IMPROVED METHODS FOR REPROGRAMING NON-PLURIPOTENT CELLS INTO PLURIPOTENT STEM CELLS
20190282624 · 2019-09-19
Inventors
- Hongkui Deng (Beijing, CN)
- Yang Zhao (Beijing, CN)
- Ting Zhao (Beijing, CN)
- Jingyang Guan (Beijing, CN)
- Xu Zhang (Beijing, CN)
- Yao FU (Beijing, CN)
- Junqing Ye (Beijing, CN)
Cpc classification
C12N2501/385
CHEMISTRY; METALLURGY
C12N5/0606
CHEMISTRY; METALLURGY
C12N5/0667
CHEMISTRY; METALLURGY
C12N2501/06
CHEMISTRY; METALLURGY
C12N2501/01
CHEMISTRY; METALLURGY
C12N2501/999
CHEMISTRY; METALLURGY
A61K9/0019
HUMAN NECESSITIES
C12N5/0696
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
A61K35/545
HUMAN NECESSITIES
International classification
A61K35/545
HUMAN NECESSITIES
C12N5/00
CHEMISTRY; METALLURGY
Abstract
Provided are chemical inducers of pluripotency (CIP) which include glycogen synthase kinase inhibitors, TGF? receptor inhibitors, cyclic AMP agonists and S-adenosylhomocysteine hydrolase (SAH) inhibitors or histone acetylators. A method of inducing pluripotency in a partially or completely differentiated cell by using such chemical inducers of pluripotency is also provided. The method includes: (i) contacting a cell with the CIPs for a sufficient period of time to result in reprogramming the cell into a pluripotent stem cell having ESC-like characteristics (CiPSC). Isolated chemically induced pluripotent stem cells (CiPSCs) and their progeny, produced by inducing differentiation of the CiPSCs, can be used in a number of applications, including but not limited to cell therapy and tissue engineering.
Claims
1. A kit or cell culture media composition for inducing pluripotency in non-pluripotent eukaryotic cells, the composition comprising chemical inducers of pluripotency (CIPs) from each of the following groups (1) glycogen synthase kinase (GSK) inhibitors, (2) TGF? receptor inhibitors, (3) cyclic AMP (cAMP) agonists, (4) S-adenosylhomocysteine hydrolase (SAH) inhibitors, (5) histone acetylators, (6) DOT1L methyltransferase inhibitors, (7) Retinoic acid receptor (RAR) agonist, (8) epigenetic modulator, and (9) inhibitors of histone demethylation in amounts effective to induce reprogramming of XEN-like cells into pluripotent cells.
2. The kit or composition of claim 1, wherein the GSK inhibitor is [6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile] (C); the TGF? receptor inhibitor is [2-(3-(6-Methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine] (6); the cAMP agonist is Forskolin (F), the SAH inhibitor is 3-deazaneplanocin A (Z), the DOT1L methyltransferase inhibitor is SGC 0946 (S) (1-[3-[[[(2R,3S,4R,5R)-5-(4-Amino-5-bromo-7H-pyrrolo[2,3-d] pyrimidin-7-yl)-3,4-dihydroxytetrahydrofuran-2-yl]methyl](isopropyl)amino]propyl]-3-[4-(2,2-dimethylethyl)phenyl]urea) or EPZ004777, 1-(3-((((2R,3S,4R,5R)-5-(4-amino-7H-pyrrolo[2,3-d]pyrimidin-7-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methyl)(isopropyl)amino)propyl)-3-(4-(tert-butyl)phenyl)urea (E); RAR agonists include AM 580 (A) (4-[(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)carboxamido]benzoic acid); the epigenetic modulator is 5-azacytidine (D) and the inhibitor of histone demethylation is tranylcypromine (T) and optionally, wherein the composition comprises 2i-medium, the 2i medium optionally further comprising N2B27.
3. The kit or composition of claim 2 comprising VC6TFZASD.
4. (canceled)
5. The kit or composition of claim 1, further comprising a least one small molecule selected from the group consisting of: (i) small molecules that facilitate late reprogramming; (ii) epigenetic modulators selected from the group consisting of sodium butyrate and RG108 [N-Phthalyl-L-tryptophan] (iii) small molecules that improve/boost chemical reprogramming efficiency selected from the group consisting of SF1670 [N-(9,10-dioxo-9,10-dihydrophenanthren-2-yl)pivalamide]; DY131 [N-(4-(Diethylaminobenzylidenyl)-N-(4-hydroxybenzoyl)-hydrazine]; UNC0638 [2-Cyclohexyl-6-methoxy-N-[1-(1-methylethyl)-4-piperidinyl]-7-[3-(1-pyrrolidinyl)propoxy]-4-quinazolinamine]; SRT1720 [N-(2-(3-(piperazin-1-ylmethyl)imidazo[2,1-b]thiazol-6-yl)phenyl)quinoxaline-2-carboxamide hydrochloride]; 2-Me-5HT (2-methyl-5-hydroxytryptamine); IBMX [3,7-Dihydro-1-methyl-3-(2-methylpropyl)-1H-purine-2,6-dioneand]; (4-[4-(2,3-Dihydro-1,4-benzodioxin-6-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide) and TTNPB [4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid and (iv) protein growth factors.
6. The composition of claim 5 wherein the late reprogramming facilitator is selected from the group consisting of prostaglandin E2 (PGE2) and rolipram.
7-10. (canceled)
11. The kit of claim 2 in a kit, wherein the small molecular weight compounds are present in relative amounts to put into cell culture media for differentiated cells to induce expression of XEN markers selected from the group consisting of SALL4, GATA4 and SOX1.
12. A method of inducing pluripotency in partially or completely differentiated cells, the method comprising: (a) contacting the cell to be reprogrammed with a first cocktail of CIPs (XEN-Cocktail) for a sufficient period of time to bias the cells into a XEN-like cell population; (b) contacting the population of XEN-like cells for a sufficient period of time to reprogram the cell into a chemically induced pluripotent stem cell (CiPSC) with a second cocktail of CIPS (herein, XEN-CiPSC cocktail); and (c) culturing the cells in 2i-medium.
13. The method of claim 12, wherein the differentiated cells are selected from the group consisting of multipotent stem cells, cells of hematological origin, cells of embryonic origin, skin derived cells, fibroblasts, adipose cells, epithelial cells, endothelial cells, mesenchymal cells, parenchymal cells, neurological cells, and connective tissue cells.
14. The method of claim 14, wherein the cells to be induced are selected from the group consisting of fibroblasts, adipose-derived cells, neural derived cells and intestinal epithelial cells, preferably not expressing Oct4 and optionally, wherein the cells are not transfected to express any of Oct4, KLF4, SOX2, C-Myc or NANOG.
15. (canceled)
16. The method of claim 12, wherein the cells to be induced are cultured in reprogramming medium comprising the CIPs for a period between 26-30 days.
17. The method of claim 12 wherein the cell culture medium comprises VC6TFA the entire time before the use of 2i-medium.
18. The method of claim 12 wherein the cells are replated at a density between 50,000 to 100,000 per well in a 6-well plate between day 6-10.
19. The method of claim 12 wherein the XEN-cocktail comprises VC6TFAE and/or the XEN-CiPSC cocktail comprises VC6TFZASD.
20. (canceled)
21. The method of claim 12 wherein the medium is changed into 2i-medium between day 26 to and day 30 and cultured in 2i-medium for about 10-14 days and optionally, wherein the 2i-medium further comprises N2B27.
22-23. (canceled)
24. The method of claim 12 wherein the cell culture medium further comprising small molecules that facilitate late reprogramming selected from the group consisting of cAMP agonists, epigenetic modulators and small molecules that improve/boost chemical reprogramming efficiency.
25. The method of claim 12 wherein the XEN-cocktail does not comprise SGC 0946.
26. The method of claim 12, wherein the media comprising the small molecule that boosts reprogramming efficiency, TTNPB.
27. The method of claim 12, comprising identifying the pluripotent cells based on morphology, doubling time, the ability of the cell to differentiate into tissues of the three embryonic germ layers, expression of ESC markers and combinations thereof wherein the ESC markers are selected from the group consisting of alkaline phosphatase (AP); nanog; Rex1; Sox2; Dax1; Sall4; undifferentiated embryonic cell transcription factor (Utf1); stage specific embryonic antigen-4 (SSEA-4) and combinations thereof; and optionally, isolating the pluripotent cells.
28-29. (canceled)
30. Pluripotent cells obtained by the method of claim 12.
31. A therapeutic composition comprising the pluripotent cells of claim 30, formulated for administration to an individual by injection, implantation of a prosthetic device or tissue engineering matrix.
32. The pluripotent cells of claim 31, wherein the the ESC markers are selected from the group consisting of alkaline phosphatase (AP); nanog; Rex1; Sox2; Dax1; Sall4; undifferentiated embryonic cell transcription factor (Utf1); stage specific embryonic antigen-4 (SSEA-4) and combinations thereof; and optionally, isolating the pluripotent cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0038] The term chemically induced pluripotent stem cells (CiPSCs) as used herein refers to pluripotent cells derived from a cell that is not pluripotent, i.e., a multipotent or differentiated cells, by contacting the non-pluripotent cell with chemical compounds, not by expression of one or more transfected genes.
[0039] As used herein a culture means a population of cells grown in a medium and optionally passaged. A cell culture may be a primary culture (e.g., a culture that has not been passaged) or may be a secondary or subsequent culture (e.g., a population of cells which have been subcultured or passaged one or more times).
[0040] As used herein enhancing, or increasing the efficiency of reprogramming means reducing to total reprogramming time and/or increasing the number of reprogrammed cells obtained from the same starting cell density the same length of time when compared to a chemical reprogramming method that does not proceed via biasing the cells to be programming towards a XEN-like state.
[0041] The term Induced pluripotent stem cell (iPSC), as used herein, is a type of pluripotent stem cell artificially derived from a non-pluripotent cell. CiPSCs are iPSCs; however, they differ from some iPSCs in that they are not genetically engineered.
[0042] The term isolated or purified when referring to CiPSCs means chemically induced pluripotent stem cells at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% free of contaminating cell types such as non-pluripotent cells. The isolated stem cells may also be substantially free of soluble, naturally occurring molecules.
[0043] The term pluripotency (or pluripotent), as used herein refers to a stem cell that has the potential to differentiate into any of the three germ layers: endoderm (for example, interior stomach lining, gastrointestinal tract, the lungs), mesoderm (for example, muscle, bone, blood, urogenital), or ectoderm (for example, epidermal tissues and nervous system). The term not pluripotent means that the cell does not have the potential to differentiate into all of the three germ layers. A multipotent stem cell is less plastic and more differentiated, and can become one of several types of cells within a given organ. For example, multipotent blood stem cells can develop into red blood cell progenitors, white blood cells or platelet producing cells. Adult stem cells are multipotent stem cells. Adipose-derived stem cells are multipotent.
[0044] Reprogramming as used herein refers to the conversion of a one specific cell type to another. For example, a cell that is not pluripotent can be reprogrammed into a pluripotent cell. Where the non-pluripotent cell is reprogrammed into a pluripotent cell using chemical compounds, the resulting cell is a chemically induced pluripotent stem cell.
[0045] Reprogramming medium as used herein refers to cell culture medium that includes one or more chemical inducers of pluripotency.
[0046] 2i medium as use herein refers to ESC culture medium with dual inhibition of glycogen synthase kinase-3 and mitogen-activated protein kinase signaling, for example, ESC culture medium supplemented with 2i (CHIR99021 and PD0325901).
[0047] The term small molecule refers to a molecule, such as an organic or organometallic compound, with a molecular weight of less than 2,000 Daltons, more preferably less than 1,500 Daltons, most preferably less than 1,000 Daltons.
[0048] XEN-like cells are used herein refers to cells which are characterized as epithelial cells, and which express XEN markers such as SALL4, GATA4 and SOX17. XEN-like state when used connection with cells refers to expression of one or more XEN markers.
II. Compositions
[0049] A. Small Molecules Inducing Pluripotency
[0050] Chemical compounds that induce pluripotency i.e., chemical inducers of pluripotency (CIP) include small molecules having a molecular weight of less than 2,000 Daltons, more preferably less than 1,500 Daltons, most preferably less than 1,000 Dalton, alone or in combination with proteins. The small molecules may have a molecular weight less than or equal to 900 Daltons or, less than or equal to 500 Daltons. Larger molecules can be used in chemically-induced reprogramming, preferably targeting the same pathway as the small molecules identified here. Several protein factors, such as recombinant bFGF, have been demonstrated to be effective in the following protocol for chemical reprogramming.
[0051] Accordingly, small molecule cocktails have been identified which can be used to enhance reprogramming of partially or completely differentiated cells (including cells that are not genetically engineered to express one or more markers of pluripotency such as Oct4, and which do not naturally express Oct4), into a XEN-like state and subsequently, into pluripotent cells. The required chemical inducers of pluripotency (CIPs) include (1) a glycogen synthase kinase (GSK) inhibitor, (2) a TGF? receptor inhibitor, (3) a cyclic AMP agonist, (4) a S-adenosylhomocysteine hydrolase (SAH) inhibitor, (5) a histone acetylator such as valproic acid (V), (6) a DOT1L methyltransferase inhibitor, (7) a retinoic acid receptor (RAR) agonist, (8) an epigenetic modulator, (9) an inhibitor of histone demethylation and combinations thereof. The CIPs may be provided separately or in combination as a CIP composition. One or more epigenetic modulators and retinoic acid receptor agonists, for example, retinoic receptor ligands may also be administered with the CIPs. In some preferred embodiments, the CIPs include DZNep as an SAH inhibitor.
[0052] (1). GSK Inhibitors
[0053] The preferred GSK inhibitor is the aminopyrimidine, CHIR99021 having the chemical name [6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile] (C), used in a concentration of about 20 ?M. Other GSK inhibitors can also be used in the methods disclosed herein, and they include, but are not limited to BIO-acetoxime (for example 1 ?M); GSK 31 inhibitor XV; SB-216763; CHIR 99021 trihydrochloride, which is the hydrochloride salt of CHIR99021; GSK-3 Inhibitor IX [((2Z, 3E)-6-bromo-3-(hydroxyimino)-[2,3-biindolinylidene]-2-one]; GSK 3 IX [6-Bromoindirubin-3-oxime]; GSK-3? Inhibitor XII [3-[[6-(3-Aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl]oxy]phenol]; GSK-3 Inhibitor XVI [6-(2-(4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)-pyrimidin-2-ylamino)ethyl-amino)-nicotinonitrile]; SB-415286 [3-[(3-chloro-4-hydroxyphenyl)amino]-4-(2-nitrophenyl)-1 H-pyrrole-2,5-dione]; and Bio [(27,3E)-6-bromoindirubin-3-oxime], used at a concentration equivalent to 20 ?M CHIR99021.
[0054] (2). TGF? Receptor Inhibitor
[0055] The TGF? inhibitor is preferably inhibits the TGF? type 1 receptor activating receptor-like kinase (ALK) 5 in some embodiments, and can additionally inhibit ALK 4 and the nodal type receptor 1 receptor ALK7 in other embodiments
[0056] The preferred TGF? receptor inhibitor is 616452. Other TGF? inhibitors are known in the art and are commercially available. Examples include E-616452 [2-(3-(6-Methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine]; A 83-01 [3-(6-Methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1-carbothioamide]; SB 505124 [2-[4-(1,3-Benzodioxol-5-yl)-2-(1,1-dimethylethyl)-1H-imidazol-5-yl]-6-methyl-pyridine]; GW 788388 [4-[4-[3-(2-Pyridinyl)-1H-pyrazol-4-yl]-2-pyridinyl]-N-(tetrahydro-2H-pyran-4-yl)-benzamide]; and SB 525334 [6-[2-(1,1-Dimethylethyl)-5-(6-methyl-2-pyridinyl)-1H-imidazol-4-yl]quinoxaline], and dorsomorphine.
[0057] (3) cAMP Agonists
[0058] The preferred cAMP agonist is Forskolin (F). However, any cAMP agonist can be included in the cocktail of CINPs disclosed herein. Examples include, but are not limited to prostaglandin E2 (PGE2), rolipram, genistein and cAMP analogs such as DBcAMP or 8-bromo-cAMP.
[0059] (4). SAH Inhibitors
[0060] The preferred SAH inhibitor is 3-deazaneplanocin A (DZNep; Z). Other useful SAH hydrolase inhibitors that can be included in the CIP combination compositions disclosed herein include, but are not limited to, (?) Neplanocin A (NepA), Adenozine periodate (oxidized) Adox and 3-deazaadenosine (DZA) and combinations thereof
[0061] (5). Histone Acetylator/Deacetylase Inhibitors
[0062] The preferred histone acetylator is valproic acid. However, other histone deacetylase inhibitors are commercially available and can be used. Non-limiting examples include apicidin, CI 994 (N-acetyldinaline 4-(Acetylamino)-N-(2-aminophenyl)benzamide), Depsipeptide, KD 5170 (S-[2-[6-[[[4-[3-(Dimethylamino)propoxy]phenyl]sulfonyl]amino]-3-pyridinyl]-2-oxoethyl]ethanethioc acid ester), sodium, 4-pehynl butyrate, sodium butyrate, UF 010, etc.
[0063] (6). DOT1L Methyltransferase Inhibitors
[0064] DOT1L methyltransferase inhibitors are preferred. Preferred examples include methyltransferase inhibitors include SGC 0946 (S) and EPZ004777 (E).
[0065] (7). Retinoic Acid Receptor (RAR) Agonists
[0066] Ch 55 ([4-[(1E)-3-[3,5-bis(1,1-Dimethylethyl)phenyl]-3-oxo-1-propenyl]benzoic acid], a highly potent synthetic retinoid that has high affinity for RAR-? and RAR-? receptors and low affinity for cellular retinoic acid binding protein (CRABP)]; AM580 ([4-[(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)carboxamido]benzoic acid]; an analog of retinoic acid that acts as a selective RAR? agonist); [4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid] (TTNPB).
[0067] Preferred RAR agonists include AM 580 (A) and Ch 55.
[0068] (8). Epigenetic Modulators
[0069] Epigenetic modulators that can be included in the CIP composition include one or more of 5-azacytidine, decitabine and RG108 and combinations thereof. A preferred epigenetic modulator is 5-azacytidine (D).
[0070] (9). Inhibitors of Histone Demethylation
[0071] A preferred inhibitor of histone demethylation is tranylcypromine (T). Tranylcypromine is a nonselective and irreversible monoamine oxidase inhibitor (MAOI). Another useful MAOI which are also inhibitors of histone demethylation include phenelzine (Lee, et al. Chem and Biol., 13:563-567 (2006), Additional non-limiting examples include compound XZ09 disclosed in Zhou, et al., Chem Biol. and Drug Design, 85(6):659-671 (2015) and nonpeptide propargylamines (Schmidttt, et al. J. Med. Chem., 56 (18), pp 7334-7342 (2013).
[0072] (10). Additional Small Molecule Boosters
[0073] In some embodiments, small molecules that facilitate late reprogramming and small molecules that improve/boost chemical reprogramming efficiency over the levels seen with VC6TFZ are included. Improved/boosted efficiency can be manifested by reducing the time needed to generate such pluripotent cells (e.g., by shortening the time to development of pluripotent cells by at least a day compared to a similar or same process without the small molecule). Alternatively, or in combination, a small molecule can increase the number of pluripotent cells generated by a particular process (e.g., increasing the number in a given time period by at least 10%, 50%, 100%, 200%, 500%, etc. compared to a similar or same process without the small molecule).
[0074] Small molecules that improve/boost chemical reprogramming efficiency include [N-(9,10-dioxo-9,10-dihydrophenanthren-2-yl)pivalamide] (SF1670); [N-(4-(Diethylaminobenzylidenyl)-N-(4-hydroxybenzoyl)-hydrazine] (DY131); [2-Cyclohexyl-6-methoxy-N-[1-(1-methylethyl)-4-piperidinyl]-7-[3-(1-pyrrolidinyl)propoxy]-4-quinazolinamine](UNC0638); [N-(2-(3-(piperazin-1-ylmethyl)imidazo[2,1-b]thiazol-6-yl)phenyl)quinoxaline-2-carboxamide hydrochloride] (SRT1720); 2-Me-5HT (2M5 2-methyl-5-hydroxytryptamine); and [3,7-Dihydro-1-methyl-3-(2-methylpropyl)-1H-purine-2,6-dioneand] (IBMX) and D4476 (D4476 (CAS 301836-43-1) (4-[4-(2,3-Dihydro-1,4-benzodioxin-6-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide), a high purity Casein kinase inhibitor and TGF-? type-I receptor (ALK5) inhibitor). An example of small molecule combinations used to reprogram cells is shown in Table 1A. Table 1A small molecule combination for inducing pluripotency
TABLE-US-00001 small molecule combination that can Initial cell CiPSC induce pluripotency numbers colony CHIR99021 + 616452 + Forskolin 100,000 1 CHIR99021 + 616452 + Forskolin + 50,000 3 DZNep CHIR99021 + 616452 + Forskolin + 40,000 8 DZNep + VPA CHIR99021 + 616452 + Forskolin + 28,000 42 DZNep + TTNPB CHIR99021 + 616452 + Forskolin + 90,000 1 DZNep + Tranylcypromine CHIR99021 + 616452 + Forskolin + 50,000 1 VPA + Tranylcypromine CHIR99021 + 616452 + DZNep + 300,000 1 VPA + Tranylcypromine CHIR99021 + 616452 + Forskolin + 20,000 2 DZNep + 4PB + Tranylcypromine CHIR99021 + 616452 + Forskolin + 40,000 12 DZNep + VPA + Tranylcypromine (VC6TFZ) CHIR99021 + 616452 + DBcAMP + 40,000 1 DZNep + VPA + Tranylcypromine CHIR99021 + 616452 + IBMX + 40,000 1 DZNep + VPA + Tranylcypromine CHIR99021 + 616452 + Rolipram + 40,000 1 DZNep + VPA + Tranylcypromine CHIR99021 + 616452 + Forskolin + 50,000 32 NepA + VPA + Tranylcypromine CHIR99021 + 616452 + Forskolin + 50,000 28 Adox + VPA + Tranylcypromine CHIR99021 + 616452 + Forskolin + 50,000 10 DZA + VPA + Tranylcypromine CHIR99021 + 616452 + Forskolin + 30,000 14 Decitabine + EPZ + VPA + Tranylcy- promine CHIR99021 + 616452 + Forskolin + 40,000 20 DZNep + VPA + Tranylcypromine + TTNPB CHIR99021 + 616452 + Forskolin + 40,000 25 DZNep + VPA + Tranylcypromine + AM580 CHIR99021 + 616452 + Forskolin + 40,000 19 DZNep + VPA + Tranylcypromine + Ch55 TD114-2 + 616452 + Forskolin + 40,000 40 DZNep + VPA + Tranylcypromine CHIR99021 + 616452 + Forskolin + 300,000 6 VPA + Tranylcypromine + 2M5 + D4476 + Butyrate + UNC0638 + Scriptaid CHIR99021 + 616452 + Forskolin + 250,000 5 VPA + Tranylcypromine + TTNPB + PGE2 + 5-aza-C CHIR99021 + 616452 + Forskolin + 250,000 8 VPA + Tranylcypromine + TTNPB + PGE2 + Decitabine CHIR99021 + 616452 + Forskolin + 30.000 14 VPA + Tranylcypromine + Decitabine + EPZ
[0075] Concentration ranges for exemplary small molecules that can be included in the formulations disclosed herein are provided in Table 1B.
Table 1B Summary of Small Molecule Concentrations
[0076]
TABLE-US-00002 preferred Chemical Concentration concentrations names ranges ?M CHIR99021 0.1-40 20 616452 0.1-50 10 *Forskolin 0.1-100 10 or 50 DZNep 0.005-0.5 0.05 VPA 50-2000 500 SGC 0946 2-10 5 TTNPB 0.01-5 2 Tranylcypromine 1-40 5 4PB 0.1-50 2 DBcAMP 0.1-500 50 IBMX 0.1-500 50 Rolipram 0.1-50 10 NepA 0.01-5 0.05 Adox 0.1-50 10 DZA 0.1-50 10 Decitabine 0.01-5 0.1 EPZ 0.1-20 5 AM580 0.01-5 0.05 Ch55 0.01-5 2 TD114-2 0.1-20 2 2M5 0.1-40 5 D4476 0.1-40 5 Butyrate 1-400 200 UNC0638 0.01-5 0.5 Scriptaid 0.01-5 0.5 PGE2 0.1-20 5 5-aza-C 0.01-50 5 RG108 0.01-100 10 SRT1720 0.1-20 2 *50 ?M Forskolin is preferred in a XEN-cocktail: 10 ?M forskolin if preferred in a XEN-XiPSC cocktail.
[0077] B. Protein Factors
[0078] Protein factors, such as recombinant basic fibroblast growth factor (bFGF), have been demonstrated to be effective in the following protocol for chemical reprogramming. bFGF can be used in a concentration range from 10 ng/mL-200 ng/mL, preferably at concentration of 100 ng/mL.
[0079] C. Cells to be Induced
[0080] The induced pluripotent stem cells are obtained by inducing partially or completely differentiated cells obtained from a mammal such as any mammal (e.g., bovine, ovine, porcine, canine, feline, equine, primate), preferably a human. Sources include bone marrow, fibroblasts, fetal tissue (e.g., fetal liver tissue), peripheral blood, umbilical cord blood, pancreas, skin or any organ or tissue. In a preferred embodiment, the CiPSCs are obtained from chemically induced fibroblasts, adipose-derived stem cells, neural stem cells or cells from the intestinal epithelium. In a more preferred embodiment, CiPSCs are obtained from chemically induced neonatal (for example foreskin) or adult fibroblasts. However, CiPSCs can be obtained from other cell types including but not limited to: multipotent stem cells, cells of hematological origin, cells of embryonic origin, skin derived cells, fibroblasts, adipose cells, epithelial cells, endothelial cells, mesenchymal cells, parenchymal cells, neurological cells, and connective tissue cells. multipotent stem cells, cells of hematological origin, cells of embryonic origin, skin derived cells, fibroblasts, adipose cells, epithelial cells, endothelial cells, mesenchymal cells, parenchymal cells, neurological cells, and connective tissue cells. The cell to be reprogrammed can be obtained from a sample obtained from a mammalian subject. The subject can be any mammal (e.g., bovine, ovine, porcine, canine, feline, equine, primate), including a human. The sample of cells may be obtained from any of a number of different sources including, for example, bone marrow, fetal tissue (e.g., fetal liver tissue), peripheral blood, umbilical cord blood, pancreas, skin or any organ or tissue.
[0081] In a preferred embodiment, the CiPSCs are obtained from fibroblasts and adipose-derived stem cells. In a more preferred embodiment, CiPSCs are obtained from fibroblast, which can be neonatal (for example foreskin fibroblasts) or adult fibroblast. In still another preferred embodiment, the non-pluripotent cells do not express Oct4 and/or are not genetically engineered to express one or more markers of pluripotency.
[0082] Cells may be isolated by disaggregating an appropriate organ or tissue which is to serve as the cell source using techniques known to those skilled in the art. For example, the tissue or organ can be disaggregated mechanically and/or treated with digestive enzymes and/or chelating agents that weaken the connections between neighboring cells, so that the tissue can be dispersed to form a suspension of individual cells without appreciable cell breakage. Enzymatic dissociation can be accomplished by mincing the tissue and treating the minced tissue with one or more enzymes such as trypsin, chymotrypsin, collagenase, elastase, and/or hyaluronidase, DNase, pronase, dispase etc. Mechanical disruption can also be accomplished by a number of methods including, but not limited to, the use of grinders, blenders, sieves, homogenizers, pressure cells, or insonators.
[0083] D. Chemically Induced Pluripotent Stem Cells (CiPSCs)
[0084] CiPSCs are physiologically and morphologically indistinguishable from Embryonic Stem Cells (ESC). The Examples show that CiPSCs grow with a doubling time similar to ESC, and like ESC, express pluripotency markers, have a similar gene expression profile to ESC, and have a similar DNA methylation and histone modifications at Oct4 and Nanog promoters. Karyotyping analysis also demonstrates that CiPSCs do not acquire chromosomal abnormalities. Further evidence that the CiPSCs are pluripotent is their ability to differentiate into tissues of the three embryonic germ layers. These findings demonstrate the ability to manipulate differentiated human cells to generate an unlimited supply of patient-specific pluripotent stem cells.
[0085] CiPSCs possess ESC-like properties such as ESC morphology, doubling time similar to ESC, expression of ESC markers such as alkaline phosphatase (AP), nanog, Rex1, Sox2, Dax1, Sall4, undifferentiated embryonic cell transcription factor (Utf1), stage specific embryonic antigen-4 (SSEA-4), and the ability of the cell to differentiate into tissues of the three embryonic germ layers. Such cells can also be characterized by the down-regulation of markers characteristic of the differentiated cell from which the CiPSC is induced. For example, CiPSCs derived from fibroblasts may be characterized by down-regulation of the fibroblast cell marker Thy1 and/or up-regulation of SSEA-1. There is no minimum number of pluripotency markers that must be displayed on CiPSCs. The gold standard for pluripotency is the differentiation potential into cell types of all three germ layers. Teratoma assay, chimeras assay and the germ-line transmission capability are some direct assays to test their differentiation potential.
III. Methods of Making
[0086] A. Induction of CiPSCs
[0087] CiPSCs can be induced by providing partially or completely differentiated cells in a culture media containing the CIPs for a sufficient period of time to result in reprogramming the cells into chemically induced pluripotent stem cell (CiPSC). The reprogrammed cells are defined as pluripotent cells based on possession of ESC-like properties such as morphology, doubling time, expression of ESC markers for example alkaline phosphatase (AP); nanog, Rex1; Sox2; Dax1; Sall4; undifferentiated embryonic cell transcription factor (Utf1); stage specific embryonic antigen-4 (SSEA-4), and the ability of the cell to differentiate into tissues of the three embryonic germ layers.
[0088] The CIP compounds are contacted with the cells to be induced in an amount effective to induce and/or enhance reprogramming of non-pluripotent cells into pluripotent cells. One of skill in the art can readily determine the concentrations of the CIP compounds disclosed herein required to provide complete reprogramming using methods outlined in the examples below, or other methods known in the art. In some preferred embodiments, the CIPs include an SAH inhibitor.
[0089] VPA is administered to the cells to a concentration between 500 ?M and 0.5 mM, CHIR is administered to a concentration between 10 to 20 ?M preferably, 20 ?M, 616452 is administered to a concentration between 5 to 10 ?M, FSK is administered to a concentration between 10 to 50 ?M and DZNep is administered to a concentration between 20 nM and 0.1 ?M, preferably, between 0.05 to 0.1 ?M, and more preferably, between 20 and 200 nM. Exemplary combinations of small molecules that can be used to induce pluripotency in a non-pluripotent cell and concentration ranges are provided in Tables 1A and B.
[0090] 616452 and Forskolin need to be present the entire time before the use of 2i-medium. CHIR99021 should be used in the first 12 days, and is preferably present the entire time before the use of 2i-medium. DZNep should be added at the late stage of reprogramming (day 12 to day 40), preferably, day 16 after the initial treatment of other small molecules. The small molecule combination should be changed into 2i-medium after a time point between day 26 and day 48, preferably day 28. Different cell types have different optimal concentrations of small molecules. These can be determined by routine experimentation based on the studies described herein. The order of exposure and the period of time of exposure are similar between cell types.
[0091] In a preferred embodiment, the method includes culturing cells in a reprogramming medium containing the CIPs, and further culturing the cells in an ESC culture medium for more than 4 days with dual inhibition of glycogen synthase kinase-3 (GSK3) and mitogen-activated protein kinase (MAPK) signaling after about day 28 post treatment with the reprogramming medium. In one embodiment, dual inhibition of GSK3 and MAPK is accomplished using CHIR99021 and PD0325901.
[0092] In some embodiments, the method further includes contacting the cells with additional small molecules that facilitate late reprogramming for example, cAMP agonists other than forskolin and/or epigenetic modulators disclosed herein, and/or small molecules that improve/boost chemical reprogramming efficiency disclosed herein. Epigenetic modulators can be included in the composition containing VC6TF. Alternatively, these small molecules can be included in cell culture medium following treatment of the cells with VC6TF. The cells are preferably exposed to the small molecules for more than 1 day. In some embodiments, treatment of cells with cAMP agonists and epigenetic modulators does not exceed the period of treatment with VC6TF. In other embodiments treatment of cells with cAMP agonists and epigenetic modulators does not exceed the period of treatment with VC6TFZ. In still other embodiments, treatment of cells with cAMP agonists and epigenetic modulators does not exceed the period of treatment with VC6TF plus VC6TFZ. A preferred small molecule for boosting chemical reprogramming efficiency is TTNPB.
[0093] The disclosed methods yield induced pluripotent stem cells without the need to transfect cells with genes such as Oct4, KLF4, SOX2, C-Myc or NANOG or the need to contact the cells with any of the KLF, Oct, Myc and/or Sox polypeptide.
[0094] B. Induction of CiPSCs Via Specific Selection of Conditions for XEN-Like State Bias
[0095] Reprogramming non-pluripotent cells via a XEN-like state bias includes the steps of (a) contacting the cell to be reprogrammed with a first cocktail of CIPs (XEN-cocktail) for a sufficient period of time to bias the cells into a XEN-like state, thus generating a subpopulation XEN-like cells; (b) contacting the population of XEN-like cells for a sufficient period of time to reprogram the cells into a chemically induced pluripotent stem cell (CiPSC) with a second cocktail of CIPS (XEN-CiPSC cocktail) and (c) culturing the cells in 2i-medium. The cells are preferably replated during step (a) at a density of about 50,000-100,000 cells per well in a 6-well plate.
[0096] In a preferred embodiment, cells to be reprogrammed are cultured initially in a reprogramming medium containing the CIPs for a total period preferably between 26-30 days. The cells are then cultured in 2i-medium for more than 4 days. The cells are cultured in 2i-medium from preferably, between 10-14 days (
[0097] Inducing CiPSCs via XEN-like state bias increases the efficiency of reprogramming. For example, the number of colonies obtained cells to be programmed are first biased towards a XEN-LIKE state from the same starting cell population is increased and/or the length of time it takes to obtain the same number of colonies is reduced when compared to a chemical reprogramming method that does not selectively bias the cells to be programming towards a XEN-like state.
[0098] C. Isolation of CiPSCs
[0099] Media that can maintain the undifferentiated state and pluripotency of ES cells or induce differentiation are known in this field. Differentiation and proliferation abilities of isolated induced pluripotent stem cells can be easily confirmed by those skilled in the art by using confirmation means widely applied to ES cells.
[0100] A substantially purified population of CiPSCs can be obtained, for example, by extraction (e.g., via density gradient centrifugation and/or flow cytometry) from a culture source. Purity can be measured by any appropriate method. The pluripotent cells can be 99%-100% purified by, for example, flow cytometry (e.g., FACS analysis). Human induced pluripotent stem cells can be isolated by, for example, utilizing molecules (e.g., antibodies, antibody derivatives, ligands or Fc-peptide fusion molecules) that bind to a marker (e.g., a TRA-1-81, a TRA-1-61 or a combination of markers) on the induced pluripotent stem cells and thereby positively selecting cells that bind the molecule (i.e., a positive selection). Other examples of positive selection methods include methods of preferentially promoting the growth of a desired cell type in a mixed population of desired and undesired cell types. Alternatively, by using molecules that bind to markers that are not present on the desired cell type, but that are present on an undesired cell type, the undesired cells containing such markers can be removed from the desired cells (i.e., a negative selection). Other negative selection methods include preferentially killing or inhibiting the growth of an undesired cell type in a mixed population of desired and undesired cell types. Accordingly, by using negative selection, positive selection, or a combination thereof, an enriched population of stem cell can be made.
[0101] Procedures for separation may include magnetic separation, using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents joined to a monoclonal antibody, or such agents used in conjunction with a monoclonal antibody, e.g., complement and cytotoxins, and panning with antibody attached to a solid matrix (e.g., plate), or other convenient technique. Techniques providing accurate separation include fluorescence activated cell sorters, which can have varying degrees of sophistication, e.g., a plurality of color channels, low angle and obtuse light scattering detecting channels, and impedance channels. Antibodies may be conjugated with markers, such as magnetic beads, which allow for direct separation, biotin, which can be removed with avidin or streptavidin bound to a support, or fluorochromes, which can be used with a fluorescence activated cell sorter, to allow for ease of separation of the particular cell type. Any technique may be employed which is not unduly detrimental to the viability of the induced pluripotent stem cells. In one embodiment, the cells are incubated with an antibody against a marker (e.g., a TRA-1-81 antibody) and the cells that stain positive for the marker are manually selected and subcultured.
[0102] Combinations of enrichment methods may be used to improve the time or efficiency of purification or enrichment. For example, after an enrichment step to remove cells having markers that are not indicative of the cell type of interest, the cells may be further separated or enriched by a fluorescence activated cell sorter (FACS) or other methodology having high specificity. Multi-color analyses may be employed with a FACS. The cells may be separated on the basis of the level of staining for a particular antigen or lack thereof. Fluorochromes may be used to label antibodies specific for a particular antigen. Such fluorochromes include phycobiliproteins, e.g., phycoerythrin and allophycocyanins, fluorescein, and Texas red.
[0103] Any cell type-specific markers can be used to select for or against a particular cell type. Induced stem cell markers useful for enrichment comprise expressed markers such as TRA-1-81 and loss of markers (e.g., GFP) associated with a retroviral vector or other exogenous vector.
[0104] C. Culture and Preservation of CiPSCs (and their Progeny)
[0105] The CiPSCs can be expanded in culture and stored for later retrieval and use. Once a culture of cells or a mixed culture of stem cells is established, the population of cells is mitotically expanded in vitro by passage to fresh medium as cell density dictates under conditions conducive to cell proliferation, with or without tissue formation. Such culturing methods can include, for example, passaging the cells in culture medium lacking particular growth factors that induce differentiation (e.g., IGF, EGF, FGF, VEGF, and/or other growth factor). Cultured cells can be transferred to fresh medium when sufficient cell density is reached. Some stem cell types do not demonstrate typical contact inhibition-apoptosis or they become quiescent when density is maximum. Accordingly, appropriate passaging techniques can be used to reduce contact inhibition and quiescence.
[0106] Cells can be cryopreserved for storage according to known methods, such as those described in Doyle et al., (eds.), 1995, Cell & Tissue Culture: Laboratory Procedures, John Wiley & Sons, Chichester. For example, cells may be suspended in a freeze medium such as culture medium containing 15-20% fetal bovine serum (FBS) and 10% dimethylsulfoxide (DMSO), with or without 5-10% glycerol, at a density, for example, of about 4-10?10.sup.6 cells/ml. The cells are dispensed into glass or plastic vials which are then sealed and transferred to a freezing chamber of a programmable or passive freezer. The optimal rate of freezing may be determined empirically. For example, a freezing program that gives a change in temperature of ?1? C./min through the heat of fusion may be used. Once vials containing the cells have reached ?80? C., they are transferred to a liquid nitrogen storage area. Cryopreserved cells can be stored for a period of years.
IV. Methods of Use
[0107] Identification of a readily available source of stem cells that can give rise to a desired cell type or morphology is important for therapeutic treatments, tissue engineering and research. The availability of stem cells would be extremely useful in transplantation, tissue engineering, regulation of angiogenesis, vasculogenesis, and cell replacement or cell therapies as well as the prevention of certain diseases. Such stem cells can also be used to introduce a gene into a subject as part of a gene therapy regimen.
[0108] A. Providing Differentiated Somatic Cells (Re-Differentiated Cells)
[0109] Once established, a culture of stem cells may be used to produce progeny cells, for example, fibroblasts capable of producing new tissue. The CiPSCs can be induced to differentiate into cells from any of the three germ layers, for example, skin and hair cells including epithelial cells, keratinocytes, melanocytes, adipocytes, cells forming bone, muscle and connective tissue such as myocytes, chondrocytes, osteocytes, alveolar cells, parenchymal cells such as hepatocytes, renal cells, adrenal cells, and islet cells, blood cells, retinal cells (and other cells involved in sensory perception, such as those that form hair cells in the ear or taste buds on the tongue), and nervous tissue including nerves.
[0110] In one embodiment, the CiPSCs are induced to differentiate into cells of ectodermal origin by exposing the cells to an ectodermal differentiating media. In another embodiment the CiPSCs are induced to differentiate into cells of mesodermal origin by exposing the cells to mesodermal differentiating media. In still another embodiment, the CiPSCs are induced to differentiate into cells of endodermal origin by exposing the cells to endodermal media. Components of endodermal, mesodermal and ectodermal media are known to one of skill in the art. Known cell surface markers can be used to verify that the cells are indeed differentiating into cells of the lineage of the corresponding cell culture medium. The most commonly accepted markers to confirm differentiation of the three germ layers are the expression of alpha fetal protein for endodermal cells, alpha smooth muscle actin for mesoderm, and Beta-III tubulin for ectoderm, all of which are normally expressed very early in the development of these tissues.
[0111] Differentiation of stem cells to fibroblasts or other cell types, followed by the production of tissue therefrom, can be triggered by specific exogenous growth factors or by changing the culture conditions (e.g., the density) of a stem cell culture. Methods for inducing differentiation of cells into a cell of a desired cell type are known in the art. For example, CiPSCs can be induced to differentiate by adding a substance (e.g., a growth factor, enzyme, hormone, or other signaling molecule) to the cell's environment. Examples of factors that can be used to induce differentiation include erythropoietin, colony stimulating factors, e.g., GM-CSF, G-CSF, or M-CSF, interleukins, e.g., IL-1, -2, -3, -4, -5, -6, -7, -8, Leukemia Inhibitory Factory (LIF), or Steel Factor (Stl), coculture with tissue committed cells, or other lineage committed cells types to induce the stem cells into becoming committed to a particular lineage.
[0112] The redifferentiated cells can be can be expanded in culture and stored for later retrieval and use.
[0113] B. Cell Therapy
[0114] Therapeutic uses of the induced pluripotent stem cells include transplanting the induced pluripotent stem cells, stem cell populations, or progeny thereof into individuals to treat a variety of pathological states including diseases and disorders resulting from cancers, wounds, neoplasms, injury, viral infections, diabetes and the like. Treatment may entail the use of the cells to produce new tissue, and the use of the tissue thus produced, according to any method presently known in the art or to be developed in the future. The cells may be implanted, injected or otherwise administered directly to the site of tissue damage so that they will produce new tissue in vivo. In one embodiment, administration includes the administration of genetically modified CiPSCs or their progeny.
[0115] In a preferred embodiment, the CiPSCs are obtained from autologous cells i.e., the donor cells are autologous. However, the cells can be obtained from heterologous cells. In one embodiment, the donor cells are obtained from a donor genetically related to the recipient. In another embodiment, donor cells are obtained from a donor genetically un-related to the recipient.
[0116] If the human CiPSCs are derived from a heterologous (non-autologous/allogenic) source compared to the recipient subject, concomitant immunosuppression therapy is typically administered, e.g., administration of the immunosuppressive agent cyclosporine or FK506. However, due to the immature state of the human induced pluripotent stem cells such immunosuppressive therapy may not be required. Accordingly, in one embodiment, the human induced pluripotent stem cells can be administered to a recipient in the absence of immunomodulatory (e.g., immunsuppressive) therapy. Alternatively, the cells can be encapsulated in a membrane, which permits exchange of fluids but prevents cell/cell contact. Transplantation of microencapsulated cells is known in the art, e.g., Balladur et al., Surgery, 117:189-94, 1995; and Dixit et al., Cell Transplantation 1:275-79 (1992).
[0117] (i) Diabetes
[0118] Diabetes mellitus (DM) is a group of metabolic diseases where the subject has high blood sugar, either because the pancreas does not produce enough insulin, or, because cells do not respond to insulin that is produced.
[0119] A promising replacement for insulin therapy is provision of islet cells to the patient in need of insulin. Shapiro et al., N Engl J Med., 343(4):230-8 (2000) have demonstrated that transplantation of beta cells/islets provides therapy for patients with diabetes. Although numerous insulin types are commercially available, these formulations are provided as injectables. The human induced pluripotent stem cells provide an alternative source of islet cells to prevent or treat diabetes. For example, induced pluripotent stem cells can be isolated and differentiated to a pancreatic cell type and delivered to a subject. Alternatively, the induced pluripotent stem cells can be delivered to the pancreas of the subject and differentiated to islet cells in vivo. Accordingly, the cells are useful for transplantation in order to prevent or treat the occurrence of diabetes. Methods for reducing inflammation after cytokine exposure without affecting the viability and potency of pancreatic islet cells are disclosed for example in U.S. Pat. No. 8,637,494 to Naziruddin, et al.
[0120] (ii) Neurodegenerative Disorders
[0121] Neurodegenerative disorders are characterized by conditions involving the deterioration of neurons as a result of disease, hereditary conditions or injury, such as traumatic or ischemic spinal cord or brain injury. Neurodegenerative conditions include any disease or disorder or symptoms or causes or effects thereof involving the damage or deterioration of neurons. Neurodegenerative conditions can include, but are not limited to, Alexander Disease, Alper's Disease, Alzheimer Disease, Amyotrophic Lateral Sclerosis, Ataxia Telangiectasia, Canavan Disease, Cockayne Syndrome, Corticobasal Degeneration, Creutzfeldt-Jakob Disease, Huntington Disease, Kennedy's Disease, Krabbe Disease, Lewy Body Dementia, Machado-Joseph Disease, Multiple Sclerosis, Parkinson Disease, Pelizaeus-Merzbacher Disease, Niemann-Pick's Disease, Primary Lateral Sclerosis, Refsum's Disease, Sandhoff Disease, Schilder's Disease, Steele-Richardson-Olszewski Disease, Tabes Dorsalis or any other condition associated with damaged neurons. Other neurodegenerative conditions can include or be caused by traumatic spinal cord injury, ischemic spinal cord injury, stroke, traumatic brain injury, and hereditary conditions.
[0122] In particular, the disclosed methods include transplanting into a subject in need thereof NSCs, neural progenitors, or neural precursors that have been expanded in vitro such that the cells can ameliorate the neurodegenerative condition. Transplantation of the expanded neural stem cells can be used to improve ambulatory function in a subject suffering from various forms of myelopathy with symptoms of spasticity, rigidity, seizures, paralysis or any other hyperactivity of muscles. Methods for expanding and transplanting neural cells and neural progenitor cells for the treatment of different neurodegenerative conditions is disclosed for example, in U.S. Pat. No. 8,236,299 to Johe, et. al.
[0123] (iii) Cancer Therapy
[0124] Therapeutic uses of the CiPSCs and their progeny include transplanting the induced pluripotent stem cells, stem cell populations, or progeny thereof into individuals to treat and/or ameliorate the symptoms associated with cancer. For example, in one embodiment, the CiPSCs can be administered to cancer patients who have undergone chemotherapy that has killed, reduced, or damaged cells of a subject. In a typical stem cell transplant for cancer, very high doses of chemotherapy are used, often along with radiation therapy, to try to destroy all the cancer cells. This treatment also kills the stem cells in the bone marrow. Soon after treatment, stem cells are given to replace those that were destroyed.
[0125] In another embodiment, the CiPSCs can be transfected or transformed (in addition to the de-differentiation factors) with at least one additional therapeutic factor. For example, once CiPSCs are isolated, the cells may be transformed with a polynucleotide encoding a therapeutic polypeptide and then implanted or administered to a subject, or may be differentiated to a desired cell type and implanted and delivered to the subject. Under such conditions the polynucleotide is expressed within the subject for delivery of the polypeptide product.
[0126] (iii) Tissue Engineering
[0127] CiPSCs and their progeny can be used to make tissue engineered constructions, using methods known in the art. Tissue engineered constructs may be used for a variety of purposes including as prosthetic devices for the repair or replacement of damaged organs or tissues. They may also serve as in vivo delivery systems for proteins or other molecules secreted by the cells of the construct or as drug delivery systems in general, Tissue engineered constructs also find use as in vitro models of tissue function or as models for testing the effects of various treatments or pharmaceuticals. The most commonly used biomaterial scaffolds for transplantation of stem cells are reviewed in the most commonly used biomaterial scaffolds for transplantation of stem cells is reviewed in Willerth, S. M. and Sakiyama-Elbert, S. E., Combining stem cells and biomaterial scaffolds for constructing tissues and cell delivery (Jul. 9, 2008), StemBook, ed. The Stem Cell Research Community, StemBook. Tissue engineering technology frequently involves selection of an appropriate culture substrate to sustain and promote tissue growth. In general, these substrates should be three-dimensional and should be processable to form scaffolds of a desired shape for the tissue of interest.
[0128] U.S. Pat. No. 6,962,814 generally discloses method for producing tissue engineered constructs and engineered native tissue. With respect to specific examples, U.S. Pat. No. 7,914,579 to Vacanti, et al., discloses tissue engineered ligaments and tendons. U.S. Pat. No. 5,716,404 discloses methods and compositions for reconstruction or augmentation of breast tissue using dissociated muscle cells implanted in combination with a polymeric matrix. U.S. Pat. No. 8,728,495 discloses repair of cartilage using autologous dermal fibroblasts. U.S. Published application No. 20090029322 by Duailibi, et al., discloses the use of stem cells to form dental tissue for use in making tooth substitute. U.S. Published application No. 2006/0019326 discloses cell-seed tissue-engineered polymers for treatment of intracranial aneurysms. U.S. Published application No. 2007/0059293 by Atala discloses the tissue-engineered constructs (and method for making such constructs) that can be used to replace damaged organs for example kidney, heart, liver, spleen, pancreas, bladder, ureter and urethra.
[0129] (ii) Cells Produced from CiPSCs (Progeny)
[0130] The CiPSCs can be induced to differentiate into cells from any of the three germ layers, for example, skin and hair cells including epithelial cells, keratinocytes, melanocytes, adipocytes, cells forming bone, muscle and connective tissue such as myocytes, chondrocytes, osteocytes, alveolar cells, parenchymal cells such as hepatocytes, renal cells, adrenal cells, and islet cells (e.g., alpha cells, delta cells, PP cells, and beta cells), blood cells (e.g., leukocytes, erythrocytes, macrophages, and lymphocytes), retinal cells (and other cells involved in sensory perception, such as those that form hair cells in the ear or taste buds on the tongue), and nervous tissue including nerves.
[0131] (iii) Therapeutic Compositions
[0132] The CiPSCs can be formulated for administration, delivery or contacting with a subject, tissue or cell to promote de-differentiation in vivo or in vitro/ex vivo. Additional factors, such as growth factors, other factors that induce differentiation or dedifferentiation, secretion products, immunomodulators, anti-inflammatory agents, regression factors, biologically active compounds that promote innervation, vascularization or enhance the lymphatic network, and drugs, can be incorporated.
[0133] The induced pluripotent cells can be administered to a patient by way of a composition that includes a population of CiPSCs or CiPSC progeny alone or on or in a carrier or support structure. In many embodiments, no carrier will be required. The cells can be administered by injection onto or into the site where the cells are required. In these cases, the cells will typically have been washed to remove cell culture media and will be suspended in a physiological buffer.
[0134] In other embodiments, the cells are provided with or incorporated onto or into a support structure. Support structures may be meshes, solid supports, scaffolds, tubes, porous structures, and/or a hydrogel. The support structures may be biodegradable or non-biodegradable, in whole or in part. The support may be formed of a natural or synthetic polymer, metal such as titanium, bone or hydroxyapatite, or a ceramic. Natural polymers include collagen, hyaluronic acid, polysaccharides, and glycosaminoglycans. Synthetic polymers include polyhydroxyacids such as polylactic acid, polyglycolic acid, and copolymers thereof, polyhydroxyalkanoates such as polyhydroxybutyrate, polyorthoesters, polyanhydrides, polyurethanes, polycarbonates, and polyesters. These may be in for the form of implants, tubes, meshes, or hydrogels.
[0135] Solid Supports
[0136] The support structure may be a loose woven or non-woven mesh, where the cells are seeded in and onto the mesh. The structure may include solid structural supports. The support may be a tube, for example, a neural tube for regrowth of neural axons. The support may be a stent or valve. The support may be a joint prosthetic such as a knee or hip, or part thereof, that has a porous interface allowing ingrowth of cells and/or seeding of cells into the porous structure. Many other types of support structures are also possible. For example, the support structure can be formed from sponges, foams, corals, or biocompatible inorganic structures having internal pores, or mesh sheets of interwoven polymer fibers. These support structures can be prepared using known methods.
[0137] The support structure may be a permeable structure having pore-like cavities or interstices that shape and support the hydrogel-cell mixture. For example, the support structure can be a porous polymer mesh, a natural or synthetic sponge, or a support structure formed of metal or a material such as bone or hydroxyapatite. The porosity of the support structure should be such that nutrients can diffuse into the structure, thereby effectively reaching the cells inside, and waste products produced by the cells can diffuse out of the structure
[0138] The support structure can be shaped to conform to the space in which new tissue is desired. For example, the support structure can be shaped to conform to the shape of an area of the skin that has been burned or the portion of cartilage or bone that has been lost. Depending on the material from which it is made, the support structure can be shaped by cutting, molding, casting, or any other method that produces a desired shape. The support can be shaped either before or after the support structure is seeded with cells or is filled with a hydrogel-cell mixture, as described below.
[0139] An example of a suitable polymer is polyglactin, which is a 90:10 copolymer of glycolide and lactide, and is manufactured as VICRYL? braided absorbable suture (Ethicon Co., Somerville, N.J.). Polymer fibers (such as VICRYL?), can be woven or compressed into a felt-like polymer sheet, which can then be cut into any desired shape. Alternatively, the polymer fibers can be compressed together in a mold that casts them into the shape desired for the support structure. In some cases, additional polymer can be added to the polymer fibers as they are molded to revise or impart additional structure to the fiber mesh. For example, a polylactic acid solution can be added to this sheet of polyglycolic fiber mesh, and the combination can be molded together to form a porous support structure. The polylactic acid binds the crosslinks of the polyglycolic acid fibers, thereby coating these individual fibers and fixing the shape of the molded fibers. The polylactic acid also fills in the spaces between the fibers. Thus, porosity can be varied according to the amount of polylactic acid introduced into the support. The pressure required to mold the fiber mesh into a desirable shape can be quite moderate. All that is required is that the fibers are held in place long enough for the binding and coating action of polylactic acid to take effect.
[0140] Alternatively, or in addition, the support structure can include other types of polymer fibers or polymer structures produced by techniques known in the art. For example, thin polymer films can be obtained by evaporating solvent from a polymer solution. These films can be cast into a desired shaped if the polymer solution is evaporated from a mold having the relief pattern of the desired shape. Polymer gels can also be molded into thin, permeable polymer structures using compression molding techniques known in the art.
[0141] Hydrogels
[0142] In another embodiment, the cells are mixed with a hydrogel to form a cell-hydrogel mixture. Hydrogels may be administered by injection or catheter, or at the time of implantation of other support structures. Crosslinking may occur prior to, during, or after administration.
V. Kits
[0143] Kits are provided which include the chemical inducers of pluripotency (CIP) disclosed herein. The CIPs are as described above. These may be in a form having defined concentrations to facilitate addition to cell culture media to produce a desired concentration. The kit may include directions providing desired concentration ranges and times of administration based on the types of cells to be induced. The kit may also include cell culture media which is pre-mixed with the CIPs for culture of cells to induce pluripotency.
[0144] The present invention will be further understood by reference to the following non-limiting examples.
Examples
Materials and Methods
[0145] Mice
[0146] The mouse strains C57BL/6 J-Tg(GOFGFP)11Imeg/Rbrc (OG), C57BL/6NCrlVr (C57), ICR and 129S2/SvPasCrlVr (129) were purchased as described by Li, Cell Res., 21:196-204 (2011). The OG mice were mated with other strains to generate offspring carrying Oct4 promoter-driven GFP. Mouse strains including ICR, C57?129, OG?ICR, OG?129 and OG?C57 were used to isolate primary mouse embryonic fibroblasts (MEFs), mouse neonatal fibroblasts (MNFs), mouse adult fibroblasts (MAFs) and adipose-derived stem cells (ADSCs). These cells were used for CiPSC induction. The neonatal mice used were 2-3 days old and the adult mice used were 7 weeks old. The Tet-On POU5F1 mouse strain B6;129t(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm2(tetO-Pou5f1)Jae/J was purchased from Jackson Laboratory (Hochedlinger, et al., Cell, 121:465-477 (2005)) and used only for reprogramming with Oct4 plus VC6 T. Animal experiments were performed according to the Animal Protection Guidelines of Peking University, China.
[0147] Cell Culture
[0148] Primary MEFs were isolated as described by Takahashi, et al., Cell, 126:663-676 (2006)), with careful attention to the removal of the genital ridges. MNFs from skin, MAFs from lungs and ADSCs from inguinal fat pads were isolated as described by Lichti, et al., Nat. Protoc. 3:799-810 (2008); Seluanov, et al., J. Vis. Exp. 2010:2033 (2010); Tat, et al., Cell Transplant. 19:525-536 (2010) and McQualter, et al., Stem Cells, 27:623-633 (2009).
[0149] MEFs, MNFs, MAFs and ADSCs were cultured in DMEM/High Glucose (Hyclone) containing 10% fetal bovine serum (Hyclone). The cells used in reprogramming were from passages 1 to 5.
[0150] Mouse ESCs (R1 and TT2), iPSCs and CiPSCs were maintained on feeder layers of mitomycin C-treated MEFs in ESC culture medium (KnockOut DMEM (Invitrogen) containing 10% knockout serum replacement (Invitrogen), 10% fetal bovine serum (Hyclone), 2 mM GlutaMAX?-I (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM 2-mercaptoethanol (Invitrogen), 1% penicillin-streptomycin (Invitrogen) and 1,000 U/ml leukemia inhibitory factor (LIF, Millipore)) or 2i-medium (ESC culture medium supplemented with 2i (3 ?M CHIR99021 and 1 ?M PD0325901)). The medium was changed daily. ESCs, iPSCs and CiPSCs were passaged by trypsin-EDTA (Invitrogen). For CiPSC induction, LIF-free ESC culture medium supplemented with 20-100 ng/ml bFGF (Origene) was used as the chemical reprogramming medium.
[0151] Fetal small intestinal epithelial cells were isolated from mouse embryonic small intestine at embryonic 13.5 day as previously described (Li et al, 2011), and cultured in Knockout? DMEM (Invitrogen), supplemented with 10% fetal bovine serum (FBS; Pan-Biotech), 10% knockout serum replacement (KSR), 1% non-essential amino acids (NEAA), 2 mM GlutaMAX?-I (GlutaMAX), 10 U penicillin-streptomycin (PS), and 55 ?M ?-Mercaptoethanol (?-me) (all from Invitrogen).
[0152] Fetal neural stem cells (NSCs) were isolated from mouse forebrain at embryonic day 13.5 as previously described (Fischer et al., 2011), and postnatal NSCs were isolated from the subventricular zone of the postnatal mouse brain (Fischer et al., 2011: Guo et al., 2012). NSCs were cultured in NSC culture medium (DMEM/F-12 (1:1), DF12) containing N2 and B27 supplements, 1% NEAA, 2 mM GlutaMAX, 10 U PS, 55 ?M ?-me (all from Invitrogen), 25 ng/mL basic fibroblast growth factor (bFGF) (Origene), and 20 ng/mL epidermal growth factor (EGF) (R&D)), and passaged by accutase (Millipore) every 4-5 days. NSCs were single-cell suspended and formed neurospheres for 2-3 days.
[0153] Mouse ESCs (R1) were maintained on feeder layers of mitomycin C-treated MEFs in 2i-medium plus LIF (Knockout? DMEM containing 10% KSR, 10% FBS, 2 mM GlutaMAX, 1% NEAA, 55 ?M ?-me, 10 U PS (all from Invitrogen), 3 ?M CHIR99021 (CHIR), 1 ?M PD0325901 (PD03) and 10 ng/mL mouse leukemia inhibitory factor (mLIF; Millipore)). The medium was changed daily. ESCs and CiPSCs were passaged by trypsin-EDTA (Invitrogen).
[0154] For CiPSC induction, ESC culture medium without CHIR, PD03 and LIF supplemented with bFGF and Vc was used as chemical reprogramming medium. At the 2i-medium stage, the basal culture medium was DMEM/F12 plus N2 and B27 supplements (N2B27-2iL medium).
[0155] XEN Cell Derivation and Culture
[0156] Traditional eXEN (embryo-derived XEN) cell lines (gift from Dr. Rossant's laboratory) were cultured as previously described (Kunath et al., 2005). Briefly, eXEN cells were seeded on MEF feeders with RPMI1640 (Invitrogen) containing 20% fetal bovine serum, 2 mM GlutaMAX?-I (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM 2-mercaptoethanol (Invitrogen), 1% penicillin-streptomycin (Invitrogen), and 1% sodium pyruvate (Invitrogen; RPMI medium). For most experiments, eXEN cells were cultured in a feeder-free system, on gelatin (0.1% porcine skin gelatin, Sigma)-coated plates supplemented with 70% MEF-conditioned medium (RPMI-CM). Alternatively, eXEN could be cultured long-term in stage 1 medium (with VC6TFAE or VC6TF; with 20 ng/ml bFGF) on gelatin-coated plates (eXEN in VC6TF). Cells were routinely fed every 2 days and passaged at 1:20 to 1:30 every 3 days. eXEN were also derived directly from E3.5 blastocysts using stage 1 medium (with VC6TFAE or VC6TF; with 20 ng/ml bFGF; CeXEN). In brief, E3.5 blastocysts were plated on MEF feeders in stage 1 medium. The medium was changed every 2 days. Approximately 4-7 days (depending on the size of outgrowth) later, outgrowths could be disaggregated 1:1 to 1:2 onto new feeder cells. The medium was changed every 2 days, and XEN cells could grow to confluence in approximately 4-7 days. Then, CeXEN cells were routinely cultured in stage 1 medium and passaged 1:20-1:30 every 3 days. Three CeXEN cell lines were derived in this manner and were expanded long-term for more than 25 passages.
[0157] Small-Molecule Compounds and Libraries
[0158] The small-molecule compounds used in this study were purchased or synthesized as described in Table 1D. The concentration of compounds is shown in Table 1D. Small-molecule libraries used for the screen were purchased or generated in-house as described in Table 1C
TABLE-US-00003 TABLE 1C Small molecule libraries used in reprograming Number of small- Library Source molecule compounds BBP-2080NPs library BioBioPha 2,080 The Spectrum Collection MicroSource 2,000 Discovery Systems Sigma LOPAC?.sup.,1280 Sigma 1,280 Prestwick Chemical Prestwick Chemical 1,200 Library? Tocriscreen? Total Tocris 1,120 US Drug Collection MicroSource 1,040 Discovery Systems ICCB Known Enzo 480 Bioactives Library Protein Kinase Inhibitor Millipore 324 Library I, II, III StemSelect Small Calbiochem 303 Molecule Regulators Nuclear Receptor Enzo 76 Ligand Library Selected Small Molecules* Our lab 88 *This library was generated in-house, including 88 selected small molecules related to pluripotency, reprogramming or epigenetic modification
TABLE-US-00004 TABLE 1D Small-molecule compounds tested in reprogramming Concen- Abbre- tration Molecular Full Name viation (?M) Source Weight Structure Valproic acid sodium salt VPA, V 500 Sigma, cat. no. P4543 166.19
[0159] Plasmid Construction and Lentivirus Production
[0160] The pLL3.7-?U6 vector was described by (McQualter, et al., Stem Cells, 27:623-633 (2009). Mouse Sall4 was amplified from ESCs (TT2) by RT-PCR, cloned into the pEASY-Blunt vector (TransGen Biotech), confirmed by sequencing and then introduced into the XhoI/EcoRI sites of pLL3.7-?U6. The primers are listed in Table 2.
TABLE-US-00005 TABLE2 PrimersetsforPCRreactions Genes Forward(5 to3) Reverse(5 to3) Forplasmidconstruction Sall4 ACTCGAGCCACCATGTCGAGGC GCAATTGTTAGCTGACAGCAAT GCAAGCAGGCGAA(SEQIDNO: CTTATTTTCCTCC(SEQIDNO:2) 1) ForqRT-PCR Sox2 CGGGAAGCGTGTACTTATCCTT GCGGAGTGGAAACTTTTGTCC (SEQIDNO:3) (SEQIDNO:4) Klf4 TTGCGGTAGTGCCTGGTCAGTT CTATGCAGGCTGTGGCAAAACC (SEQIDNO:5) (SEQIDNO:6) Oct4 CAGGGCTTTCATGTCCTGG AGTTGGCGTGGAGACTTTGC (SEQIDNO:7) (SEQIDNO:8) Gata4 GAGCTGGCCTGCGATGTCTGAG AAACGGAAGCCCAAGAACCTGA TG(SEQIDNO:9) AT(SEQIDNO:10) Gata6 TGAGGTGGTCGCTTGTGTAG ATGGCGTAGAAATGCTGAGG (SEQIDNO:11) (SEQIDNO:12) Sox17 GTCAACGCCTTCCAAGACTTG GTAAAGGTGAAAGGCGAGGTG (SEQIDNO:13) (SEQIDNO:14) Esrrb GTGGCTGAGGGCATCAATG AACCGAATGTCGTCCGAAGAC (SEQIDNO:15) (SEQIDNO:16) Sall4 TGGCAGACGAGAAGTTCTTTC TCCAACATTTATCCGAGCACAG (SEQIDNO:17) (SEQIDNO:18) Lin28a CCGCAGTTGTAGCACCTGTCT GAAGAACATGCAGAAGCGAAG (SEQIDNO:19) A(SEQIDNO:20) Dppa2 GCGTAGCGTAGTCTGTGTTTG TCAACGAGAACCAATCTGAGGA (SEQIDNO:21) (SEQIDNO:22) Nanog AGTTATGGAGCGGAGCAGCAT AGGCCTGGACCGCTCAGT(SEQ (SEQIDNO:23) IDNO:24) Actb CATTGCTGACAGGATGCAGAA TGCTGGAAGGTGGACAGTGAGG GG(SEQIDNO:25) (SEQIDNO:26) Gadph CATCACTGCCACCCAGAAGACT ATGCCAGTGAGCTTCCCGTTCAG G(SEQIDNO:27) (SEQIDNO:28) ForgenomicPCR pLL-Oct4 GAAGGATGTGGTCCGAGT(SEQ GCAGCGTATCCACATAGCGT IDNO:29) (SEQIDNO:30) pLL-Sox2 CATGGGTTCGGTGGTCAA(SEQ GCAGCGTATCCACATAGCGT IDNO:31) (SEQIDNO:32) pLL-Klf4 ACCACTGTGACTGGGACG(SEQ GCAGCGTATCCACATAGCGT IDNO:33) (SEQIDNO:34) pLL-cMyc TACATCCTGTCCGTCCAAGC GCAGCGTATCCACATAGCGT (SEQIDNO:35) (SEQIDNO:36) Fu-tet- ACCTCCATAGAAGACACCG TAGCCCCACTCCAACCTG(SEQ hOct4 (SEQIDNO:37) IDNO:38) Fu-tet- ACCTCCATAGAAGACACCG CTCCGACAAAAGTTTCCACTCG hSox2 (SEQIDNO:39) (SEQIDNO:40) Fu-tet- ACCTCCATAGAAGACACCG GAAGAGGAGGCTGACGCT(SEQ hKlf4 (SEQIDNO:41) IDNO:42) Fu-tet- ACCTCCATAGAAGACACCG GGGTCGCAGATGAAACTC(SEQ hcMyc (SEQIDNO:43) IDNO:44) Forbisulfitegenomicsequencing Oct4 GGAGTGGTTTTAGAAATAATTG TCCAACCCTACTAACCCATCACC (SEQIDNO:45) (SEQIDNO:46) Nanog GATTTTGTAGGTGGGATTAATT ACCAAAAAAACCCACACTCATA GTGAATTT(SEQIDNO:47) TCAATATA(SEQIDNO:48) Forchromatinimmunoprecipitation Oct4 CTGTAAGGACAGGCCGAGAG CAGGAGGCCTTCATTTTCAA (SEQIDNO:49 (SEQIDNO:50) Nanog CTATCGCCTTGAGCCGTTG AACTCAGTGTCTAGAAGGAAAG (SEQIDNO:51) ATCA(SEQIDNO:52) Sox2 TTTATTCAGTTCCCAGTCCAA TTATTCCTATGTGTGAGCAAGA (SEQIDNO:53) (SEQIDNO:54) ForOG(Oct4promoter-drivenGFP)cassette OG AACCACTACCTGAGCACCC ACCTCTACAAATGTGGTATG (SEQIDNO:55) (SEQIDNO:56)
The lentiviral vectors containing the other individual reprogramming factors (Oct4, Sox2, Klf4 or c-Myc) were described by Zhao, et al., Cell Stem Cell, 3:475-479 (2008). For tet-on Oct4 systems, Fu-tet-hOct4 and FUdeltaGW-rtTA were the same as described by Li, et al., Cell Res., 21:196-204 (2011); Maherali, et al., Cell Stem Cell, 3:340-345 (2008). Genetic knockdown was carried out using shRNAs (SIGMA MissionR shRNA) according to the manufacturer's protocol. The shRNA sequences are listed in Table 3. Lentivirus production, collection and infection were as described by Zhao, et al., Cell Stem Cell, 3:475-479 (2008).
TABLE-US-00006 TABLE3 SequencesofshRNAs shRNA Sequences(5-3) Sall4 shRN CCGGCAGCCCACCTTTGTCAAAGTTCTCGAGAACTTTGACA A1 AAGGTGGGCTGTTTTTG(SEQIDNO:57) shRN CCGGGCCCACCTTTGTCAAAGTTGACTCGAGTCAACTTTGA A2 CAAAGGTGGGCTTTTTG(SEQIDNO:58) Gata4 shRN CCGGAGCCCAAGAACCTGAATAAATCTCGAGATTTATTCAG A1 GTTCTTGGGCTTTTTTG(SEQIDNO:59) shRN CCGGCATCTCCTGTCACTCAGACATCTCGAGATGTCTGAGT A2 GACAGGAGATGTTTTTG(SEQIDNO:60) Gata6 shRN CCGGCCACTACCTTATGGCGTAGAACTCGAGTTCTACGCCA A1 TAAGGTAGTGGTTTTTG(SEQIDNO:61 shRN CCGGCCTCGACCACTTGCTATGAAACTCGAGTTTCATAGCA A2 AGTGGTCGAGGTTTTTG(SEQIDNO:62) Sox17 shRN CCGGCCCACAATCACTGTCCAGTTTCTCGAGAAACTGGACA A1 GTGATTGTGGGTTTTTG(SEQIDNO:63) shRN CCGGCGCACGGAATTCGAACAGTATCTCGAGATACTGTTCG A2 AATTCCGTGCGTTTTTG(SEQIDNO:64) Ezh2 shRN CCGGGCTAGGCTAATTGGGACCAAACTCGAGTTTGGTCCCA A1 ATTAGCCTAGCTTTTTG(SEQIDNO:65) shRN CCGGCGGCTCCTCTAACCATGTTTACTCGAGTAAACATGGT A2 TAGAGGAGCCGTTTTTG(SEQIDNO:66) Control shRN CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCT A TCATCTTGTGTTTTTG(SEQIDNO:67) control
[0161] CiPSC Induction
[0162] CiPSC Induction without Selective Priming for XEN-Like Cell Population
[0163] The initial cells (MEFs, MNFs, MAFs or ADSCs) were seeded at a density of 50,000 cells per well of a 6-well plate or 300,000 cells per 100 mm dish. On the next day (day 0), the original medium was replaced with chemical reprogramming medium containing the small-molecule combinations. The small-molecule combinations-containing medium was changed every 4 days. On day 12, these cells were washed in PBS and digested with 0.25% Trypsin-EDTA (Invitrogen) at 37? C. for 3-5 min. After neutralization, the cell clumps were dissociated into single cells by thorough pipetting. The cells were harvested (300,000-1,000,000 cells per well of a 6-well plate) and replated at a density of 300,000-500,000 cells per well of a 6-well plate in the chemical reprogramming medium containing the small-molecule combinations. DZNep was added to the cell cultures on day 16 or day 20. On day 28-36, the small-molecule combinations including DZNep were removed. Meanwhile, the chemical reprogramming medium was replaced with 2i-medium. After another 8-12 days, 2i-competent, ESC-like and GFP-positive colonies were counted as primary CiPSC colonies. For CiPSC induction from wild-type cells without OG reporter, 2i-competent and ESC-like colonies were counted as primary CiPSC colonies. These CiPSC colonies were picked up for expansion and characterization. Alternatively, CiPSCs could be induced without replating on day 12.
[0164] IEC-CiPSC Induction
[0165] The initial IECs were seeded at a density of 100,000 cells per well of a 12-well plate. On the next day (day 0), the medium was replaced with chemical reprogramming medium containing the small-molecule cocktail (0.5 mM VPA, 20 ?M CHIR, 10 ?M 616452, 10 ?M Tranylcypromine, 50 ?M Forskolin, 0.05 ?M AM 580) and changed every 4 days. From day 12, 0.01 ?M DZnep was added into chemical reprogramming medium, and AM 580 is withdrawn. The medium was replaced with N2B27-2iL medium from day 32. After another 12 days, 2i-competent, ESC-like and OG-positive colonies were counted as primary CiPSC colonies. The primary CiPSC colonies were picked up for expansion and further characterization.
[0166] NSC-CiPSC Induction
[0167] The initial NSCs were seeded at the density of 50,000 cells per well of a 6-well plate. The original culture medium was replaced by chemical reprogramming medium containing the small-molecule cocktail (0.5 mM VPA, 15 ?M CHIR, 5 ?M 616452, 10 ?M Tranylcypromine, 20 ?M Forskolin, 1 ?M Ch 55, 5 ?M EPZ) and changed every 4 days. From day 20, 0.01 ?M DZNep was added into the chemical reprogramming medium. The medium was replaced with N2B27-2iL medium from day 40-44. After another 12 days, 2i-competent, ESC-like and OG-positive colonies were counted as primary CiPSC colonies. The primary CiPSC colonies were picked up for expansion and further characterization.
[0168] CiPSC Induction Via Selective Priming/Bias for XEN-Like Cell Population
[0169] The induction medium was prepared as following: The basal medium of stage 1 and stage 2 were LIF-free ESC culture medium containing 100 ng/ml and 20 ng/ml bFGF (Origene), respectively. The stage 3 medium was an N2B27-2i medium. The N2B27-2i medium (500 ml) was generated including the following: 240 ml DMEM/F12 (Invitrogen), 240 ml Neurobasal (Invitrogen), 5 ml N2 supplement (Invitrogen), 10 ml B27 supplement (Invitrogen), 2 mM GlutaMAX?-I (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM 2-mercaptoethanol (Invitrogen), 1% penicillin-streptomycin (Invitrogen), 3 ?M CHIR99021, 1 ?M PD0325901 and 1,000 U/ml LIF.
[0170] MEFs, MNFs or MAFs were plated at 300,000 cells per 100 mm dish, or 50,000 cells per well on a 6-well plate. The next day (day 0), the culture was changed into stage 1 medium supplemented with small-molecule cocktail VC6TFAE (0.5 mM VPA, 20 ?M CHIR99021, 10 ?M 616452, 5 ?M Tranylcypromine, 50 ?M FSK, 0.05 ?M AM580 and 5 ?M EPZ004777). On day 12, the cells were washed in PBS and digested with 0.25% Trypsin-EDTA (Invitrogen) at 37? C. for 2-3 min. After neutralization, the cell clumps were dissociated into single cells by thorough pipetting. The cells were harvested and then re-plated at 100,000 cells per well of a 6-well plate (1:15). During days 12-16, the cells were cultured in stage 1 medium supplemented with a modified small-molecule cocktail VC6TFA (0.5 mM VPA, 10 ?M CHIR99021, 10 ?M 616452, 5 ?M Tranylcypromine, 10 ?M FSK, 0.05 ?M AM580). On day 16, XEN-like epithelial colonies were formed and the culture was changed into stage 2 medium supplemented with small-molecule cocktail VC6TFAZDS (0.5 mM VPA, 10 ?M CHIR99021, 10 ?M 616452, 5 ?M Tranylcypromine, 10 ?M FSK, 0.05 ?M AM580, 0.05 ?M DZNep, 0.5 ?M 5-aza-dC and 5 ?M SGC0946). On day 28, the culture was transferred into stage 3 medium. After another 8-12 days, 2i-competent, ESC-like and GFP-positive (if using pOct4-GFP reporter) CiPSC colonies emerged and were then picked up for expansion and characterization. During CiPSC induction, the medium and small molecules were changed every 4 days.
Chemical Reprogramming of eXEN Cells
[0171] eXEN cells or CeXEN cells were plated at 2,000-10,000 cells per well of a 12-well plate on MEF feeders. Following the treatment with stage 1 medium for 4 days (dispensable for induction), stage 2 medium for 12 days and stage 3 medium for another 8-12 days, 2i-competent, ESC-like CiPSC colonies emerged and were then picked up for expansion and characterization. For most experiments, feeder cells were helpful for the survival of XEN cells, and a relatively low cell density was beneficial for CiPSC induction.
Plasmid Construction and Lentivirus Production
[0172] Plasmids were constructed as previously described (Zhao et al., 2008). Briefly, SALL4, GATA4 and GATA6 were amplified by qRT-PCR, cloned into the pEASY-Blunt vector (TransGen Biotech), confirmed by sequencing and then introduced into the XhoI/EcoRI sites of pLL3.7-?U6. The primers are listed in Table 4.
TABLE-US-00007 TABLE4 Primersforplasmidconstruction ACCESSION SYMBOL NUMBERS PRIMERS(5 to3) SALL4 NM_020436 TACTCGAGGCCACCATGTCGAGGCGCAAGCAGG (SEQIDNO:68) GGGAATTCATCACAAAGCAGCATAGCAACAATC GTG(SEQIDNO:69) GATA4 NM_002052 ACCTCGAGGCCACCATGTATCAGAGCTTGGCCA TGGC(SEQIDNO:70) GCGAATTCATCATTACGCAGTGATTATGTCCCC GTG(SEQIDNO:71) GATA6 NM_005257 ATCTCGAGGCCACCATGGCCTTGACTGACGGCG G(SEQIDNO:72 CTGAATTCATCATCAGGCCAGGGCCAGGGC (SEQIDNO:73)
[0173] Fu-tet-hSOX2 and FUdeltaGW-rtTA were described previously (Li et al., 2011; Maherali et al., 2008). Genetic knockdown, lentivirus production and infection were also the same as previously described (Hou et al., 2013).
Immunofluorescence, RT-PCR, Genomic PCR, Teratoma Formation and Karyotype Analysis
[0174] Immunofluorescence, RT-PCR, genomic PCR and teratoma formation were all carried out as described in Hou, et al., Science, 341:651-654 (2013). For immunofluorescence, the primary antibodies included SSEA-1 (Millipore, MAB4301), OCT4 (Abcam, ab18976), SOX2 (Santa Cruz, sc-17320), KLF4 (Santa Cruz, sc-20691), REX1 (Santa Cruz, sc-99000), NANOG (R&D, AF2729), UTF1 (Abcam, ab24273), SALL4 (Santa Cruz, sc-166033). Secondary antibodies were Rhodamine-conjugated, including Donkey Anti Mouse IgG (H+L)(Jackson ImmunoResearch, 715-025-150), Donkey Anti Goat IgG (H+L) (Jackson ImmunoResearch, 705-025-147), and Donkey Anti Rabbit IgG (H+L) (Jackson ImmunoResearch, 711-025-152). Primers for RT-PCR were the same as described previously (Li, et al., Cell Res., 21:196-204 (2011)). Primers for genomic PCR are shown in Table 2. Karyotype analyses were performed as reported (Longo, et al., Transgenic Res. 6:321-328 (1997)).
[0175] For the imaging analysis, the cells were imaged using the Andor's Revolution WD spinning disk confocal microscopy system (Andor) or ImageXpress Micro XL Widefield High Content Screening System (Molecular Devices).
Real-Time PCR
[0176] Total RNA from an entire well of cultured cells was isolated using the RNeasy Plus MiniKit (QIAGEN). For a single colony, RNA was isolated using the RNeasy Micro Kit (QIAGEN). RNA was converted to cDNA using TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech). PCR was carried out using Power SYBRR Green PCR Master Mix (Applied Biosystems) and performed on an ABI Prism 7300 Sequence Detection System. The data were analyzed using the delta-delta Ct method. The primers used for real-time PCR are listed in Table 2.
Chimera Construction
[0177] Chimeric mice were obtained by the injection of CiPS cells into blastocysts using a sharp injection needle or into eight-cell embryos using a XY Clone laser system (Hamilton ThorneBioscience). For blastocyst injection, 10-15 CiPS cells were injected into the recipient embryo cavity of F2 (intercross of B6D2F1) or CD-1 (albino) female mice at 3.5 d (days postcoitum). Host eight-cell embryos were collected from female mice at 2.5 d, and 7-10 CiPS cells were injected into each embryo. After injection, blastocysts and eight-cell embryos (6-8 embryos in each oviduct or horn of the uterus) were transferred into 2.5 d or 0.5 d pseudopregnant CD-1 females, respectively. Chimeric mice were identified by coat color and then assessed for germline transmission by mating with ICR mice.
[0178] XEN Chimera Assay
[0179] GFP-labeled XEN-like cells were induced from the GFP-labeled MEF isolated from GFP (ICR?ICR) mice. For chimera test, GFP-labeled XEN-like cell colonies were picked and disaggregated to single cells by 0.25% trypsin-EDTA. Approximately 10 to 15 XEN-like cells were injected into blastocysts and transferred to the uterus of E2.5 pseudopregnant females. Chimera conceptus between E6.5-8.5 were dissected carefully to keep the parietal yolk sac intact and observed with fluorescence stereoscopy.
[0180] For the chimera test with eXENs and CeXENs, cells were infected with lentiviral vectors expressing EGFP and FASC sorted for the purification of EGFP-positive cells.
[0181] DNA Microarray and RNA-Seq
[0182] Total mRNA was isolated from mouse fibroblasts, CiPSCs and ESCs. Microarrays were performed as reported by Li, et al., Cell Res., 21:196-204 (2011). RNA sequencing libraries were constructed using the Illumina mRNA-seq Prep Kit (Illumina). Fragmented and randomly primed 200 bp paired-end libraries were sequenced using Illumina HiSeq 2000. Hierarchical clustering of the microarray data was performed as reported by Li, et al., Cell Res., 21:196-204 (2011). Heatmaps were generated using R (Bioconductor). In some studies, total RNA was isolated using the RNeasy Plus Mini Kit (Qiagen). RNA sequencing libraries were constructed using the NEBNext? Ultra? RNA Library Prep Kit for Illumina? (NEB). Fragmented and randomly primed 200 bp paired-end libraries were sequenced using Illumina HiSeq 2500. Hierarchical clustering, scatter plots and heatmaps were generated in R v3.2.0 using the amap package, the graphics package and the pheatmap package, respectively.
[0183] Bisulfite Genomic Sequencing
[0184] Genomic DNA was modified by bisulfate treatment and purified using the MethylCode? Bisulfite Conversion Kit (Invitrogen) according to the manufacturer's protocol. The primers are listed in Table 2. The amplified fragments were cloned into the pEASY-blunt Vector (Transgene). Ten randomly picked clones from each sample were sequenced.
[0185] cAMP, S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH) Quantification
[0186] cAMP was quantified using the Direct cAMP ELISA Kit (Enzo) according to the manufacturer's protocol. For SAM and SAH quantification, cultured cells (1,000,000 cells) were trypsinized and homogenized by ultrasonication in 200 ?l PBS. Then 40 ?l of 400 mg/ml TCA was added. Cell extracts were incubated on ice for 30 min. After centrifugation at 4? C. (13,000 rpm, 15 min), the supernatants were filtered through a 0.22 ?m filter and analyzed by high-performance liquid chromatography (HPLC, Shimadzu) with HILIC columns (Waters).
Comparative Genomic Hybridization (CGH) Analysis.
[0187] For CGH experiments, genomic DNA was extracted and hybridized to NimbleGen 3?720K mouse whole-genome tiling arrays by Imagenes using C57BL/6 MEF DNA as a reference (Gene BioDesign).
[0188] Flow Cytometry Analysis
[0189] Cultured cells were trypsinized into single cells and then resuspended in PBS containing 3% fetal bovine serum. Using endogenous Oct4-GFP, FACS analyses were performed with a FACSCalibur instrument (BD Biosciences). The data were analyzed with FCS Express 4 (De Novo).
[0190] Chromatin Immunoprecipitation (ChIP)
[0191] ChIP was performed using the EZ-Magna ChIP A/G Kit (Millipore) according to the manufacturer's protocol. Anti-H3K27me3 (Abcam, ab6002), anti-H3K9me2 (Millipore, 07-441), anti-H3K4me3 (Abcam, ab8580) and anti-H3K9ac (Abcam, ab4441) antibodies were used. Following immunoprecipitation, DNA was analyzed by real-time PCR. The primers used are listed in Table 2.
[0192] Southern Blot
[0193] Southern blot was performed with the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, 11 585 614 910), with reference to Roche Techniques for Hybridization of DIG-labeled Probes to a Blot. 20 ?g genomic DNA isolated from iPS cells or MEFs was digested with EcoRI and XbaI. The DNA probe was designed based on psi sequence, which is present in the pLL3.7-_U6 vector and Fu-tet vectors and could thus be integrated into the genome along with exogenous transgenes after virus infection.
[0194] Luciferase Activity Assays
[0195] MEFs were plated at a density of 40,000 cells per well of a 24-well plate and transiently transfected with Oct4 promoter reporters using Lipofectamine LTX & Plus Reagent (Invitrogen) according to the manufacturer's instructions. pRL-TK plasmids (Promega) were cotransfected in each well as internal references, and the total DNA concentrations for all transfections were equalized by adding empty pLL3.7-_U6 vector. At 48 hours after transfection, cells were washed in PBS and lysed in passive lysis buffer (Promega). Luciferase activity was measured with the Dual-luciferase Reporter Assay System (Promega) using a Centro LB960 96-well luminometer (Berthold Technologies) and normalized to Renilla luciferase activity. Empty expression vector plasmids were used as negative control. The fold activation describes the ratio of firefly to Renilla luciferase activity for each condition compared with that of the empty vector control.
[0196] Western Blot Analysis
[0197] Cells were cultured in 100 mm dishes, washed in PBS and scraped in lysis buffer. Aliquots were loaded onto an 8-10% SDS-polyacrylamide gel and blotted onto a nitrocellulose membrane. Membranes were incubated overnight at 4? C. with rabbit anti-EZH2 (Abcam, ab3748) at a dilution of 1:1000. Goat anti Rabbit IgG(H+L)/HRP (ZSBIO, ZB-2301) was used as the secondary antibody. Detection was performed using SuperSignal West Pico solutions (Pierce).
Example 1: Chemical Substitutes for Oct 4
[0198] To identify chemical substitutes of Oct4, MEFs from OG mice were plated at a density of 20,000 cells per well of a 12-well plate and infected with lentiviruses encoding Sox2, Klf4 and c-Myc. After infection, the medium was replaced with LIF-free ESC culture medium. Individual chemicals from small-molecule libraries were added to each well. The medium and chemicals were changed every 4 days. Chemical treatments were continued for 14-20 days or until GFP-positive colonies appeared. Primary hits were selected for further confirmation and optimization.
[0199] Small molecules that enable reprogramming in the absence of Oct4 were searched using Oct4 promoter-driven green fluorescent protein (GFP) expression (OG) mouse embryonic fibroblasts (MEFs), with viral expression of Sox2, Klf4, and c-Myc. After screening up to 10,000 small molecules (Table 1C), Forskolin (FSK), 2-methyl-5-hydroxytryptamine (2-Me-5HT), and D4476 (Table 1D) were identified as chemical substitutes for Oct4 (
[0200] Passaged SKM-FSK-iPSCs exhibit typical ESC morphology and homogeneously express GFP (
[0201] A small molecule combination VC6 T [VPA, CHIR99021 (CHIR), 616452, tranylcypromine], that enables reprogramming with a single gene, Oct4 (Li, et al., Cell Res., 21:196-204 (2011)), was used next to treat OG-MEFs plus the chemical substitutes of Oct4 in the absence of transgenes. The data shows that VC6 T plus FSK (VC6TF) induced some GFP-positive clusters expressing E-cadherin, a mesenchyme-to-epithelium transition marker, reminiscent of early reprogramming by transcription factors (Li, et al., Cell Stem Cell, 7:51-63 (2010); Samavarchi-Tehrani, et al., Cell Stem Cell, 7:64-77 (2010)) (
Example 2: Small Molecules that Facilitate Late Reprogramming
[0202] To identify small molecules that facilitate late reprogramming, a doxycycline (DOX)-inducible Oct4 expression screening system was used (Li, et al., Cell Res. 21:196-204 (2011)).
[0203] MEFs from OG mice were plated as described above and infected with Fu-tet-hOct4 and FUdeltaGW-rtTA lentiviruses. The induction protocol was carried out as described above.
[0204] After infection, the culture medium was replaced with LIF-free ESC culture medium containing VC6 T (VPA, CHIR99021, 616452, Tranylcypromine) plus DOX (1 ?g/ml). Alternatively, MEFs harboring DOX-inducible Oct4 from Tet-On POU5F1 mouse strain B6;129-Gt(ROSA)26Sor.sup.tm1(rtTA*M2)JaeCol1a.sub.1.sup.tm2(tetO-Pou5f1)Jae/J were used in this screen (Li, et al., Cell Res., 21:196-204 (2011)). These two DOX-inducible systems were only used in this screen, but not in complete chemical reprogramming. Individual chemicals from small-molecule libraries were added to each well. The concentrations of small molecules are listed in Table 1D. Small molecules were added at different culture time points. 5-aza-C(5-Azacytidine) and DZNep were added from day 8. The medium and chemicals were changed every 4 days; DOX was added only for the first 4-8 days. Chemical treatments were continued for 16-24 days or until GFP-positive colonies appeared. Primary hits were selected for further confirmation and optimization. CiPSC colonies were counted on day 44. Primary hits were selected for further confirmation and optimization.
[0205] Small molecule hits, including several cAMP agonists (FSK, Prostaglandin E2, and Rolipram) and epigenetic modulators [3-deazaneplanocin A (DZNep), 5-Azacytidine, sodium butyrate, and RG108], were identified in this screen (
Example 3: Complete Chemical Reprogramming without the Oct-4 Inducible System
[0206] To achieve complete chemical reprogramming without the Oct4-inducible system, small molecules were further tested in the chemical reprogramming of OG-MEFs without transgenes. When DZNep was added 16 days after treatment with VC6TF (VC6TFZ), GFP-positive cells were
obtained more frequently by a factor of up to 65 than those treated with VC6TF, forming compact, epithelioid, GFP-positive colonies without clearcut edges (
[0207] Next, the dosages and treatment duration of the small molecules were optimized leading to generation of 1 to 20 CiPSC colonies from 50,000 initially plated MEFs (
[0208] After an additional screen, some small-molecule boosters of chemical reprogramming were identified, among which, a synthetic retinoic acid receptor ligand, TTNPB, enhanced chemical reprogramming efficiency up to a factor of 40, to a frequency comparable to transcription factor-induced reprogramming (up to 0.2%) (
[0209] Using the small-molecule combination VC6TFZ, CiPSC lines were obtained from mouse neonatal fibroblasts (MNFs), mouse adult fibroblasts (MAFs), and adipose-derived stem cells (ADSCs) with OG cassettes by efficiency lower by a factor of ?10 than that obtained from MEFs. Table 5.
TABLE-US-00008 TABLE 5 Summary of CiPS cell characterization Gene Clone Initial cell Chemical ESC-like and Non- AP expression Germ-line number types Mouse strain combinations GFP-positive transgenic staining RT-PCR immunostaining profiling Teratoma karyotype DNA chimeras transmission CiPS-6 MEFs OG (C57) ? ICR VC6TFMB + Z ? ? ? ? ? ? ? ? ? No CiPS-11 MEFs OG (C57) ? ICR VC6TFMB + Z ? ? ? ? ? ? ? CiPS-21 MEFs OG (C57) ? ICR VC6TFDBS + Z ? ? ? ? ? ? ? ? ? ? ? CiPS-25 MEFs OG (C57) ? ICR VC6TFMDBSPR + Z ? ? ? ? ? ? ? ? ? ? CiPS-30 MEFs OG (C57) ? ICR VC6TFMDBSPR + Z ? ? ? ? ? ? ? ? ? CiPS-34 MEFs OG (C57) ? ICR VC6TFMP + Z ? ? ? ? ? ? ? ? ? ? ? CiPS-36 MEFs OG (C57) ? ICR VC6TFMDB + Z ? ? ? ? ? ? ? ? ? ? No CiPS-39 MEFs OG (C57) ? ICR VC6TFMDB + Z ? ? ? ? ? ? ? CiPS-42 MEFs OG (C57) ? ICR FC6 + Z ? ? ? ? ? ? CiPS-43 MEFs OG (C57) ? ICR FC6 + Z ? ? ? ? ? ? CiPS-44 MEFs OG (C57) ? ICR FC6 + Z ? ? ? ? ? ? CiPS-45 MEFs OG (C57) ? ICR FC6 + Z (w/o bFGF) ? ? ? ? ? ? ? ? ? CiPS-47 MEFs OG (C57) ? ICR VC6TF + Z ? ? ? ? ? ? ? ? CiPS-50 MEFs OG (C57) ? ICR VC6F + Z ? ? ? ? ? ? ? ? ? CiPS-56 MEFs OG (C57) ? ICR VC6TFBPS + Z ? ? ? ? ? ? CiPS-82 MEFs OG (C57) ? OG VC6TF + Z ? ? ? ? ? ? (C57) CiPS-453 MEFs OG (C57) ? 129 VC6TFPS + Z ? ? ? ? ? ? ? CiPS-WT1 MEFs (without ICR VC6TFMPS + Z ? ? ? ? ? ? ? ? OG-reporter) CIPS-WT2 MEFs (without C57 ? 129 VC6TFMPS + Z ? ? ? ? ? ? ? ? OG-reporter) MNF-CiPS- Mouse neonatal OG (C57) ? ICR VCT6FMDBR + Z ? ? ? ? ? ? ? ? ? ? No 1 fibroblasts (MNFs) MNF-CiPS- MNFs OG (C57) ? ICR VC6TFRP + Z ? ? ? ? ? ? 2 MNF-CiPS- MNFs OG (C57) ? ICR VC6TFS + Z ? ? ? ? ? ? ? ? No 7 ADSC- Adipocyte stem OG (C57) ? ICR VC6TFMPS + Z ? ? ? ? ? ? No CiPS-1 cells ADSC- Adipocyte stem OG (C57) ? ICR VC6TFMPS + Z ? ? ? ? ? ? ? ? CiPS-2 cells ADSC- Adipocyte stem OG (C57) ? ICR VC6TFDM + Z ? ? ? ? ? CiPS-3 cells ADSC- Adipocyte stem OG (C57) ? ICR VC6TFDM + Z ? ? ? ? ? ? CiPS-4 cells MAF-CiPS- MAFs OG (C57) ? ICR VC6TF + Z ? ? ? ? ? ? 1 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFDM + Z ? ? ? ? ? ? ? ? No 3 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFBS + Z ? ? ? ? ? ? ? ? ? ? ? 62 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFPS + Z ? ? ? ? ? ? ? ? ? ? ? 63 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFBS + Z ? ? ? ? ? ? ? ? ? 73 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFB + Z ? ? ? ? ? ? ? 76 MAF-CiPS- MAFs OG (C57) ? ICR FC6 + Z ? ? ? ? ? ? ? ? 80 MAF-CiPS- MAFs OG (C57) ? ICR FC6 + Z ? ? ? ? ? ? ? ? 81 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFP + Z ? ? ? ? ? ? ? ? ? ? 83 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFN + Z ? ? ? ? ? ? ? ? ? 84 MAF-CiPS- MAFs OG (C57) ? ICR VC6TFN + Z ? ? ? ? ? ? ? ? ? ? ? 85 CiPS-101 MEFs OG (C57) ? ICR FC6 ? CiPS-102 MEFs OG (C57) ? ICR FCT6 + Z ? CiPS-103 MEFs OG (C57) ? ICR FC6N + Z ? CiPS-104 MEFs OG (C57) ? ICR FC6T + 4PB + Z ? CiPS-105 MEFs OG (C57) ? ICR VCT6 + Z ? CiPS-31 MEFs OG (C57) ? ICR VC6TF ? ? ? ? ? CiPS-106 MEFs OG (C57) ? ICR VC6T + DBcAMP + Z ? CiPS-107 MEFs OG (C57) ? ICR VC6T + IBMX + Z ? CiPS-108 MEFs OG (C57) ? ICR VC6T + Rloipram + Z ? CiPS-109 MEFs OG (C57) ? ICR VF6T + TD114-2 + Z ? CiPS-110 MEFs OG (C57) ? ICR VC6TF + NepA ? CiPS-111 MEFs OG (C57) ? ICR VC6TF + Adox ? CiPS-112 MEFs OG (C57) ? ICR VC6TF + DZA ? CiPS-113 MEFs OG (C57) ? ICR VC6TF + Decitabine + ? EPZ004777 CiPS-114 MEFs OG (C57) ? ICR VC6TFN + Z ? CiPS-115 MEFs OG (C57) ? ICR VC6TF + AM580 + Z ? CiPS-116 MEFs OG (C57) ? ICR VC6TF + Ch55 + Z ? CiPS-117 MEFs OG (C57) ? ICR VC6TF + TTNPB + ? PGE2 + 5-aza-C CiPS-118 MEFs OG (C57) ? ICR VC6TF + TTNPB + ? PGE2 + Decitabine CiPS-119 MEFs OG (C57) ? ICR VC6TFDMB + UNC0638 + ? ? ? ? ? Scriptaid CiPS-120 MEFs OG (C57) ? ICR VC6TF + Decitabine + ? EPZ
Moreover, CiPSCs were induced from wild-type MEFs without OG cassettes or any other genetic modifications by a comparable efficiency to that achieved from MEFs with OG cassettes. The CiPSCs were also confirmed to be viral-vector free by genomic polymerase chain reaction (PCR) and Southern blot analysis (
[0210] Furthermore, small molecule combinations were used to generate CiPSCs from neural stem cells and from cells obtained from the intestinal epithelium (Table 6).
TABLE-US-00009 TABLE 6 Generation of CiPSCs from neural stem cells and cells from the intestinal epithelium Clone Initial cell ES-like genomic AP number type mouse strain small molecules morphology PCR staining RT-PCR IE-CiPS- intestinal OG (C57) ? ICR VC6TFAM580 + ? ? ND ? 1 epithelium Z cell NS-CiPS- neural stem OG (C57) ? ICR VC6TFZ + Ch55 + ? ? ND ? 1 cell Decitabine + EPZ Clone DNA chimeric germ-line number immunofluorescence microarray teratoma karyotype methylation mice transmission IE-CiPS- ? ? ? ? ? ? ? 1 NS-CiPS- ? ND ? ND ND ? ND 1 (ND represents not determined yet)
[0211] AM580 is 4-[(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)carboxamido]benzoic acid]; Ch55 is 4-[(1E)-3-[3,5-bis(1,1-Dimethylethyl)phenyl]-3-oxo-1-propenyl]benzoic acid] and EPZ. Intestinal and neural stem cells, likes MEF can be reprogrammed using VC6TFZ, without addition of the indicated small molecules, albeit with a different efficiency.
[0212] Experiments were next carried out to determine which of these small molecules were critical in inducing CiPSCs. Four essential small molecules (shown below) whose individual withdrawal from the combinations generated significantly reduced GFP-positive colonies and no CiPSCs were identified (
##STR00033##
[0213] These small molecules (C6FZ) are: CHIR (C), a glycogen synthase kinase 3 inhibitor (Ying, et al., Nature, 453:519-523 (2008)); 616452 (Zhang, et al., Cell Res. 21:196-204 (2011)), a transforming growth factor-beta receptor inhibitor (Maherali, et al., Curr. Biol., 19:1718-1723 (2009)); FSK (F), a cAMP agonist (
[0214] C6FZ was able to induce CiPSCs from both MEFs and MAFs, albeit by an efficiency lower by a factor of 10 than that induced by VC6TFZ (Table 5).
[0215] The effect of inhibiting adenylate cyclase on the number of colonies generated by VC6TFZ was tested. Inhibition of adenylate cyclase by 2'SddAdo decreased the number of colonies formed by VC6TFZ (
[0216] Generation of CiPSCs from NSCs Obtained from Oct4-GFP Transgenic Mice
[0217] In other experiments NSCs (obtained from Oct4-GFP transgenic mice) were treated with the reprogramming cocktail VC6TF (VPA, V; CHIR99021, CHIR, C; 616452, 6; Tranylcypromine, T; Forskolin, F). This did not able to induce pluripotency from NSCs. Then, potential reprogramming boosters including a RA agonist, Ch 55 (5) and a Dotl1 inhibitor, EPZ 004777 (EPZ, E) were added i.e., VC6TFZE5. The number of CiPSC colonies obtained from 30,000 with different RAR agonists is shown in
[0218] Generation of CiPSCs from Small Intestinal Epithelial Cells Obtained from Oct4-GFP Transgenic Mice
[0219] IECs isolated from the small intestinal tissue of Oct4-GFP transgenic mice at embryonic day 13.5 were used in these studies. The isolated IECs exhibited epithelial cell morphology, and immunofluorescence staining showed that the IECs highly expressed a specific intestinal epithelial cell marker, KERATIN 20 (KRT20) (data not shown).
[0220] Isolated IECs were cultured with the reported chemical reprogramming cocktail VC6TF and the RAR agonist AM 580. DZnep was then added to the cocktail from day 16-20. During this process, epithelioid clusters were observed from day 4-8, and formed colonies from day 16 (data not shown). After switching to 2i-medium from day 32-36, compact, epithelioid, ESC-like OG-positive colonies with clear-cut edges were developed (data not shown). Primary CiPSC colonies were calculated and harvested on day 44-46, and passaged in 2i-medium plus mouse LIF for more than 20 passages, maintaining ESC-like morphology (data not shown). These cells were referred to as IEC-CiPSCs.
[0221] A lineage tracing experiment was performed using transgenic mice expressing the Cre recombinase driven by Villin, an epithelium specific gene promoter, crossed with mice expressing a loxP-stop-loxP-td-Tomato located in Rosa26 locus. The IECs were labelled by tdTomato fluorescence (data not shown). After exposure to the chemical cocktail, tdTomato fluorescent CiPSC colonies were generated from IECs (
Example 4: Characterization of CiPSC Lines
[0222] Characterization of CiPSC Obtained from Fibroblasts
[0223] The established CiPSC lines were then further characterized. They grew with a doubling time (14.1 to 15.1 hours) similar to that of ESCs (14.7 hours), maintained alkaline phosphatase activity, and expressed pluripotency markers, as detected by immunofluorescence and reverse transcription (RT)-PCR (
[0224] The gene expression profiles were similar in CiPSCs, ESCs, and OSKM-iPSCs (iPSCs induced by Oct4, Sox2, Klf4, and c-Myc). DNA methylation state and histone modifications at Oct4 and Nanog promoters in CiPSCs were similar to that in ESCs. In addition, CiPSCs maintained a normal karyotype and genetic integrity for up to 13 passages, i.e., CiPS cells maintain normal chromosome numbers, few copy number variations and genetic mutations, making them safe for further clinical application.
[0225] To characterize their differentiation potential, CiPSCs were injected into immunodeficient (SCID) mice. The cells were able to differentiate into tissues of all three germ layers-respiration epithelium (endoderm); muscle cells (mesoderm); neural epithelium (endoderm) and pigmented epithelium (ectoderm). When injected into eight-cell embryos or blastocysts, CiPSCs were capable of integration into organs of all three germ layers, including gonads and transmission to subsequent generations. An adult chimeric mouse was produced from clone ciPS-34 as well as F2 offspring. Germline contribution of clone CiPS-45 was shown in testes. An adult chimeric mouse was also produced with CiPSCs derived from MNFs (clone MNF-CiPS-1). An adult chimeric mouse was produced with CiPSCs derived from MAFs (clone MAF-CiPS-62). Black F2 offspring were produced with CiPSCs derived from MAFs (clone MAF-CiPS-62). Black F2 offsprings were produced with CiPSCs derived from MAFs (clone MAF-CiPS-63). Chimeras were produced with CiPSCs derived from WT MEFs (clone CiPS-WT1, ICR) that were microinjected into (C57?DBA)?ICR embryos. Unlike chimeric mice generated from iPSCs induced by transcription factors including c-Myc (Nakagawa, et al., Proc. Natl. Acad. Sci. U.S.A. 107:14152-14157 (2010)), the chimeric mice generated from CiPSCs were 100% viable and apparently healthy for up to 6 months (
[0226] Characterization of NSC- and IEC-Derived CiPSCs
[0227] The established NSC-CiPSC lines and IEC-CiPSC lines were further characterized. The doubling time of the established CiPSC lines was 18 h-24 h, similar to mouse ESCs (
TABLE-US-00010 TABLE 7 Number of chromosomes in NSC-CiPSCs and IEC-CiPSCs by karyotype analysis Chromosome number Sample 2n = 40 2n < 40 2n > 40 NSC-CiPSC ? 100% 0% 0% IEC-CiPSC 98% 2% 0% pVillin-Cre-tdTomato 100% 0% 0% IEC-CiPSC
[0228] To evaluate the pluripotency of CiPSCs derived from NSCs and IECs, their in vivo developmental potential was examined. Both CiPSC lines could form well-differentiated teratomas with tissues from all three germ layers after injection into immunodeficient (NOD/SCID) mice (data not shown). When injected into blastocysts, CiPSCs were able to generate chimeric mice with germline transmission competency (data not shown). These results demonstrated that CiPSC lines derived from NSCs and IECs were pluripotent and fully reprogrammed.
Example 5: Pluripotency Inducing Properties of Small Molecules
[0229] To better understand the pluripotency-inducing properties of these small molecules, the global gene expression during chemical reprogramming was profiled. To determine clustering of gene expression profiles during chemical reprogramming, cell culture samples treated with VC6TFZ (Z was added from day 20) during chemical reprogramming on day 12, 20 and 32 were analyzed. MEFs on day 0, CiPSCs and ESCs were used as controls. Sequential activation of certain key pluripotency genes was observed, which was validated by real-time PCR and immunofluorescence. Genes that express in ESCs by more than 10 fold and in samples (day 32) by more than 3 fold compared to MEFs (day 0) include Sall4, Sox2, Lin28a, Dppa2, Esrrb, Klf4 and Pou5f1. Genes that express in samples (day 32) by more than 3 folds compared to MEFs (day 0) and ESCs include Sox 17, Gata6 and Gata4. The expression levels of two pluripotency-related genes, Sall4 and Sox2, were most significantly induced in the early phase in response to VC6TF, as was the expression of several extra-embryonic endoderm (XEN) markers Gata4, Gata6, and Sox17 (
[0230] The roles of the endogenous expression of these genes in chemical reprogramming were examined, using gene overexpression and knockdown strategies. The data shows that the concomitant overexpression of Sall4 and Sox2 was able to activate an Oct4 promoter-driven luciferase reporter (
[0231] Next, the role of DZNep, which was added in the late phase of chemical reprogramming was investigated. The data shows that Oct4 expression was enhanced significantly after the addition of DZNep in chemical reprogramming (
[0232] Consistently, DZNep significantly decreased DNA methylation and H3K9 methylation (
[0233] In summary, as a master switch governing pluripotency, Oct4 expression, which is kept repressed in somatic cells by multiple epigenetic modifications, is unlocked in chemical reprogramming by the epigenetic modulator DZNep and stimulated by C6F-induced expression of Sox2 and Sall4 (
[0234] Initial Gene Activation was Conserved in Chemical Reprogramming from Different Cell Types
[0235] At the initial stage of chemical-induced reprogramming to pluripotency, NSCs and IECs were transformed into highly refractive phase-bright and epithelial-like cells, which share similar morphology of partial colonies during MEF chemical reprogramming. Compact epithelioid colonies were observed around day 20-32 (data not shown), and all CiPSC colonies were derived from these epithelioid colonies in at least ten independent experiments. Time-course quantitative real-time PCR was performed during the chemical reprogramming of NSCs and IECs. The data analysis results showed that during reprogramming of NSCs and IECs, a pluripotency gene Sall4, and differentiation-associated genes Gata4, Gata6 and Sox17, were activated as early as day 4 and increased with time in the early stage, while other pluripotency genes such as Lin28a, Dppa2, Esrrb and Oct4 were activated much later (
[0236] This proof-of-principle study demonstrates that somatic reprogramming toward pluripotency can be manipulated using only small-molecule compounds (
[0237] In sum, the present data establishes that although a similar chemical cocktail is generally required for different cell types, fine-tuning the treatment of small molecules allows for improved reprogramming initiation in different cell types. Especially for the chemical reprogramming of NSCs, the concentration 616452, should be reduced to 2 ?M in comparison of 10 ?M, which is used on MEFs. Notably, the reduced 616452 concentration resulted in enhanced expression of Sall4 and Gata4 genes (
[0238] Interestingly, the reprogramming kinetics and frequency of NSCs and IECs are distinct from each other. The former underwent a longer early stage, with less epithelioid colonies generated, but almost 100 percent of the colonies could be converted into CiPSC colonies. In contrast, the latter could easily form more epithelioid colonies, but only 20-30 percent of these colonies were converted into CiPSC colonies.
Example 6. Identification of the Induction of Cell Colonies Expressing XEN Cell Markers as a Cornerstone Event During Chemical Reprogramming
[0239] In the method for inducing pluripotent stem cells from non-pluripotent stem cells described in Hou et al., Science 341, 651-654 (2013)), there are three essential stages in the chemical reprogramming process. Reprogramming of cells into CiPSC was obtained a cocktail of five small molecules, VC6TF was used in stage 1 for 16-20 days, following which, another small molecule, DZNep, was added at the start of stage 2 (i.e., VC6TFZ) for the next 20-24 days, and 2i-medium was used in stage 3 for the last 12-16 days, in some cases adding additional small molecules. In total, the chemical reprogramming process can take as long as 48-60 days, resulting in a maximum of about 40 colonies (
[0240] In order to improve on the efficiency of reprogramming non-pluripotent cells into CiPSC, studies were conducted to characterize the chemical reprogramming process, by carefully following the change in cell morphology during chemical reprogramming in each stage. These studies revealed a number of epithelial colonies formed at the end of stage 1, which rapidly expanded during stage 2. By tracing the dynamic changes in cell fate during chemical reprogramming, these studies revealed that CiPSCs predominantly emerged from the inside of these epithelial cell colonies (
[0241] Immunofluorescence and quantitative real-time PCR (qRT-PCR) was then used to examine the gene expression pattern of these epithelial cell colonies. Immunofluorescence showed that all epithelial colonies formed in the end of stage 1 co-expressed SALL4, GATA4 and SOX17, master genes of XENs (Lim et al., Cell Stem Cell., 3:543-554 (2008)) (data not shown). qRT-PCR analysis further detected the expression of other XEN marker genes, such as Sox7 and Gata6 in these colonies (
[0242] Studies were further conducted to determine whether these XEN-like cells represent an intermediate state of chemical reprogramming. Using a XEN-expressing surface protein, EpCAM, XEN-like cells were enriched at day 20 by FACS sorting and found that selection for EpCAM-positive cells greatly enriched the proportions of cells forming XEN-like cell colonies and subsequently generating CiPSCs by more than 20-fold (
Example 7. Identification of Small Molecules that Promote the Transition from Fibroblasts to XEN-Like Cells
[0243] The identification of an intermediate state of chemical reprogramming in Example 6 provides a target for enhancing reprogramming conditions and for screening novel small-molecule boosters in early reprogramming by using XEN-like colony numbers as the readout. Increased concentration of CHIR99021 is proved beneficial for the formation of XEN-like colonies from MEFs (
[0244] Next, the effects of a selected small-molecule library of previously reported reprogramming boosters was tested in the presence of a small-molecule cocktail, VC6TF, with 20 ?M CHIR99021, on the reprogramming of cell fate from fibroblasts to XEN-like cells. Among the tested small molecules, an RA agonist, AM580 (A), and a DOT1L inhibitor, EPZ004777 (E), each enhanced the formation of XEN-like colonies by 2 to 3-fold When these small molecules were used together in a cocktail of seven small molecules, VC6TFAE, the number of XEN-like colonies was enhanced by more than 5-fold (
Example 8. The Identification of Small Molecules that Promote the Transition from a XEN-Like to a Pluripotent State
[0245] Studies were next conducted to identify small molecules that facilitate the transition of XEN-like colonies to CiPSCs during stages 2 and 3. Small-molecule screenings were performed in the presence of small molecule cocktail VC6TFA plus DZNep (Z) for 12 days with successful enhanced generation of CiPSC colonies. By contrast, in Hou et al., Science 341:651-654 (2013), the optimal duration for stage 2 was 20-24 days; few CiPSC colonies were obtained if stage 2 was shortened to 12 days.
[0246] After selecting and screening 88 small molecules, it was discovered that CiPSC colonies formed in stage 3 only when the cell culture medium was supplemented with 5-aza-dC during stage 2. 5-aza-dC (D) and EPZ004777 (E) had synergistic effects and promoted the kinetics of stage 2. Thus, by using a cocktail of eight small molecules, VC6TFA+ZDE, for 12 days during stage 2, up to 20 CiPSC colonies were obtained from 100,000 re-plated cells at the end of the reprogramming process of 44 days (
[0247] These studies showed that the duration of the small-molecule treatment and the re-plating cell density were both highly critical during the later stages of reprogramming. The previous studies which did not follow a reprogramming route of biasing/enriching the XEN-like cell population favors a re-plating cell density of 300,000 cells per well (Hou et al., (2013)). However, when CiPSC reprogramming progresses via enriching for the XEN-like cells, it is preferable to replate cells at a cell density of 50,000-100,000 cells per well of a 6-well plate (
[0248] In summary, the methods disclosed herein greatly improve the cell transition from non-pluripotent into pluripotent cells, by selecting a first cocktail of small molecules to enrich/bias cells to be reprogrammed towards the XEN-like state, selecting a second cocktail of small molecules and replating density and cell culture time for transition from XEN to CiPSCs.
Example 9. Establishment of a Robust CiPSC Induction Protocol was Established Through Modulation of the Cell Transitions Through a XEN-Like State
[0249] Next, reprogramming conditions for stages 1, 2 and 3 identified in Example 8 were combined to reprogram fibroblasts into CiPSCs. Using this new protocol, a well of 50,000 initial fibroblasts was induced, and the cells were expanded to more than 1,000,000 or more re-plated cells (re-plated into 10-15 wells). A total of 1,000-9,000 CiPSC colonies were obtained at the end of the reprogramming period with a total induction time of 40 days (16, 12, and 12 days for stages 1, 2 and 3, respectively). A comparison of the reprogramming protocol which includes biasing towards XEN-like cells and the previous protocol exemplified in Example 3 is shown in
[0250] The minimal time course required in inducing CiPSCs was further examined by using this new small-molecule cocktail and the reprogramming conditions established in Example 8. A minimum of 12 days were required in the formation of XEN-like colonies (cells were re-plated at day 8), and that at least another 14 days were required to induce CiPSCs from XEN-like cells (
[0251] CiPSC colonies were then picked to establish CiPSC lines for further characterization. As shown by immunostaining and qRT-PCR, the CiPSCs expressed all the tested marker genes for pluripotent stem cells, such as Oct4, Sox2 and Nanog (
[0252] Gene Expression Dynamics During CiPSC Generation
[0253] Expression of some typical pluripotency-associated genes during chemical reprogramming was examined at different stages of chemical reprogramming. The data showed sequential expression of pluripotency genes (
[0254] Through qRT-PCR analysis and RNA sequencing, AM580 and EPZ004777 were identified as molecules which both promote the expression of XEN marker genes, such as Sall4, Gata4 and Sox17, during stage 1 of chemical reprogramming from fibroblasts to XEN-like cells (
[0255] Also examined was whether primitive streak genes were expressed during the chemical reprogramming process, because a primitive streak state has been reported during the process of OSKM-induced reprogramming (Takahashi et al., Nature Communications, 5:3678 (2014)). The expression of primitive streak markers, such as T and Mixl1, was not detected during chemical reprogramming (data not shown), demonstrating a unique XEN-like state during the chemical reprogramming process, which differs from that of the reprogramming induced by transgenes (
[0256] XEN Master Gene Expression is Essential During Chemical Reprogramming
[0257] To further support the XEN state as an intermediate for chemical reprogramming and to understand the role of XEN master genes in chemical reprogramming, knockdown and ectopic expression experiments were performed. Knockdown of any one of the key XEN genes Sall4, Gata4, Gata6 or Sox/7 led to a significant down regulation in the mRNA levels of the other XEN genes and decreased XEN-like colony numbers, thus resulting in less Oct4 expression and fewer CiPSCs at the end of the reprogramming period (
[0258] Furthermore, the overexpression of two of the XEN master genes (SALL4 plus GATA4 or SALL4 plus GATA6) in fibroblasts sufficed in inducing XEN-like colony formation in the absence of the three key small molecules, CHIR99021, 616452 and Forskolin (
[0259] Notably, although these XEN master gene-induced XEN-like cells expressed Oct4, they could not be further reprogrammed into iPSCs, even with a prolonged culture in 2i-medium. Exogenous XEN genes downregulated the endogenous expression of Sox2 (
[0260] Accordingly, when Sox2 was exogenously provided in an appropriate time window after XEN gene overexpression, iPSCs were obtained (
[0261] The XEN-Like Intermediates Resemble Embryo-Derived XEN Cells in Gene Expression Patterns, In Vivo Development Potential and Reprogramming Potential
[0262] Chemically-induced XEN-like cells were compared to embryo-derived XEN cells (eXENs) (Kunath et al., Development 132:1649-1661 2005) with respect to in vitro culture conditions. The studies showed that XEN-like cells could not be maintained in the traditional XEN culture medium (RPMI CM (traditional XEN culture medium; RPMI-medium with 70% MEF-condition medium (Kunath, et al., Development, 132:1649-1661 (2005)) (data not shown). In addition, eXEN cell lines could be maintained long-term and expanded in the stage 1 medium of chemical reprogramming for more than 20 passages, with the gene expression pattern and in vivo development potential similar to eXENs maintained in traditional XEN medium (data not shown).
[0263] By using stage 1 medium including chemical cocktail VC6TF, chemically-derived eXEN cell lines (CeXENs) could be established directly from blastocysts and expanded long-term for more than 25 passages, with a XEN-like gene expression pattern and in vivo integration capability into extraembryonic parietal endoderm (
TABLE-US-00011 TABLE 7 Statistical table of XEN integration chimeric ability of different cell types as indicated to parietal endoderm. EGFP-labeled fibroblasts were set as negative control. No. of embyos recovered Cell Type (E6.5-8.5) Xen integration Xen-like D11 18 7 (39%) Xen-like D116 24 21 (88%) Xen-like D125 22 10 (45%) eXen-1 31 20 (65%) eXen-2 23 9 (39%) CeXen 20 7 (35%) Fibroblasts 10 0
[0264] qRT-PCR analysis showed that XEN-like cells express a comparable level of XEN master genes to that of eXENs and CeXEN (
[0265] In particular, the XEN-like intermediates in chemical reprogramming were closer to CeXENs than traditional eXENs in gene expression profiles (
[0266] The in vivo development potential of XEN-like cells during chemical reprogramming was also examined. XEN-like cells induced in different time courses of chemical reprogramming were injected into mouse blastocysts. Similarly to eXEN cells, XEN-like cells at days 11-25 of chemical reprogramming were able to integrate into the parietal endoderm of the extraembryonic tissues with a comparable efficiency of eXENs, without any integration in the embryos (data not shown and Table 7). In particular, XEN-like cells in day 16 of chemical reprogramming showed the highest ratio of XEN integration (Table 7). These findings suggest that XEN-like cells resemble embryo-derived XEN cells in terms of development potential. Furthermore, either eXENs derived by traditional XEN culture medium or CeXENs established by the stage 1 medium of chemical reprogramming, were capable of further reprogramming into CiPSCs by using the protocol of late chemical reprogramming in stages 2 and 3 (data not shown). Notably, 17-34 CiPSC colonies were generated from 2,000 CeXENs within 24 days, a reprogramming efficiency even higher than that of XEN-like cells.
[0267] CiPSCs generated from eXENs and CeXENs were further characterized to possess an expression pattern similar to pluripotency stem cells (
DISCUSSION
[0268] In summary, we demonstrated a XEN-like state as an intermediate for chemical reprogramming, which differs from other reprogramming scenarios. The chemical reprogramming process can be divided into two major steps. In the first step of reprogramming, fibroblasts are directly converted into XEN-like cells, whereas in the later step of reprogramming, XEN-like cells are converted into CiPSCs (
[0269] The determination of the role of a XEN-like state in chemical reprogramming uncovered a unique route in chemical reprogramming of somatic cells toward pluripotency, but not in OSKM-induced reprogramming (
[0270] Moreover, the XEN-like state is unique, as it is primed to undergo further conversion to the pluripotency state. Similarly to XEN cells in vivo, the induced XEN-like cells have already expressed Sall4 and Lin28a, two master genes of pluripotency. It is possible that the shared genes that are expressed in both XEN cells and pluripotent stem cells, such as Sall4 and Lin28a, make the pluripotency state more accessible during the cell fate transition from the XEN-like state to pluripotency. Moreover, sequential expression of many pluripotency marker genes in XEN-like cells, during stage 2 of chemical reprogramming was also demonstrated. For example, the expression of Esrrb and Oct4 was activated, and the expression of Oct4 was compatible with the expression of XEN genes. This finding indicates that the pluripotency network is easily established in XEN-like cells. This finding is consistent with the recent report that in vivo XEN cells spontaneously transition into epiblast stem cells, which are in a primed pluripotency state (Xenopoulos et al., Cell Reports, 10:1508-1520 (2015). The compatibility of XEN-like genes and the expression of pluripotency genes make the XEN-like state an ideal bridge between somatic cells and pluripotent cells.
[0271] These studies establish that XEN-like state is essential for inducing pluripotency during chemical reprogramming, possibly because that the master genes of XEN directly contribute to the establishment of pluripotency. In addition, the studies suggest that XEN-like genes may have dual roles in chemical reprogramming. As previously reported, there are several mutual antagonistic mechanisms between XEN genes and pluripotency-associated genes, such as the incompatibility between Sox17 and Sox2 and between Gata6 and Nanog (Aksoy et al., The EMBO Journal 32:938-953 (2013); Chazaud et al., Developmental Cell, 10:615-624 (2006; Niakan et al., Genes & Development, 24:312-326 (2010). In this study, the expression of Sox2 was repressed by the XEN genes. Further, during stage 3 of chemical reprogramming, the expression of Nanog and Sox2 was incompatible with the expression of Gata4, reminiscent of the cell fate determination between XENs and epiblasts regulated by FGF/ERK signaling in the mouse blastocyst as previously reported (Yamanaka et al., Development, 137:715-724 (2010). During the early stage of chemical reprogramming, the XEN state is necessary to initiate the expression of select pluripotency genes, such as Sall4, Lin28a and Oct4. However, in the later stage of reprogramming, these XEN genes need to be silenced to initiate the expression of additional pluripotency genes, such as Nanog and Sox2.
[0272] Most important, in this study, chemical reprogramming was greatly improved by manipulating cell fate transitions through the XEN-like state, through careful selection the small-molecule cocktails which bias cells towards the XEN-like state, and then CiPSC, concentrations, durations and other details of cell manipulation during each stage, greatly improving the efficiency of CiPSC generation and increasing the total yields of CiPSC colonies by up to 1,000-fold compared a chemical reprogramming protocol which does not proceed via biasing to a XEN-like state as described herein.