time for the transesterification of nBMA with increasing water content.

    [0150] The present inventors undertook extensive testing to determine how MMA might be efficiently produced by using microorganisms. In particular, though extensive experimentation, the present inventors have developed a process by which MMA can be produced via a step in which a C.sub.3-C.sub.12 methacrylate ester is produced by fermentation. The present inventors have surprisingly been able to develop such a process despite the toxicity of such C.sub.3-C.sub.12 methacrylate esters to microorganisms which was previously considered to make such a process unfeasible.

    [0151] General Materials & Methods

    [0152] Culture Growth and Maintenance

    [0153] Microorganisms

    [0154] Escherichia coli and Saccharomyces cerevisiae strains were stored in 16% glycerol stock solutions at 80 C. Working cultures were prepared on agar plates.

    [0155] Luria Bertani (LB) and Agar Preparation

    [0156] Luria Bertani high salt medium (Melford) (25 g/L) was used whenever LB medium is referred to. LB medium was prepared by dissolving peptone from casein digest (10 g), yeast extract (5 g) and sodium chloride (10 g) in 1 litre of water. The mixture was sterilised by autoclaving at 126 C. for 15 minutes, then left to cool to room temperature. Liquid LB medium was stored in a sealed sterile Duran bottle for up to one week at room temperature. LB agar plates were prepared using LB high salt medium (25 g/I) and agar (20 g/I). The LB and agar mixture was sterilised by autoclaving and allowed to cool in a 50 C. water bath prior to pouring, using aseptic techniques into sterile petri dishes. Plates were stored for up to two weeks at 4 C.

    [0157] Yeast Extract-Peptone-Dextrose (YEPD) and Aqar Preparation

    [0158] Yeast extract-Peptone-Dextrose (YEPD) medium and agar plates were prepared by dissolving yeast extract (3 g), malt extract (3 g), peptone from soybeans (5 g) and glucose (10 g) in distilled water (1 I). Agar (15 g) was added if preparing agar plates. The mixture was autoclaved at 126 C. for 15 minutes and then allowed to cool to 60 C. before pouring the plates using aseptic techniques into sterile petri dishes. Plates were stored for up to two weeks at 4 C. Liquid YEPD medium was stored for up to one week at room temperature.

    [0159] MSX Broth Preparation

    [0160] Minimal salts (MSX) medium was prepared in three parts; MSA, MSB and Vishniac Trace Elements. Vishniac trace elements solution (1 I) was prepared by combining EDTA disodium salt (50 g) with water (800 ml), dissolved by adding KOH pellets (2-3 at a time). Chemicals were then added in the following order; ZnSO.sub.4 (2.2 g), CaCl.sub.2 (5.54 g), MnCI.sub.2.4H.sub.2O (5.06 g), FeSO.sub.4.7H.sub.2O (5 g), (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O (1.1 g), CuSO.sub.4.5H.sub.2O (1.57 g) and CoCl.sub.2.6H.sub.2O (1.61 g). The solution was adjusted to pH 6 using KOH (1 M) then made up to 1 I using water. The solution was stored for up to six months at 4 C. MSA was prepared by dissolving KH.sub.2PO.sub.4 (6 g) and Vishniac trace elements (2 ml in water (660 ml). The solution was adjusted to pH 7 using KOH (1 M). The solution was then made up to 760 ml with water. MSB was prepared by dissolving NH.sub.4Cl (3 g) and MgSO.sub.4.7H.sub.2O (0.4 g) in water (200 ml). A stock solution of glucose (12.5%) was also prepared by dissolving D-glucose (12.5 g) in water (100 ml). MSA, MSB and glucose (40 ml) were autoclaved at 126 C. separately for 15 minutes then combined aseptically once cooled, the final solution having a pH of 6.8. The solution was stored for up to one week at room temperature.

    [0161] Cultivation of Microorganisms in Liquid Medium

    [0162] General

    [0163] From glycerol stock solutions, E. coli and S. cerevisiae were streaked onto sterile agar plates using four disposable inoculation loops. The inoculated plates was placed in an incubator overnight at 37 or 30 C. for E. coli and S. cerevisiae, respectively. An appropriate amount of sterile LB, YEPD or MSX medium (25 ml of medium in a 100 ml flask and 50 ml of medium in a 250 ml flask) was added to a sterile Erlenmeyer flask, fitted with a polyurethane foam bung and covered with aluminium foil, using aseptic techniques. To inoculate from an agar plate, a well isolated single colony was removed from the plate using a disposable inoculation loop. The colony was transferred to a pre-autoclaved flask containing the appropriate medium. The flask stopper was replaced and the flask incubated in an orbital incubator at 30 or 37 C., 200 rpm, for the respective microorganism. Once an OD.sub.600 value of =0.8 was reached, an aliquot of inoculum was removed from the overnight culture using a sterile pipette and transferred to a pre-autoclaved flask. The type of flask and volumes required at this stage of cultivation was specific to each test and are stated in each relevant section in this chapter. This method was used to initially inoculate all cultures for growth and toxicity tests carried out throughout this thesis.

    [0164] Specific growth rates of cultures were calculated in the exponential growth phase using the equation In Nt/N0=t, where Nt is the arbitrary light scattering units at time t (h) and p is the growth rate (h1). Growth rates varied slightly dependent on type of growth medium and also between different tests, therefore all growth test results are expressed as a percentage value of the control run alongside that particular test.

    [0165] Growth Inhibition TestsShake-Flask Cultures

    [0166] Methacrylate ester toxicity tests were carried out in sterile 40 ml Teflon sealed glass vials, due to their volatility and ability to degrade the plastic well plates. To each vial the appropriate medium of LB or MSX medium was added for E. coli, and YEPD for S. cerevisiae, by aseptic technique. The medium was then inoculated with an overnight culture of E. coli or S. cerevisiae (100 l). One vial was then left containing only these components as a control test, and to the remaining three vials was added the desired methacrylate ester. The four vials per methacrylate ester were then transferred to an orbital incubator set to 30 or 37 C., 250 rpm, for E. coli or S. cerevisiae, respectively. The aqueous medium phase was sampled every 30 minutes initially, and every 10 min once the cells entered the exponential growth phase, and again every 30 min once the stationary phase was reached, to produce a growth curve. Samples were taken through the Teflon-sealed lids using a sterile glass syringe and needle, and the OD600 values were recorded using a UV/Vis spectrophotometer, diluting samples to the appropriate detection range.

    TABLE-US-00001 TABLEOFPRIMERSANDSEQUENCES SEQ REF PRIMERSEQUENCE(5 to3) ID BCKAD.F GGCCTGTCATGAGTGATTACGAGCCG 1 BCKAD.R CGGCCCTGCAGGTTCGCGGGAATCAGATGTGC 2 AAT.F AGGAGATATACCATGAAAAGCTTTTCTGTACTC 3 AAT.R AGCAGCCGGATCCCCTGCAGGACTAGTTTACTG 4 GCTGGTGCTAC ACX4.F CACCAGCCAGTAAGCTAGCAAGGAGATATACCA 5 TGGCTG ACX4.R TCCCCTGCAGGACTAGTTTACAGGCGAGAACGG 6 GTAG

    TABLE-US-00002 Table of plasmids PLASMID REFERENCE SOURCE DESCRIPTION pET16b(Sse) This work The pET16b expression vector with a modified Sse8387I restriction site. pMMA121 This work The pET16b (Sse) expression vector containing the ACX4 gene from A. thaliana optimized for expression in pET16b (Sse) between its Xbal and Sse8387I restriction sites. pWA008 This work The pET16b(Sse) expression vector containing the operon which encodes the BCKAD complex from P. aeruginosa PA01 strain inserted between its Ncol and Sse8387I restriction sites. pAAT212 This work The pET(Sse) expression vector containing the AAT gene from Apple optimised for expression in pET16b (Sse) inserted between its Ncol and Sse8387I restriction sites pMMA133 This work The pAAT212 plasmid further containing the ACX4 gene from A. thaliana optimised for expression in the pET16b (Sse) vector inserted between the Spel restriction site and the AAT gene. pMMA134 This work The pMMA133 and the pWA008 plasmids ligated together and containing the ACX4 gene from A. thaliana optimised for expression in the pET16b (Sse) vector, the AAT gene from Apple optimised for expression in the pET16b (Sse) vector, and the BCKAD complex from P. aeruginosa PA01 strain inserted between the Xbal and Sse8387I restriction sites.

    [0167] Analytical Methods

    [0168] Biomass Concentration

    [0169] Optical density (OD) measurements were made at 600 nm with an Agilent 8453 spectrophotometer using polystyrene cuvettes (10 mm path length). Samples (1 ml) to be analysed were transferred to cuvettes and the OD measured. When the reading was outside of a range from 0-0.8, samples were diluted 1 in 10 in dH.sub.2O until they were within the specified range.

    [0170] Gas Chromatography

    [0171] The samples from the BMA/MMA extraction experiments were analysed using gas chromatography under the following operating conditions:

    TABLE-US-00003 Column Agilent HP-5MS (325 C. max) Column dimensions 30 m 0.25 mm 0.25 m nominal Gas Helium He flow rate 1.00 ml min.sup.1 Detector FID Oven set point 55 C. Oven Ramp C./min Next C. Hold min Run time Initial 55 3.5 3.5 Ramp1 30 180 1 8.67

    [0172] The samples from the transesterification experiments were analysed using gas chromatography under the following operating conditions:

    TABLE-US-00004 Column RTX-1701 (from Thames Restek) Column dimensions 62 m 0.32 mm 1.0 m nominal Gas Hydrogen H.sub.2 flow rate 2.01 ml min.sup.1 Detector FID Oven set point 60 C. Oven Ramp C./min Next C. Hold min Run time Initial 60 10 10 Ramp 1 10 180 2 24 Ramp 2 20 220 6 32

    EXAMPLES

    [0173] Toxicity of Higher Methacrylate Esters to E. coli and S. cerevisiae

    [0174] The present inventors investigated the toxicity of C.sub.3-C.sub.12 methacrylate esters to mircroorganisms, in particular the E. coli strain MG1655 and the S. cerevisiae strain DSM70449.

    [0175] In particular, the relative toxicities of methyl methacrylate (MMA), isopropyl methacrylate (iPMA) and butyl methacrylate (BMA) were investigated by growing E. coli MG1655 and S. cerevisiae DSM70449 in LB and YEPD medium respectively, in the presence of various concentrations of the methacrylate esters.

    [0176] Final biomass concentrations were recorded after 72 hours and were used to calculate the inhibitory concentration (IC.sub.50) for each ester. This is the concentration of ester that halves the maximum optical density (MaxOD.sub.600) compared to growth in the absence of the ester (see Table 1).

    TABLE-US-00005 TABLE 1 The calculated IC.sub.50 values of methacrylate esters towards E. coli and S. cerevisiae grown in complex medium. IC.sub.50 range (g/l) Methacrylate Ester logP.sub.o/w S. cerevisiae E. coli MMA 0.95 0.73-1.45 3.19-4.25 iPMA 1.81 0.66-0.99 1.18-1.77 BMA 2.57 0.04-0.07 0.07-0.11

    [0177] The toxicities of MMA, iPMA and BMA towards E. coli were also determined when the cells were grown in MSX medium. Final biomass concentrations were used to calculate the inhibitory concentration (IC.sub.50) for each ester (see Table 2).

    TABLE-US-00006 TABLE 2 The calculated IC.sub.50 values of methacrylate esters towards E. coli grown in MSX medium. Methacrylate Ester logP.sub.o/w IC.sub.50 range (g/l) MMA 0.95 3.19-4.25 iPMA 1.81 1.18-1.77 BMA 2.57 0.07-0.11

    [0178] All the esters tested were toxic towards both E. coli and S. cerevisiae (Tables 1 and 2). However, significantly increased toxicity was shown in the presence of BMA compared to the shorter chain methacrylate esters, making the use of fermentation to produce this ester difficult, due to the toxicity exhibited towards the microorganism.

    [0179] Production of butyl methacrylate from 2-ketoisovalerate by recombinant Escherichia coli The present inventors then undertook experimentation to determine whether C.sub.3-C.sub.12 methacrylate esters, for example butyl methacrylate, could be produced by microorganisms such as E. coli.

    [0180] The ACX4 gene from Arabadopsis thaliana was codon optimized for E. coli, synthesised and cloned into pET16b (Sse) vector. This gene was digested with Nhe1/Sse83871 and ligated in pET16b (Sse) digested with Xba1/Sse83871. The resultant plasmid, pMMA121 (see FIG. 1), was introduced into E. coli BL21(DE3), and the recombinant E. coli (BL21(DE3)/pMMA121) was cultured as follows.

    [0181] BL(DE3/)pET16b (vector control) or BL21(DE3)/pMMA121 was inoculated in LB medium supplemented with ampicillin (0.1 mg/ml) and grown overnight in a test tube at 37 C. An aliquot of an overnight culture was transferred to 100 ml of the same medium in a flask and shaken at 37 C. for 2-3 hours. IPTG (final 1 mM) was added to the flask and the culture was incubated with shaking at 20 C. overnight.

    [0182] Cells were harvested by centrifugation and suspended in 0.1 M sodium phosphate buffer (pH 7.0), then disrupted by sonication. The disrupted E. coli cells were centrifuged to supernatant and pellet fractions, and both the vector control and the cells containing pMMA121 were analysed for ACO (acyl-CoA oxidase) activity (see FIG. 2) and expression for ACX4 protein by SDS-PAGE (see FIG. 3).

    [0183] FIG. 2 shows the presence of only IBA-CoA in the buffer, the presence of IBA-CoA and a small amount of CoA in the sample containing cells comprising only the unaltered plasmid pET16b, and the presence of MAA-CoA, much less IBA-CoA and an unknown compound in the sample containing cells comprising the plasmid pMMA121. Therefore, a high ACO activity was detected in the supernatant fraction of BL21(DE3)/pMMA121 indicated by the production of methacrylyl CoA, showing that the 40 kDa protein detected by the SDS-PAGE of FIG. 3 is the ACX4 protein. The SDS-PAGE shows, at lane 1BL21/pET16b (vector) SF (soluble fraction); lane 2BL21/pMMA121 SF; lane 3BL21/pET16b IF (insoluble fraction); lane 4BL21/pMMA121 IF; and lane 5molecular weight marker. Around 40 kDa, a band (highlighted by black boxes) was observed only in the BL21/pMMA121 lanes but not in the BL21/pET16b (vector) lanes.

    [0184] BCKAD complex gene was cloned from Pseudomonas aeruginosa PA01 strain as follows. A DNA fragment containing an entire gene operon which encodes the BCKAD complex gene was obtained by PCR with primers BCKAD.F and BCKAD.R using the genomic DNA as a template. The obtained fragment was digested with restriction enzymes BspHI and Sse83871, and inserted into the vector pET16b(Sse) between Nco1/Sse83871 (BamH site of pET16b was converted to Sse83871 site). The resultant plasmid was named pWA008 (see FIG. 4).

    [0185] A plasmid for expressing Apple AAT and A. thaliana ACX4 was constructed as follows. DNA fragments containing AAT or ACX4 gene was amplified by PCT with primers AAT.F and AAT.R or ACX4.F and ACX4.R using a plasmid containing codon-optimised AAT gene or pMMA121 as a template, respectively. pET(Sse) vector was digested with restriction enzymes NcoI and Sse83871 and joined with the DNA fragment containing AAT gene, by using In-Fusion HD Cloning Kit (Takara Bio). The resultant plasmid, pAAT212, was digested with restriction enzyme SpeI and joined with the DNA fragment containing ACX4 gene, by using In-Fusion HD Cloning Kit. The resultant plasmid, pMMA133, contained AAT and ACX4 genes with T7 promoter control (see FIG. 4).

    [0186] A plasmid expressing BCKAD, AAT and ACX4 was constructed as follows. Plasmid pMMA133 was digested with restriction enzymes SpeI and Sse838771, and the linearised DNA fragment was obtained. Plasmid pWA008 was digested with restriction enzymes XbaI and Sse83871 and the 5.0 kb fragment containing BCKAD complex gene was isolated. Both fragments were ligated using DNA Ligation Kit Mighty Mix (manufactured by Takara Bio Inc.). The resultant plasmid pMMA134 (FIG. 4) was introduced into E. coli BL21(DE3) for butyl methacrylate production experiments.

    [0187] E. coli BL21(DE3)/pMMA134 was cultured in essentially the same manner as described above in relation to expression of ACX4. Cells were harvested by centrifuge, washed with 0.1 M sodium phosphate buffer (pH 7.0) and suspended in the same buffer to obtain a cell suspension. By using cell suspension, about 1 ml of a resting cell reaction solution was prepared in each vial, which contained 40 mM 2-ketoisovalerate (2-oxoisovalerate), 60 mM butanol, 0.05 M sodium phosphate buffer (pH 7.0) and cells (OD.sub.650=12.5). The reactions were carried out at 30 C., 180 rpm for 3 to 44 hour, and 1 ml acetonitrile was added to the vials and mixed well to stop the reaction. After filtration using a syringe filter DISMIC/hole diameter 0.45 micron (manufactured by ADVANTEC), analysis was made by HPLC on ODS column. The HPLC conditions were as follows: Apparatus: Waters 2695, Column: CAPCELL PAK C18 UG120, 2.0 mml.Math.C.250 mm, Mobile phase: 0.1% phosphoric acid/65% methanol, Flow amount: 0.25 ml/min, Run rime: 12 min, Column temperature: 35 C. and Detection: UB 210 nm.

    [0188] FIG. 5 shows the concentration of the following chemicals over the time of the fermentation: .square-solid., 2-ketoisovalerate (2-OIV); .box-tangle-solidup., isobutyric acid (IBA); .diamond-solid., butyl methacrylate (BMA); and x, methacrylic acid (MAA). As the concentration of the feedstock of 2-ketoisovalerate (2-oxoisovalerate) falls, the production of the intermediate in the pathway isobutyric acid, increases, as does the production of the final ester product butyl methacrylate.

    [0189] This example demonstrates viable in vivo production of a C.sub.3-C.sub.12 methacrylate ester, in particular butyl methacrylate, from the biochemical intermediate 2-ketoisovalerate (2-oxoisovalerate) which is produced directly from glucose, and the reagent butanol which is a common industrial feedstock. The production of butyl methacrylate is demonstrated at industrially applicable levels by culturing of recombinant E. coli cells expressing the BCKAD operon to convert 2-ketoisovalerate into isobutyryl CoA, ACX4 to convert isobutyryl CoA into methacrylyl CoA, and AAT to convert methacrylyl CoA into butyl methacrylate by reaction with butanol.

    [0190] Extraction of BMA into Organic Solvents

    [0191] Following the above investigation which demonstrated the production of butyl methacrylate from 2-ketoisovalerate by recombinant Escherichia coli, the present inventors undertook significant experimentation to investigate the extraction of C.sub.3-C.sub.12 methacrylate ester, for example BMA, from fermentation media.

    [0192] In brief, five shake flask cultures were grown containing a variant E. coli strain similar to that used in the example above demonstrating the production of butyl methacrylate from 2-ketoisovalerate by recombinant Escherichia coli. Biomass was harvested from each flask and a separate biotransformation conducted. BMA and MMA levels in dodecane following solvent extraction was quantified by gas chromatography flame ionization detector (GC-FID).

    [0193] In a 1 I baffled shake flask, a starter culture of 200 ml LB medium containing 200 pg/ml ampicillin was grown for 16.33 hours. The culture was back diluted to OD.sub.600 0.2 into 51 I baffled shake flasks containing 300 ml fresh LB medium and left to grow at 30 C. and 250 rpm for 23.35 hours. The biomass was then harvested by centrifugation at 5000 rpm and 4 C. for 15 minutes. Each cell pellet was washed with 100 mM sodium phosphate (pH 6.7) and the centrifugation step was repeated. The biomass was resuspended in the required volume of biotransformation medium until an OD.sub.600 of 25 was reached.

    [0194] Biotransformation reactions were conducted in 5250 ml sealed Schott bottles at 30 C. and 180 rpm for 24 hours. The conditions for each biotransformation are shown in Table 3 below.

    TABLE-US-00007 TABLE 3 Biotransformation conditions Concentration of Substrate/external sodium phosphate Biotrans # std added buffer (pH 6.7) 1 40 mM 2-ketoisovalerate 50 mM 60 mM 1-butanol 2 0.28 mM BMA (40 mg/l) 100 mM 3 0.40 mM MMA (40 mg/l) 100 mM 4 0.70 mM BMA (100 mg/l) 100 mM 5 1 mM MMA (100 mg/l) 100 mM

    [0195] Samples were taken for GC-FID analysis at 5 hour and 24 hour time points. At each time point 5 ml sample was removed and transferred to a 15 ml falcon tube. Acetonitrile (5 ml) was added in addition to dodecane (1 ml). The mixture was vigorously shaken at >800 rpm for 10 minutes before centrifugation at 3900 rpm and 20 C. for 20 minutes. A 500 l sample was taken from both the organic and aqueous phases, filtered through a 0.45 m filter and placed in a crimped lid gas chromatography vial prior to injection.

    [0196] Quantification of BMA and MMA levels in biotransformation samples was achieved by using external standard calibration cultures obtained by preparing volumetric stock solutions of BMA and MMA at known concentrations.

    [0197] The results of the extraction experiments are shown in Table 4 below:

    TABLE-US-00008 TABLE 4 Mass balance and extraction efficiencies of MMA and BMA into dodecane. Amount of Amount of Total Total Amount Amount Sample MMA added BMA added at BMA MMA extracted into remaining in timepoint at t = 0 mins t = 0 mins observed observed dodecane aqueous Biotrans # h mg/l mg/l mg/l mg/l mg/l % mg/l % 1 5 138 54.1 39.2 83.9 60.8 24 102.4 47.5 46.4 54.9 53.6 2 5 40 37.1 11.1 29.9 26.0 70 24 40 26.3 6.0 22.8 20.3 77.2 3 5 40 41.7 3.2 7.7 38.5 92.3 24 40 28.9 3.4 11.8 25.5 88.2 4 5 100 72.8 26.5 36.4 46.3 63.6 24 100 52.3 20.3 38.8 32.0 61.2 5 5 100 81.0 7.8 9.6 73.2 90.4 24 100 49.3 6.4 13.0 42.9 87.0

    [0198] The inventors demonstrated that the extraction efficiency of BMA into dodecane is consistently higher compared to MMA. For example, comparison of biotransformations 2 and 3 indicated a 2.7 higher extraction efficiency of BMA compared to MMA, and comparison of biotransformations 4 and 5 indicated a 3.3 higher extraction efficiency of BMA compared to MMA. Across all samples, the average amount of BMA extraction into dodecane was around 35.6% compared to 10.5% MMA.

    [0199] Production of MMA from BMA by Transesterification

    [0200] In the process of the present invention, BMA obtained via fermentation is transesterified to produce MMA. The inventors undertook experimentation to determine how an effective transesterification process which can operate with high reaction conversion and selectivity could be developed.

    [0201] Transesterification reactions often make use of a catalyst to drive the reaction. Such catalysts can be acid catalysts, base catalysts or biocatalysts for example. A number of homo and heterogeneous catalysts have been used to drive the transesterification of MMA into higher molecular weight methacrylates. However, the reverse reaction has not been investigated.

    [0202] A number of transesterification experiments were carried out using n-BMA, methanol and a range of catalysts.

    [0203] The transesterification experiments were carried out in three necked Schlenk flasks under an inert atmosphere of nitrogen. The reaction temperatures were determined by feeding a thermocouple into the reaction solution. In general a number of reaction samples were taken during the reaction. However, if the final experimental sample showed that no reaction had taken place then the earlier samples were not analysed.

    [0204] The levels of conversion of BMA to MMA using titanium butoxide, zirconium butoxide, zirconium acetylacetonate, a heterogeneous alkyl metal complex (caesium on silica), Amberlyst 15-H (a sulphonic acid functionalised polysytrene resin) were low (between 0 and 20%). However, the level of conversion using sodium methoxide, lithium methoxide and lithium hydroxide was much higher, as outlined below.

    [0205] Transesterification of n-BMA with Methanol and Sodium Methoxide

    [0206] n-BMA (1 mol, 142.20 g), MeOH (1 mol, 32.04 g), 4-hydroxy-TEMPO (0.1 g) and NaOMe (1.01 g, 18.7 mmol) were added to a three necked 250 ml Schlenk flask under nitrogen. One neck of the flask was stoppered, one neck was stoppered with a silicon bunge which was used to feed a thermocouple into the reaction solution and the third neck attached to a condenser. The temperature was initially kept at approximately 20 C. for an hour, and then raised every hour by approximately 10 C., until reflux at 88.2 C. was achieved. At each temperature point a sample was taken and analysed by gas chromatography.

    [0207] Using sodium methoxide as a catalyst resulted in good conversion of the n-BMA to MMA (around 50%; FIG. 6).

    [0208] Transesterification of n-BMA with Methanol and Lithium Hydroxide

    [0209] n-BMA (1 mol, 142.20 g), MeOH (1 mol, 32.04 g), 4-hydroxy-TEMPO (0.1 g) and LiOH (1.01 g, 42 mmol) were added to a three necked 250 ml Schlenk flask under nitrogen. One neck of the flask was stoppered, one neck was stoppered with a silicon bung which was used to feed a thermocouple into the reaction solution and the third neck attached to a condenser. The temperature was initially kept at approximately 20 C. for an hour, and then raised every hour by approximately 10 C., until reflux at 88.2 C. was achieved. At each temperature point a sample was taken and analysed by gas chromatography.

    [0210] Good conversion of n-BMA to MMA was achieved using lithium hydroxide as catalyst (between 5 and 60%; FIG. 7).

    [0211] A repeat experiment was then carried out (using lithium hydroxide as catalyst) to determine the rate of the reaction at the reflux temperature of the reactants.

    [0212] Lithium hydroxide (0.51 g, 21 mmol) was dissolved in methanol (32.43 g, 1 mol) by stirring in a sealed Schlenk flask. n-BMA (142.18 g, 1 mol) and 4-hydroxy-TEMPO (0.1 g) was added to a three necked 250 ml Schlenk flask under nitrogen and this mixture was heated to 88.2 C., with one neck stoppered, one bunged, and the other attached to a condenser. When reflux was reached and the temperature stabilised, the catalyst (lithium hydroxide) and MeOH solution was added to the reaction flask by syringe. A sample was taken every two minutes for the first ten minutes and every five minutes for an hour. The samples were then analysed by gas chromatography. As shown in FIG. 8, equilibrium ratios of n-BMA and MMA was achieved after heating for four minutes.

    [0213] Transesterification of n-BMA with Methanol and Lithium Methoxide

    [0214] Lithium methoxide (0.79 g, 20.9 mmol) was dissolved in methanol (32.04 g, 1.00 mol) by stirring in a sealed flask. A solution of nBMA (142.20 g, 1.00 mol) and 4-hydroxy-TEMPO (0.10 g) was heated under a nitrogen atmosphere (91 C.). When the temperature had stabilised, the catalyst and methanol solution was added and reflux achieved (88 C.). Samples were taken every two minutes for the first ten minutes and every half an hour for an hour. These samples were filtered through silica and analysed by gas chromatography.

    [0215] A conversion of nBMA to MMA of 533% was achieved after four minutes (FIG. 9).

    [0216] Comparing LiOH and LiOMe as Catalysts for the Transesterification of nBMA to MMA

    [0217] The degree of deactivation of two lithium catalysts, lithium hydroxide and lithium methoxide, was also investigated. This was to determine catalyst lifetimes.

    [0218] This was investigated by running transesterification reactions of nBMA with methanol using LiOH and LiOMe catalysts. After an hour at reflux a further mole of nBMA and mole of methanol was added to the reaction, and the conversion to MMA was time monitored.

    [0219] A solution of nBMA (142.20 g, 1.00 mol), methanol (32.04 g, 1.00 mol) and 4-hydroxy-TEMPO (0.10 g) was treated with a catalyst and heated to reflux (87 C.) under a nitrogen atmosphere.

    [0220] After an hour at reflux further nBMA (142.20 g, 1.00 mol) and methanol (32.04 g, 1.00 mol) was added to the reaction solution. Samples were taken every two minutes for the first ten minutes and every half an hour for an hour. These samples were filtered through silica and analysed by gas chromatography. LiOH (0.50 g, 20.9 mmol) and LiOMe (0.79 g, 20.9 mmol) catalysts were utilised.

    [0221] Upon the addition of additional nBMA and methanol to the transesterification reaction solution catalysed by LiOH no further increase in conversion to MMA was observed. This indicates that all the catalyst had been deactivated by the water formed in the first transesterification reaction so no further reaction could occur when fresh reactants were added (FIG. 10). However, with the LiOMe catalysed transesterification solution, when more reactants were added the conversion to MMA increased until equilibrium was reached (FIG. 10).

    [0222] This data indicates that the use of LiOH as catalyst would require addition of fresh LiOH over time to maintain the reaction. However, LiOMe would not need to be added as frequently and therefore may be more suited to a continuous reaction. The inactivation of LiOH is likely to be due to the conversion of LiOH to LiMMA; LiOMe does not react with methanol to form water in situ and therefore is not deactivated as quickly.

    [0223] Effect of Increasing the Amount of Water in the Transesterification Reaction

    [0224] In the process of the present invention, the fermentation reaction takes place in an aqueous environment and so the C.sub.3-C.sub.12 methacrylate ester produced will be saturated with water. Surprisingly, however, water affects the transesterification reaction.

    [0225] The consequence of the presence of water in the transesterification reaction is shown below in relation to the addition of increasing amounts of water to nBMA transesterification reactions with methanol. The reactions were run at reflux temperature and the conversion to MMA with time monitored. All percentages of water were determined as the moles of water with respect to the moles of LiOH (Table 5).

    TABLE-US-00009 TABLE 5 Addition of water to transesterification reaction. Mass Mass Moles Moles mol % H.sub.2O Experiment LiOH Water LiOH Water with respect number (g) (g) (mmol) (mmol) to LiOH 1 0.50 0 20.9 0 0 2 0.50 0.13 20.9 7.18 34.09% 3 0.50 0.53 20.9 29.5 140.29% 4 0.50 2.01 20.9 112 522.98%

    [0226] Lithium hydroxide (0.50 g, 20.9 mmol) was dissolved in methanol (32.04 g, 1.00 mol) and water (0.13 g, 71.8 mmol) by stirring in a sealed flask. A solution of nBMA and 4-hydroxy-TEMPO (0.10 g) was heated to 90 C. under a nitrogen atmosphere. When the temperature had stabilised, the LiOH, methanol and water solution was added and a reflux temperature of 86 C. was observed. Samples were taken every two minutes for the first ten minutes and then after 30 minutes and 60 minutes. These samples were filtered through silica gel before being analysed by gas chromatography. This method was repeated with masses of water of 0.53 g and 2.01 g.

    [0227] From the results it is clear that increasing the water in the reaction decreases the conversion of nBMA to MMA (FIG. 11). These results indicate that although conversion of C.sub.3-C.sub.12 methacrylate ester to MMA can take place in the presence of water, it is advantageous if the presence of water is limited to improve conversion. Therefore, it may be advantageous to remove the C.sub.3-C.sub.12 methacrylate ester of the present invention from the aqueous environment prior to commencement of the transesterification reaction.

    [0228] Biotransformation

    [0229] Biotransformation experiments were carried out on a new strain of E. coli modified for methacrylate ester production to compare the biotransformation using different alcohols.

    [0230] The cells were grown overnight in LB-Miller (Merck) plus ampicillin (200 g/mL) in a baffled shake flask at 30 C. and at 250 rpm.

    [0231] The resulting culture was centrifuged and the pellet resuspended to an OD of 50 with 0.1M sodium phosphate buffer (pH 7). An aliquot (15 mL) of this resuspended culture was placed into a 250 mL Schott bottle and 15 mL of 80 mM KIV (ketoisovalerate) stock solution was added. This provided an overall OD of 25 and a final concentration of 40 mM KIV and 0.05 M sodium phosphate buffer in 30 mL volume. Each alcohol was added neat to a final concentration of 5 mM. The biotransformation incubation was carried out in the Schott bottle at 30 C. and 250 rpm.

    [0232] Samples were taken after 3.5 h incubation for GC-MS analysis to determine alkyl methacrylate ester levels.

    [0233] Sampling was carried out by taking a 0.5 mL sample of the biotransformation broth adding 0.5 mL heptane and vortexing the mixture continuously for 5 minutes. The phases were then separated by microcentrifugation (14,800 rpm, 5 mins). A 0.2 mL sample of the resulting heptane extract was taken and placed into a GC vial (containing a 0.25 mL vial insert) and crimped. The sample was then subjected to GC-MS using an Agilent 6890 series GC with an Agilent 5973 mass selective detector (single quadrupole). The analytes were separated using an ZB-WAXPlus 30 m column, 250 m internal diameter and 0.25 m film thickness using helium carrier gas. Specific GC details are given in table 6 and the results are set out in table 7.

    TABLE-US-00010 TABLE 6 GC Parameters Column Type ZB-WAXPlus Column Length 30 metres Internal Diameter 0.25 mm Film Thickness 0.25 m Carrier Gas Helium Flow Rate 1 mL min.sup.1 Injection Type Split Split Ratio 50:1 Injection Volume 1 L Inlet Temperature 250 C. Pressure 12.3 psi

    TABLE-US-00011 TABLE 7 Biotransformation with various Alcohols at 3.5 hours Alkyl Methacrylate Ester Concentration 3.5 h Methanol 0.117 mM Butanol 1.031 mM Pentanol 2.122 mM Hexanol 0.756 mM Heptanol 1.460 mM Octanol 0.665 mM

    CONCLUSIONS

    [0234] These studies indicate that C.sub.3-C.sub.12 methacrylate esters (in particular n-BMA) can be transesterified to produce MMA with particular high efficiency using group I and group II basic metal salts as catalysts and that the absence of water results in higher conversion efficiency. In addition, it has been shown that the production of higher esters proceeds at a faster rate than that of methyl methacrylate.

    [0235] All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.

    [0236] Each feature disclosed in this specification (including any accompanying claims, abstract and drawings) may be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.

    [0237] The invention is not restricted to the details of the foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any process so disclosed.

    [0238] Furthermore, it will be appreciated that numerous modifications to the above described process may be made without departing from the scope of the invention as defined in the appended claims.