PLASMODIUM WITH HISTAMINE RELEASING FACTOR (HRF) DEFICIENCY FOR USE AS A VACCINE
20190282680 ยท 2019-09-19
Inventors
Cpc classification
A61K39/015
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K35/68
HUMAN NECESSITIES
International classification
A61K39/015
HUMAN NECESSITIES
A61K35/68
HUMAN NECESSITIES
Abstract
A method of generating an antibody and cellular immune response against a Plasmodium in a primate, comprising administering at least 10.sup.3 genetically modified live Plasmodium to the primate, wherein the genetically modified live Plasmodium is a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium, and wherein the genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein, to thereby induce an antibody and cellular immune response against the Plasmodium in the primate. In some embodiments at least 10.sup.4 genetically modified live Plasmodium is administered to the primate. An immunogenic composition for administration to a primate, comprising a at least 10.sup.3 genetically modified live Plasmodium wherein the genetically modified live Plasmodium is a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium, and wherein the genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein; and at least one pharmaceutically acceptable excipient and/or support. In some embodiments the immunogenic composition comprises at least 10.sup.3 genetically modified live Plasmodium.
Claims
1. A method of generating an antibody and cellular immune response against a Plasmodium in a primate, comprising administering at least 10.sup.3 genetically modified live Plasmodium to the primate, wherein the genetically modified live Plasmodium is a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium, and wherein the genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein, to thereby induce an antibody and cellular immune response against the Plasmodium in the primate.
2. The method of claim 1, wherein the HRF coding sequence is deleted in the genome of the genetically modified live Plasmodium.
3. The method of any one of claims 1 to 2, wherein the genetically modified live Plasmodium is a Plasmodium falciparum.
4. The method of any one of claims 1 to 3, wherein the genetically modified live Plasmodium does not cause cerebral malaria when administered to the primate.
5. The method of any one of claims 1 to 4, wherein the primate is a human.
6. The method of any one of claims 1 to 5, wherein the antibody response comprises an IgG3 and IgG1 antibody response.
7. The method of any one of claims 1 to 6, wherein the cellular immune response comprises an FcR+ CD 11b+ phagocytic cellular immune response.
8. The method of any one of claims 1 to 7, wherein the genetically modified live Plasmodium does not produce a functional form of one ore more of purine nucleoside phosphorylase, nucleoside transporter 1, UIS3, UIS4, p52, p36, and HMGB2.
9. The method of any one of claims 1 to 8, wherein the HMGB2 coding sequence is deleted in the genome of the genetically modified live Plasmodium.
10. The method of any one of claims 1 to 9, wherein the genetically modified live Plasmodium is in an intra-erythrocytic form.
11. The method of claim 10, wherein the genetically modified live Plasmodium is in the form of intra-erythrocytic trophozoites, merozoites or schizonts.
12. The method of claim 11, wherein the genetically modified live Plasmodium is in the form of intra-erythrocytic merozoites or schizonts.
13. The method of any one of claims 1 to 9, wherein the genetically modified live Plasmodium is in the form of sporozoites.
14. The method of any one of claims 1-13, wherein the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 68 days following administration of the genetically modified live Plasmodium.
15. The method of claim 14, wherein the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 396 days following administration of the genetically modified live Plasmodium.
16. The method of any one of claims 1-15, wherein the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 25 days following administration of the genetically modified live Plasmodium.
17. The method of any one of claims 1-16, wherein administering the genetically modified live Plasmodium induces an increase of at least 50% in plasma IL-6.
18. The method of any one of claims 1-17, wherein administering the genetically modified live Plasmodium induces a decrease of at least 50% in spleen PD1+ T cells.
19. The method of any one of claims 1-18, wherein an infectious dose of at least 10.sup.4 genetically modified live Plasmodium is administered.
20. An immunogenic composition for administration to a primate, comprising a at least 10.sup.3 genetically modified live Plasmodium wherein the genetically modified live Plasmodium is a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium, and wherein the genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein; and at least one pharmaceutically acceptable excipient and/or support.
21. The immunogenic composition of claim 20, wherein the HRF coding sequence is deleted in the genome of the genetically modified live Plasmodium.
22. The immunogenic composition of any one of claims 20 to 21, wherein the genetically modified live Plasmodium is a Plasmodium falciparum.
23. The immunogenic composition of any one of claims 20 to 22, wherein the genetically modified live Plasmodium does not cause cerebral malaria when administered to the primate.
24. The immunogenic composition of any one of claims 20 to 23, wherein the primate is a human.
25. The immunogenic composition of any one of claims 20 to 24, wherein administering the immunogenic composition to the primate generates an antibody and cellular immune response against Plasmodium in the primate.
26. The immunogenic composition of claim 25, wherein the antibody response comprises an IgG3 and IgG1 antibody response.
27. The immunogenic composition of claim 25 or 26, wherein the cellular immune response comprises an FcR+ CD 11b+ phagocytic cellular immune response.
28. The immunogenic composition of any one of claims 20 to 27, wherein the genetically modified live Plasmodium does not produce a functional form of one or more of purine nucleoside phosphorylase, nucleoside transporter 1, UIS3, UIS4, p52, p36, and HMGB2.
29. The immunogenic composition of any one of claims 20 to 28, wherein the HMGB2 coding sequence is deleted in the genome of the genetically modified live Plasmodium.
30. The immunogenic composition of any one of claims 20 to 29, wherein the genetically modified live Plasmodium is in an intra-erythrocytic form.
31. The immunogenic composition of claim 30, wherein the genetically modified live Plasmodium is in the form of intra-erythrocytic trophozoites, merozoites or schizonts.
32. The immunogenic composition of claim 31, wherein the genetically modified live Plasmodium is in the form of intra-erythrocytic merozoites or schizonts.
33. The immunogenic composition of any one of claims 20 to 29, wherein the genetically modified live Plasmodium is in the form of sporozoites.
34. The immunogenic composition of any one of claims 20 to 33, wherein administering the immunogenic composition to the primate induces a protective immune response such that the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 68 days following administration of the genetically modified live Plasmodium.
35. The immunogenic composition of claim 34, wherein administering the immunogenic composition to the primate induces a protective immune response such that the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 396 days following administration of the genetically modified live Plasmodium.
36. The immunogenic composition of any one of claims 20 to 35, wherein administering the immunogenic composition to the primate induces a protective immune response such that the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 25 days following administration of the genetically modified live Plasmodium.
37. The immunogenic composition of any one of claims 20 to 36, wherein administering the immunogenic composition to the primate induces an increase of at least 50% in plasma IL-6.
38. The immunogenic composition of any one of claims 20 to 37, wherein administering the immunogenic composition to the primate induces a decrease of at least 50% in spleen PD1+ T cells.
39. The immunogenic composition of any one of claims 20 to 38, further comprising at least one immunological adjuvant.
40. The immunogenic composition of any one of daims 20 to 39, wherein the immunological adjuvant is selected from muramyl peptide type adjuvants, trehalose dimycolate (TDM), lipopolysaccharide (LPS), monophosphoryl lipid A (MPL), carboxymethylcellulose, complete Freund's adjuvant, incomplete Freund's adjuvant, adjuvants of oil-in-water emulsion type optionally supplemented with squalene or squalane, mineral adjuvants, bacterial toxins, CpG oligodeoxynucleotides, saponins, synthetic copolymers, cytokines, imidazoquinolones, and combinations thereof.
41. The immunogenic composition of any one of claims 20 to 40, formulated for parenteral administration to a primate.
42. The immunogenic composition of any one of claims 20 to 41, formulated for administration of an infectious dose of at least 10.sup.4 genetically modified live Plasmodium.
43. The immunogenic composition of any one of claims 20 to 42, for use as an immunogenic protective composition in a primate, in particular in a human, against clinical malaria.
44. The immunogenic composition of any one of claims 20 to 42, for use as an immunogenic protective composition in a primate, in particular in a human wherein said primate is naive for Plasmodium infection.
45. The immunogenic composition of any one of claims 20 to 42, for use in a primate, in particular in a human, wherein the primate has been previously therapeutically treated against malaria, said composition being protective against subsequent infection by a Plasmodium parasite.
46. The immunogenic composition of any one of claims 20 to 42, for use in a primate, in particular in a human, as a cross-stage and cross-species protective composition against Plasmodium infection or against malaria.
47. A process of preparing an immunogenic composition according to any one of claims 20-42 suitable for generating an immune response, in particular an antibody response against a Plasmodium in a primate, wherein the process comprises admixing at least 10.sup.3 genetically modified live Plasmodium wherein the genetically modified live Plasmodium is a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium, and wherein the genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein; and at least one pharmaceutically acceptable excipient and/or support.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064] Ther colours described in respect of
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
TABLE-US-00001 TABLE3 ListofoligonucleotidesusedforRT-qPCRanalyses SEQ Fw/ ID Primer Rev Sequence No Pb18S Fw ATTAATCTTGAACGAGGAATGGCT 1 Rev TCAATCGGTAGGAGCGACG 2 Pb Fw GCCAAATGCTAAACCTAATG 3 LSP2 Rev TGGGTTTGTATTGTATGCAC 4 Pb Fw TGCAGCTAATCAAACTC 5 HSP70 Rev ACTTCAATTTGTGGAACACC 6 muIL- Fw CCACCAGGACTCAAGGACAACA 7 23 Rev GCAGGCTCCCCTTTGAAGA 8 mu Fw CAGAGTGCAATGCCATGCTCC 9 EBB Rev GCCACACCGAGCCTGTAAGT 10 muIL- Fw TACTAGAGAGACTTCTTCCACAACAAGAG 11 12p35 Rev GATTCTGAAGTGCTGCGTTGAT 12 muIL- Fw GGAAGCACGGCAGCAGAATA 13 12p40 Rev AACTTGAGGGAGAAGTAGGAATGG 14 mu Fw AAAGGATGCATTCATGAGTATTGC 15 IFN- Rev CGCTTCCTGAGGCTGGATT 16 mu Fw CATCTTCTCAAAATTCGAGTGACAA 23 TNF- Rev TGGGAGTAGACAAGGTACAACCC 24 muIL- Fw AAAGAAATGATGGATGCTACCAAAC 17 6 Rev CTTGTTATCTTTTAAGTTGTTCTTCATGTACTC 18 muIL- Fw GGCGCTGTCATCGATTTCTC 19 10 Rev GACACCTTGGTCTTGGAGCTTATTAA 20 mu Fw CTGGTGAAAAGGACCTCTCG 21 HPRT Rev TGAAGTACTCATTATAGTCAAGGGCA 22
[0071]
[0072]
[0073]
[0074]
[0075]
DETAILED DESCRIPTION
A. Introduction
[0076] While most vaccines against blood-stage malaria in development today use subunit preparations, live attenuated parasites confer significantly broader and more lasting protection. In recent years Plasmodium genetically attenuated parasites (GAP) have been generated in rodent models that cause self-resolving blood-stage infections and induce strong protection. All such GAP generated so far bear mutations in house keeping genes important for parasite development in red blood cells.
[0077] In prior work the inventors used a P. berghei model based on strain P. berghei ANKA (PbANK A) in which function of HRF is eliminated. PbANK A causes cerebral malaria in susceptible mice, with lesions starting at day 5 post-infection (p.i.) and mice dying from day 7-8 p.i. Thus, use of this PbANK A precludes study of adaptive immunity. In the context of that model the data suggested that HRF is not important during the erythrocytic phase of infection, but is instead important during the pre-erythrocytic phase of infection, which mainly consists in the transformation in the liver of the mosquito-injected parasite form into the erythrocyte-infecting form. Development of P. berghei ANKA c115cy1 liver stages lacking HRF is impaired and associated with an early rise in systemic IL-6, a cytokine that strongly suppresses development of Plasmodium liver stages.
[0078] The inventors generated the data reported in the examples using a different model. Specifically, the inventors have used, as an animal model of malaria, C57BL/6 mice infected with the P. berghei NK65 parasite (PbNK65). PbNK65 does not cause cerebral malaria but hyperparasitemia, leading to mouse death by sever anemia around day 25 p.i. This new model is, therefore, compatible with tracking anti-blood stage immune responses over time. Using this new model the inventors were unexpectedly able to demonstrate a novel blood-stage GAP that lacks a secreted factor related to histamine-releasing factor (HRF). Lack of HRF causes IL-6 increase, which boosts T and B cell responses to resolve infection in a cross-stage-, and cross-species-transcendant manner with a long-lasting immunity. Mutant-induced protection involves a combination of anti-parasite IgG2c antibodies and FcR.sup.+ CD11b.sup.+ cells phagocytes, especially neutrophils, which are sufficient to confer protection. This immune-boosting GAP highlights an important role of opsonized parasite-mediated phagocytosis, which may be central to protection induced by all self-resolving, blood-stage GAP infections. In order to better understand the molecular basis of the PbNK65 hrf-induced protection, the inventors have furthermore analysed CD4.sup. and CD8.sup. T cells and memory B cells responses to PbNK65 in C57BL/6J mice in more details.
[0079] This disclosed data demonstrate that abortive blood-stage infection leading to lasting protection can be achieved not just by impairing parasite intracellular growth but also by enhancing protective immune responses. Indeed, lack of HRF leads to an increase in IL-6, which does not affect parasite growthper se since PbNK65-hrf blood stages multiply normally in mice until day 10. Rather, IL-6, which is involved in B and T cell differentiation, boosts anti-parasite adaptive responses that clear parasites. Like with previously reported blood-stage GAPs that induce abortive infections, the protective response to PbNK65-hrf parasites is both solid, conferring cross-stage and cross-species immunity, and durable. The inventors have found that the protective response relies on the combination of anti-parasite IgG2c antibodies and FcR+ CD11b+ cells phagocytic cells, in particular neutrophils, which are sufficient for solid protection. Interestingly, the discovery of a B-helper neutrophil population in the spleen that can act as professional helper cells for marginal zone B-cells (Puga et al., 2012) highlights a neutrophil-B cell interplay that may be critical for B cell differentiation into antibody-producing plasma cells and may also contribute to inhibit the well-known Plasmodium capacity to induce short-lived B-cell memory (Wykes et al., 2005). Opsonic phagocytosis was also described as a protective mechanism induced by the plasmepsin-4-deficient mutant (Spaccapelo et al., 2010). Whether this represents the essential protective mechanism common to all self-resolving infections remains to be determined. In addition, by exploring the immunological mechanisms underlying the anti-parasite protective properties of the mutant PbNK65-hrf the inventors have demonstrated that in addition to an up-regulation of IL-6 production, CD4.sup.+ but not CD8.sup.+ T effector lymphocytes are indispensable for the clearance of malaria infection. Maintenance of T cell-associated protection is associated with the reduction in CD4.sup.+PD1.sup.+ and CD8.sup.+PD1.sup.+ T cell numbers. A pivotal role in protection was also conferred by a higher number of central and effector memory B cells observed in mice infected with the mutant parasite. Importantly, the inventors also demonstrated that prior infection with WT parasites followed by a drug cure does not prevent the induction of PbNK65-hrf-induced protection, suggesting that such protection may be efficient even in individuals that have been infected and who repeatedly received antimalarial drugs.
[0080] Thus, in a first aspect, the present invention relates to a method of generating an antibody and cellular immune response against a Plasmodium in a primate, comprising administering at least 10.sup.3 genetically modified live Plasmodium to the primate, and wherein the infectious genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein, to thereby induce an antibody and cellular immune response against the Plasmodium in the primate. The Plasmodium is preferably capable of developing in primates, and more particularly in humans. In some embodiments the Plasmodium belongs to the subgenus selected from the group consisting of Plasmodium vinckeia, Plasmodium plasmodium and Plasmodium laverania. In some embodiments the Plasmodium is a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium. According to one embodiment, the Plasmodium is capable of developing in a human host and belongs to the subgenus Plasmodium plasmodium or Plasmodium laverania. Preferably, the Plasmodium belongs to a species responsible for malaria in humans, more particularly to a species selected from the group consisting of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium. More preferably, the Plasmodium belongs to a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. According to one particular embodiment, the Plasmodium belongs to a species selected from the group consisting of Plasmodium falciparum, Plasmodium vivax and Plasmodium malariae. According to one preferred embodiment, the Plasmodium belongs to the species Plasmodium falciparum.
[0081] According to another embodiment, the Plasmodium belongs to a species which is capable of inducing an immune reaction but is not capable of causing the symptoms of malaria in human beings. Preferably, this parasite is a rodent parasite belonging to the subgenus Plasmodium vinckeia. The use of rodent parasites in the context of vaccination in humans makes it possible to considerably reduce the risks associated with the administration of live parasites to the subject. The rodent parasite can be modified so as to express one or more proteins of a Plasmodium which infects humans, such as P. falciparum, which is or are required for the invasion of human red blood cells. Such proteins are, for example, described in the article by Triglia et al., 2000. Preferably, the parasite belongs to the species Plasmodium berghei or Plasmodium yoelii. More particularly preferably, the parasite belongs to the species Plasmodium berghei. According to one preferred embodiment, the parasite is the NK65 isolate of the species Plasmodium berghei.
[0082] According to another embodiment, the Plasmodium belongs to a species selected from the group consisting of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. The Plasmodium may also belong to a species selected from the group consisting of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale and Plasmodium malariae or from the group consisting of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax and Plasmodium malariae, or else from the group consisting of Plasmodium berghei and Plasmodium falciparum.
[0083] In one embodiment, the Plasmodium strain doesn't cause cerebral malaria in primates and/or humans.
[0084] According to one preferred embodiment, the wild-type strain of the Plasmodium, i.e. the Plasmodium in which HRF function is not reduced or eliminated, does not cause cerebral malaria. This strain may, for example, be chosen from the group consisting of Plasmodium berghei NK65, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. This strain may also be a Plasmodium falciparum strain which has lost its cytoadherence capacity or which has a reduced cytoadherence capacity. According to one embodiment, the wild-type strain of the Plasmodium is a non-cytoadherent Plasmodium falciparum strain. According to another embodiment, the wild-type strain of the Plasmodium is a Plasmodium falciparum strain which has a reduced cytoadherence capacity. Cytoadherence is a property of Plasmodium falciparum which is directly linked to the development of cerebral malaria. Indeed, red blood cells infected with a cytoadherent Plasmodium falciparum strain have the capacity to bind to surface molecules of endothelial cells, such as CD36, ICAMI, VCAMI or PECAM1/CD31, and thus to cause avascular obstruction, inflammation and damage in various organs, in particular in the brain. The cytoadherence capacity of a strain can be evaluated by any technique known to those skilled in the art, such as, for example, that described in the article by Buffet et al., 1999 or that by Traore et al., 2000. The term reduced cytoadherence capacity refers to a cytoadherence capacity which is lower than that observed on a reference cytoadherent Plasmodium strain, for example the Plasmodium falciparum 3D7 strain. The cytoadherence can be reduced by at least 40%, 50%, 60%, 70%, 80%, 90% or 95%, preferably by at least 80%, and more particularly preferably by at least 90%, relative to a reference cytoadherent Plasmodium strain, for example the Plasmodium falciparum 3D7 strain. It is possible to obtain Plasmodium falciparum strains which have a reduced cytoadherence capacity, for example by multiplying the passages in culture ex vivo (Udeinya et al., 1983). Various Plasmodium falciparum strains with a reduced cytoadherence capacity have been described, for example in the article by Trenholme et al., 2000 (Plasmodium falciparum in which the clag9 gene is inactivated) and by Nacer et al., 2011 (Plasmodium falciparum D10 and T9-96). Thus, according to one particular embodiment, the wild-type strain of the Plasmodium is a Plasmodium falciparum strain which is sparingly cytoadherent or non-cytoadherent. In particular, the wild-type strain of the Plasmodium may be a Plasmodium falciparum strain with a reduced cytoadherence capacity, selected from the group consisting of a Plasmodium falciparum strain in which the clag9 gene is inactivated, of the Plasmodium falciparum D10 strain and of the Plasmodium falciparum T9-96 strain.
[0085] The infectious genetically modified live Plasmodium used in the invention does not produce functional histamine releasing factor (HRF) protein. For example, it is possible to block the function of the gene encoding HRF at the transcriptional or translational level or to block HRF function at the protein level, for example by blocking or decreasing the transcription or the translation of the HRF gene or by disrupting the correct folding of the protein or its activity. In a preferred embodiment HRF function is reduced or eliminated by mutating the HRF coding sequence in the genome of the Plasmodium.
[0086] The function of the HRF gene can in particular be inactivated by the total or partial deletion of this gene, or the insertion or the substitution of one or more nucleotides in order to make this gene inactive. According to one particular embodiment, the function of the HRF gene is inactivated by total or partial deletion of this gene, preferably by total deletion.
[0087] Preferably, the deletion of the HRF gene is obtained by homologous recombination. This method is well known to those skilled in the art and has been applied many times to the parasites of the Plasmodium genus (see, for example, Thathy and Mnard, 2002). According to one particular embodiment, the coding region of the HRF gene is replaced by homologous recombination with a marker which makes it possible to select the parasites in which the recombination has taken place. The selectable marker may be, for example, the human dihydrofolate reductase (dhfr) gene which confers pyrimethamine resistance on the Plasmodium. The obtaining of Plasmodium in which the HRF gene is deleted is exemplified in the Examples section. According to one particular embodiment of the invention, the Plasmodium used is a Plasmodium in which the HRF gene has been replaced with a selectable marker, preferably with the human dhfr gene. According to one very particular embodiment of the invention, the Plasmodium is a Plasmodium berghei, preferably the NK65 isolate, in which the Plasmodium gene has been replaced with a selectable marker, preferably with the human dhfr gene. According to another particular embodiment of the invention, the parasite used is a Plasmodium falciparum, which is preferably non-cytoadherent or sparingly cytoadherent, in which the Plasmodium gene has been replaced with a selectable marker, preferably with the human dhfr gene. As exemplary method of deleting the HRF gene is presented in the examples section of this application.
[0088] The function of the HRF gene can also be inactivated by blocking or decreasing the translation of the mRNA of this gene. RNA interference, which makes it possible to specifically inhibit the expression of the target gene, is a phenomenon well known to those skilled in the art that has already been used to inhibit the expression of Plasmodium genes (see, for example, McRobert and McConkey, 2002; Mohmmed et al., 2003; Gissot et al. 2004). According to one embodiment, a sequence encoding an interfering RNA, or its precursor, is introduced into the genome of the parasite and its expression is controlled by a strong promoter, preferably a constitutive promoter, such as, for example, the promoter of the eEF 1 a elongation factor, which is active in all stages of the development of the parasite, or the promoter of the HSP70 gene, which is active in the sporozoites and during the erythrocytic cycle. The sequence and the structure of the interfering RNA can be easily chosen by those skilled in the art. In particular, the interfering RNA used may be a small interfering RNA (siRNA).
[0089] It is also feasible to block the function of HRF by introducing mutations in the binding domain to calcium of the protein. Indeed a key function of HRF is its binding to calcium. Deletion constructs of rat TCTP determined that the calcium-binding region of TCTP is confined to residues 81-112 using a 45Ca.sup.2+ overlay assay (Kim et al., 2000, Identification of the calcium binding sites in translationally controlled tumor protein. Arch Pharm Res 23, 633-6). However, in a recent report the calcium-binding site of human TCTP was determined by NMR, and was found to involve the residues N131, Q133, L149 and D150, with very low affinity (Feng et al., 2007, Feng Y., Liu D., Yao H. and Wang J. (2007) Solution structure and mapping of a very weak calcium-binding site of human translationally controlled tumor protein by NMR. Arch Biochem Biophys 467, 48-57). Mutations in codons of the HFR gene coding for these residues will alter the calcium binding function, which result in profound alterations of HRF biological activities.
[0090] One of the important features of mammalian HRF is the binding to immunoglobulins, including IgE. A major Ig-binding site was mapped to the N-terminal 19-residue peptide (N19). A synthetic N19 peptide also inhibited IgE binding to HRF and did not alter the growth or survival of various cells, but it blocked mast cell activation.(Jun-ichi Kashiwakura et al. Histamine-releasing factor has a proinflammatory role in mouse models of asthma and allergy J Clin Invest. 2012 Jan. 3; 122(1): 218-228). Since Plasmodium HRF is also endowed with histamine releasing activities from basophils, mutations in or deletion of the 19 N-terminal residues of Plasmodium HFR will abrogate this function and render HRF non functional.
[0091] In another preferred embodiment of the invention, the deletion of the HRF coding gene is obtained using the CRISPR-Cas9 system as illustrated in
[0092] The GenBank and PlasmoDB references of the sequences of HRF genes of various Plasmodium species that have been sequenced and also those of the corresponding protein sequences are given in the table below.
TABLE-US-00002 GenBank PlasmoDB Plasmodium Species reference number reference number P. berghei ANKA XM_674443.1 PBANKA_1110500 P. chabaudi chabaudi XM_737401.1 PCHAS_1110200 P. yoelii yoelii 17X XM_720179.1 PY17X_1111700 P. yoelii YM PYYM_1112700 P. falciparum 3D7 XM_001351631.1 PF3D7_0511000 P. falciparum IT PFIT_0511100 P. knowlesi strain H XM_002259671.1 PKNH_1022600 P. vivax Sal-l XM_001613795.1 PVX_080685 P. reichenowi XM_012906171.1 PRCDC_0510200 (strain CDC) P. cynomolgi strain B XM_004222856.1 P. vinckei vinckei XM_008626260.1 P. inui San Antonio 1 XM_008816858.1
[0093] The HRF genes of the Plasmodium species that have not yet been sequenced can be easily identified by means of methods well known to those skilled in the art, in particular by hybridization or PCR.
[0094] In the Plasmodium according to the invention, the function of one or more genes other than HRF can also be inactivated so that the corresponding functional protein encoded by the gene is not produced. The additional protein/gene of which the function is inactivated can be a gene which participates in the survival of the parasite in a mammalian host, in particular in humans. Preferably, the inactivation of this additional gene makes it possible to attenuate the virulence of the parasite while at the same time preserving its immunogenic nature. This additional gene can be chosen from the group consisting of purine nucleoside phosphorylase (PNP; PFE0660c), nucleoside transporter 1 (NT 1; PF13_0252), UIS3 (PF13_0012), UIS4 (PF10_0164 early transcript), p52, (PFD0215c protein with 6-cysteine motif) and p36 (PFD021 Oc), hmgb2, and also combinations thereof (the references between parentheses are the PlasmoDB bank accession numbers of the Plasmodium falciparum 3D7 sequences, given here by way of example). Preferably the additional gene(s) is or includes hmgb2. Methods of inactivating one or more of these genes are well known in the art and generally include the methods usefol to inactivate the HRF gene as discussed above. Suitable methods are also provided, for example in US 2014/015489 A1.
[0095] The methods for growing the Plasmodium according to the invention and also the methods of preservation, in particular of cryopreservation, of the Plasmodium have been described previously and are well known to those skilled in the art (see, for example, Leef et al., 1979; Orjih et al., 1980). This Plasmodium can be grown ex vivo using cell cultures or in vivo in an animal, for example a mouse.
[0096] According to one embodiment, the Plasmodium according to the invention is used in an erythrocytic form, more particularly in the form of non-intra-erythrocytic merozoites or in the form of intra-erythrocytic merozoites, trophozoites or schizonts.
[0097] According to one particular embodiment, the Plasmodium according to the invention is used in the form of intra-erythrocytic merozoites, trophozoites or schizonts, i.e. which are inside red blood cells.
[0098] According to another particular embodiment, the Plasmodium is used in the form of non-intra-erythrocytic merozoites, i.e. of merozoites which have been partially or totally purified after rupturing of parasitized red blood cells. The merozoites can be obtained according to any one of the methods known to those skilled in the art, such as that described in the article by Boyle et al., 2010.
[0099] The parasitized red blood cells can be obtained by introduction of the Plasmodium into a host, preferably a human-being, and recovery of the red blood cells of the infected host when the parasitaemia reaches a minimum 1%, preferably between 5% and 10%. According to one preferred embodiment, the parasitized red blood cells are recovered from a human host whose blood group is O and who is Rhesus negative.
[0100] According to another preferred embodiment, the parasitized red blood cells are obtained by ex vivo infection of human red blood cells, preferably red blood cells which are blood group O and Rhesus negative. Optionally, the parasitized red blood cell cultures can be synchronized so as to obtain predominantly intra-erythrocytic merozoites, trophozoites or schizonts. The methods for ex vivo culturing of Plasmodium parasites are well known to those skilled in the art (see, for example, Trager and Jensen, 1976).
[0101] Anticoagulants, such as heparin, can be added to the parasitized red blood cells thus obtained. The parasitized red blood cells can be preserved by freezing in the presence of one or more cryoprotective agents compatible with use in vivo, such as, for example, glycerol or dimethyl sulphoxide (DMSO). The parasitized red blood cells can also be preserved by refrigeration at 4 C. in an appropriate preserving medium, for example SAGM (Saline Adenine Glucose Mannitol) medium or a CPD (Citrate Phosphate Dextrose) solution, but for a period not exceeding approximately 45 days.
[0102] According to another embodiment, the parasites according to the invention are used in the form of sporozoites. The sporozoites can be obtained by introduction of the parasite into a mosquito host where it will multiply. The sporozoites are then recovered from the salivary glands of the infected mosquitoes. The sporozoites thus obtained can be preserved by freezing, for example in liquid nitrogen, before being thawed in order to be injected live into a host. Alternatively, after recovery from the salivary glands of the mosquitoes, the sporozoites can be preserved by lyophilization or refrigeration before administration.
[0103] The administration of the Plasmodium according to the invention to a subject makes it possible, despite a rapid parasite clearance, to induce in the subject an immunity, lasting several months, with respect to an infection with a Plasmodium, in particular a Plasmodium chosen from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium. In some embodiments the Plasmodium is chosen from the group consisting of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae and Plasmodium knowlesi, preferably Plasmodium falciparum. This immunity can in particular be a cross-immunity with respect to an infection with a Plasmodium strain other than that of the parasite used. In particular, the administration of a parasite according to the invention belonging to a strain which does not cause cerebral malaria can result in a cross-immunity with respect to an infection with a Plasmodium strain capable of causing this severe neurological complication. The parasite according to the invention can therefore be used for the prevention of malaria and/or of cerebral malaria. In particular, the administration of the parasite according to the invention to a subject makes it possible to induce an immunity, lasting several months, with respect to an infection with a Plasmodium falciparum capable of inducing cerebral malaria and thus to prevent malaria and/or cerebral malaria induced by this parasite.
[0104] The methods of the invention typically comprise administration of at least 10.sup.3 genetically modified live Plasmodium to a primate per dose. In some embodiments from 10.sup.3 to 10.sup.8 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments from 10.sup.4 to 10.sup.8 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments from 10.sup.3 to 10.sup.5 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments from 10.sup.4 to 10.sup.6 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments from 10.sup.5 to 10.sup.7 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments from 10.sup.4 to 10.sup.5 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments at least 10.sup.3 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments at least 10.sup.4 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments at least 10.sup.5 genetically modified live Plasmodium is administered to a primate per dose. In some embodiments at least 10.sup.6 genetically modified live Plasmodium is administered to a primate per dose.
[0105] In some embodiments the immunogenic composition is administered from one to five times, such as one time, two times, three times, four times, or five times. In some embodiments comprising a plurality of administrations the doses are administered over a period of 30 days, 60 days, 90 days, one year or more than one year. In some embodiments a dose is admini stered annually.
[0106] In a particular embodiment, the administered genetically modified live Plasmodium is P. falciparum and it is administered to a human being.
[0107] In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 50% for a period of at least 68 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 68 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 80% for a period of at least 68 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 85% for a period of at least 68 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 90% for a period of at least 68 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 95% for a period of at least 68 days following administration of the genetically modified live Plasmodium.
[0108] In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 50% for a period of at least 396 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 396 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 80% for a period of at least 396 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 85% for a period of at least 396 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 90% for a period of at least 396 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 95% for a period of at least 396 days following administration of the genetically modified live Plasmodium.
[0109] In some embodiments of the methods, the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 50% for a period of at least 25 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 25 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 80% for a period of at least 25 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 85% for a period of at least 25 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 90% for a period of at least 25 days following administration of the genetically modified live Plasmodium. In some embodiments of the methods, the likelihood that the primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 95% for a period of at least 25 days following administration of the genetically modified live Plasmodium.
[0110] In some embodiments of the methods, the antibody and cellular immune response generated by the administration of genetically modified live Plasmodium to the primate is a protective immune response of Th1 type.
[0111] In some embodiments of the methods administering the genetically modified live Plasmodium to the primate induces an increase of at least 50% in plasma IL-6. In some embodiments of the methods administering the genetically modified live Plasmodium to the primate induces an increase of at least 100% in plasma IL-6. In some embodiments of the methods administering the genetically modified live Plasmodium to the primate induces an increase of at least 150% in plasma IL-6. In some embodiments of the methods administering the genetically modified live Plasmodium to the primate induces an increase of at least 200% in plasma IL-6.
[0112] In some embodiments of the methods administering the genetically modified live Plasmodium to the primate induces a decrease of at least 50% in spleen PD1+ T cells, preferably in spleen PD1+ CD8+ CD62L cells and spleen PD1+ CD4+ CD62L cells.
[0113] In some embodiments of the methods the antibody response generated by the administration of genetically modified live Plasmodium to the primate consists in antibodies against parasite proteins from wild type Plasmodium-infected red blood cells. Preferably, parasite proteins recognized by the produced antibodies are merozoite surface protein 1 (MSP1), serine repeat antigen 1(SERA1) and 2 (SERA2), Rhoptry protein (RhopH3) and octopeptide-repeat antigen.
[0114] In some embodiments of the methods, the cellular immune response generated by the administration of genetically modified live Plasmodium to the primate comprises phagocytic cells, and preferably FcR+ CD11b+ phagocytic cells, and more preferably neutrophils.
[0115] In some embodiments of the methods the antibody response is detectable by Western blot, for example by using the method disclosed in the examples.
[0116] In some embodiments of the methods the antibody response is detectable by ELISA, for example by using the method disclosed in the examples.
[0117] In another aspect, the present invention relates to an immunogenic composition for administration to a primate, comprising a at least 10.sup.3 genetically modified live Plasmodium, wherein the infectious genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein; and at least one pharmaceutically acceptable excipient and/or support. The Plasmodium included in the composition is as described above.
[0118] According to one embodiment, the composition comprises a Plasmodium according to the invention in an erythrocytic form, more particularly in the form of intra-erythrocytic merozoites, trophozoites or schizonts or of non-intra-erythrocytic merozoites, preferably in the form of intra-erythrocytic merozoites, trophozoites or schizonts.
[0119] In some embodiments the composition comprises red blood cells parasitized with the Plasmodium according to the invention and which can be obtained according to the method described above and in the experimental section.
[0120] In some embodiments the Plasmodium included in the composition is in the form of sporozoites as described above.
[0121] In some embodiments the immunogenic composition is capable of inducing, in the subject to whom it is administered, a response of the immune system against the Plasmodium that it contains. In a particular embodiment, the immunogenic composition is intended for administration to a human being and it comprises P. falciparum forms as described herein.
[0122] The immunogenic compositions of the invention typically comprise at least 10.sup.3 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise from 10.sup.3 to 10.sup.8 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise from 10.sup.4 to 10.sup.8 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise from 10.sup.3 to 10.sup.5 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise from 10.sup.4 to 10.sup.6 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise from 10.sup.5 to 10.sup.7 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise from 10.sup.4 to 10.sup.5 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise at least 10.sup.3 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise at least 10.sup.4 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise at least 10.sup.5 genetically modified live Plasmodium per dose. In some embodiments the immunogenic compositions of the invention comprise at least 10.sup.6 genetically modified live Plasmodium per dose.
[0123] In preferred embodiments the immunogenic composition is used according to a method of the invention and is active therein. For example, in some embodiments of the immunogenic composition, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 50% for a period of at least 68 days following administration of the immunogenic composition to the primate. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 68 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 80% for a period of at least 68 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 85% for a period of at least 68 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 90% for a period of at least 68 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 95% for a period of at least 68 days following administration of the immunogenic compositions.
[0124] In some embodiments of the immunogenic composition, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 50% for a period of at least 396 days following administration of the immunogenic composition to the primate. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 396 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 80% for a period of at least 396 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 85% for a period of at least 396 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 90% for a period of at least 396 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop Plasmodium parasitemia following challenge with a wild type live Plasmodium is reduced by at least 95% for a period of at least 396 days following administration of the immunogenic compositions.
[0125] In some embodiments of the immunogenic compositions, the likelihood that a primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 50% for a period of at least 25 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 75% for a period of at least 25 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 80% for a period of at least 25 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 85% for a period of at least 25 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 90% for a period of at least 25 days following administration of the immunogenic compositions. In some embodiments of the immunogenic compositions, the likelihood that a primate will develop a blood stage Plasmodium infection following challenge with a wild type live Plasmodium is reduced by at least 95% for a period of at least 25 days following administration of the immunogenic compositions.
[0126] In some embodiments of the immunogenic compositions, administering the immunogenic compositions to a primate induces an increase of at least 50% in plasma IL-6. In some embodiments of the immunogenic compositions administering the immunogenic compositions to a primate induces an increase of at least 100% in plasma IL-6. In some embodiments of the immunogenic compositions administering the immunogenic compositions to a primate induces an increase of at least 150% in plasma IL-6. In some embodiments of the immunogenic compositions administering the immunogenic compositions to a primate induces an increase of at least 200% in plasma IL-6.
[0127] In some embodiments of the immunogenic compositions, administering the immunogenic compositions to the primate induces a decrease of at least 50% in spleen PD1+ T cells, preferably in spleen PD1+ CD8+ CD62L cells and spleen PD1 + CD4+ CD62L cells.
[0128] In some embodiments of the immunogenic compositions administering the immunogenic compositions to a primate induces an antibody response that is detectable by Western blot, for example by using the method disclosed in the examples.
[0129] In some embodiments of the immunogenic compositions administering the immunogenic compositions to a primate induces an antibody response that is detectable by ELISA, for example by using the method disclosed in the examples.
[0130] Preferably, the immunogenic composition is a malaria vaccine. In particular it is a malaria vaccine against P. falciparum for administration to a human being. In particular it is a malaria vaccine against P. falciparum that comprises P. falciparum forms as described herein.
[0131] According to some embodiments, the composition according to the invention is obtained by suspending parasitized red blood cells, merozoites or sporozoites, preferably parasitized red blood cells or sporozoites, as defined above, in one or more pharmaceutically acceptable excipients. The excipients can be easily chosen by those skilled in the art according to the form of the parasite, intra-erythrocytic, merozoites or sporozoites, and according to the route of administration envisaged. These excipients can in particular be chosen from the group consisting of sterile water, sterile physiological saline and phosphate buffer. Other excipients well known to those skilled in the art can also be used. Preferably, in the case where the composition comprises parasitized red blood cells, the excipient used is an isotonic solution which ensures the integrity of the red blood cells until administration of the composition to the subject. Preferably, the composition also comprises at least one anticoagulant such as heparin.
[0132] The composition can also be obtained by mixing Plasmodium sporozoites, as defined above, in particular P. falciparum sporozoites with a pharmaceutically acceptable support such as, for example, liposomes.
[0133] The excipients or supports used are chosen so as to ensure the integrity of the parasitized red blood cells and/or the survival of the sporozoites or of the merozoites. The excipients or supports used are chosen so as to ensure the survival of the parasites of the invention, whatever the form used (merozoites, sporozoites or intra-erythrocytic forms), until the administration of the composition to the subject to be immunized.
[0134] The composition according to the invention may be administered, for example, parenterally, cutaneously, mucosally, transmucosally or epidermally. Preferably, the composition is formulated so as to be administered parenterally, in particular subcutaneously, intramuscularly, intravenously or intradermally.
[0135] According to one particular embodiment, the Plasmodium is in an erythrocytic form, preferably included in red blood cells, and the composition is formulated so as to be administered parenterally, preferably subcutaneously, intramuscularly, intravenously or intradermally, and quite particularly preferably intravenously.
[0136] According to another particular embodiment, the Plasmodium is in the form of sporozoites and the composition is formulated so as to be administered parenterally, preferably subcutaneously, intramuscularly or intradermally, preferably intramuscularly or subcutaneously. The methods for administering compositions comprising live sporozoites are well known to those skilled in the art (see, for example, international patent application WO 2004/045559, Hoffman et al., 2010, Gueirard et al., 2010).
[0137] According to one embodiment, the Plasmodium is in erythrocytic form and included in red blood cells.
[0138] According to another embodiment, the Plasmodium is in the form of non-intra-erythrocytic merozoites.
[0139] According to yet another embodiment, the Plasmodium is in the form of sporozoites.
[0140] The dose to be administered can be easily determined by those skilled in the art by taking into account the physiological data of the subject to be immunized, such as the age or immune state thereof, the degree of immunity desired, the number of doses administered and the route of administration used. The dose to be administered can also vary according to the parasite preservation mode.
[0141] The composition according to the invention may comprise one or more strains of Plasmodium according to the invention. According to one embodiment, the composition comprises at least one Plasmodium falciparum strain and one Plasmodium vivax strain in which the function of the HRF gene is inactivated.
[0142] The composition according to the invention may also comprise one or more other genetically attenuated Plasmodium. These Plasmodium may, for example, exhibit a modification or an inactivation of the function of the purine nucleoside phosphorylase gene, nucleoside transporter 1, UIS3, UIS4, p52, p36, or hmgb2 gene, or be attenuated parasites obtained by irradiation. These Plasmodium preferably belong to a strain selected from the group consisting of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium. In a particular emboduiment the Plasmodium preferably belong to P. falciparum.
[0143] The composition according to the invention may also comprise one or more immunological adjuvants. These adjuvants stimulate the immune system and thus reinforce the immune response obtained with respect to the parasite according to the invention. These immunological adjuvants comprise, without being limited thereto, adjuvants of muramyl peptide type, such as N-acetylmuramyl-L-alanyl-D-isoglutamine (MDP) and derivatives thereof; trehalose dimycolate (TDM); lipopolysaccharide (LPS); monophosphoryl lipid A (MPL); carboxymethylcellulose; complete Freund's adjuvant; incomplete Freund's adjuvant; adjuvants of oil-in-water emulsion type optionally supplemented with squalene or squalane; mineral adjuvants such as alum, aluminium hydroxide, aluminium phosphate, potassium phosphate or calcium phosphate; bacterial toxins such as cholera toxin subunit B, the inactivated form of pertussis toxin or the thermolabile lymphotoxin from Escherichia coli; CpG oligodeoxynucleotides; saponins; synthetic copolymers such as copolymers of polyoxyethylene (POE) and polyoxypropylene (POP); cytokines; or imidazoquinolones. Combinations of adjuvants may be used. These various types of adjuvants are well known to those skilled in the art. In particular, the composition according to the invention may comprise one or more immunological adjuvants selected from the group consisting of CpG oligodeoxynucleotides and mineral adjuvants, in particular alum, and a combination thereof.
[0144] According to another aspect, the invention relates to the use of a live Plasmodium genus in which the function of the HRF gene is reduced or inactivated, for preparing a vaccine composition against malaria or cerebral malaria.
[0145] The invention also relates to a method for producing a vaccine composition against malaria or cerebral malaria according to the invention.
[0146] The invenbtion also relates to an immunogenic composition as defined in any of the herein described embodiuments, for use as an immunogenic protective composition in a primate, in particular in a human, against clinical malaria.
[0147] The immunogenic composition of the invention is in particular for use as an immunogenic protective composition in a primate, in particular in a human wherein said primate is naive for Plasmodium infection.
[0148] In a particular embodiment, the immunogenic composition of the invention is for use in a primate, in particular in a human, wherein the primate has been previously therapeutically treated against malaria, said composition being protective against subsequent infection by a plasmodium parasite.
[0149] In a particular embodiment, the immunogenic composition of the invention is for use in a primate, in particular in a human, as a cross-stage and cross-species protective composition against Plasmodium infection or against malaria.
[0150] The invention also relates to a process of preparing an immunogenic composition according to the invention wherein said composition is suitable for generating an immune response, in particular an antibody response against a Plasmodium in a primate, wherein the process comprises admixing at least 10.sup.3 genetically modified live Plasmodium wherein the genetically modified live Plasmodium is a species selected from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium coatneyi, Plasmodium cynomolgi, and Plasmodium simium, and wherein the genetically modified live Plasmodium does not produce functional histamine releasing factor (HRF) protein; and at least one pharmaceutically acceptable excipient and/or support. In particular, the Plasmodium species is P. falciparum.
[0151] According to one embodiment, the method comprises mixing red blood cells infected with a live parasite according to the invention, with one or more pharmaceutically acceptable excipients or supports. Preferably, the red blood cells are human red blood cells obtained from a host whose blood group is O and who is Rhesus negative.
[0152] According to another embodiment, the method comprises mixing live non-intra-erythrocytic merozoites of a parasite according to the invention with one or more pharmaceutically acceptable excipients or supports.
[0153] According to another embodiment, the method comprises mixing live sporozoites of a parasite according to the invention with one or more pharmaceutically acceptable excipients or supports.
[0154] According to another embodiment, the Plasmodium, in the form of parasitized red blood cells, or of merozoites or in the form of sporozoites, is also mixed with one or more immunological adjuvants. These adjuvants may be as defined above.
[0155] The method may also comprise a prior step comprising the obtaining of said parasitized red blood cells, of said merozoites or of said sporozoites, for example using the methods described above.
[0156] The composition or the vaccine obtained can be preserved before administration, for example frozen or refrigerated if it contains parasitized red blood cells, or frozen, refrigerated or lyophilized if it contains sporozoites or merozoites. Preferably, the composition or the vaccine obtained is preserved frozen before administration. In the case of lyophilization, an appropriate diluent is added to the lyophilisate before administration, for instance sterile water or sterile physiological saline, preferably sterile physiological saline.
[0157] The various embodiments concerning the Plasmodium and the composition according to the invention are also envisaged in this aspect.
[0158] According to another aspect, the invention relates to a method for immunizing a subject against malaria, comprising the administration of an immunogenic composition or of a vaccine according to the invention to said subject. Preferably, the subject is a human being.
[0159] The immunity of the subject with respect to malaria or to cerebral malaria may be total or incomplete. In the case of incomplete immunity, the seriousness of the symptoms of the established disease in an immunized subject will be reduced by comparison with those observed in a non-immunized subject. In the case of total immunity, the immunized subject will show no symptom of the disease after a contact with the parasite.
[0160] According to one preferred embodiment, the immunity obtained by administering the composition according to the invention is a sterile immunity. This means that the development of the parasites administered is highly modified and that, approximately 2 to 4 weeks after the administration, the parasites are no longer detected in the subject's peripheral blood.
[0161] The invention also relates to a method for immunizing a subject against malaria, comprising the administration of a parasite according to the invention in the form of sporozoites to said subject by means of bites by mosquitoes infected with said parasite. In particular, the administered Plasmodium species is P. falciparum.
[0162] The examples which follow are given for illustrative and non-limiting purposes.
EXAMPLES
[0163] I. Protection Against Malaria in Mice is Induced by Blood StageArresting HRFDeficient Parasites
Example 1: Materials and Methods
[0164] Rodents. Five- to eight-week-old wild-type female C57BL/6J Rj and Swiss Webster (SW) mice were purchased from Janvier laboratory (Le Genest-Saint-Isle, France). Transgenic T cell-deficient)(CD3K , B cell-deficient (secretory chain [sK.sup.0]), Fey receptor-deficient (FcyRK), and IL-6Ko mice strains were kindly provided by Dr B. Ryffel (Institut Pasteur, Paris, France), Dr. J M. Cavaillon (Institut Pasteur, Paris, France), Dr. P. Bruhns (Institut Pasteur, Paris, France), and Dr. Lionel Apetoh (INSERM U866, Dijon, France), respectively. CD11c-DTR-GFP mice (Jung et al., 2002) have been used to explore the role of DCs in controlling parasite development. Transgenic mice have all been back-crossed ten times on C57BL/6 mice from The Jackson Laboratory.
[0165] Parasites. Mice were inoculated with red blood cells infected (iRBCs) with either Plasmodium berghei (Pb) NK65 wild-type or mutant (hrfl1) GFP-transgenic parasites. In a few control experiments, mice were infected with P. Yoelii YM or Pb ANKA-GFP iRBCs, or with PbNK65 or PbANK A GFP-transgenic sporozoites collected from salivary glands of infected Anopheles stephensi.
[0166] Mouse infections and immunization with blood stages. Cryopreserved P. berghei parasites were passaged once through SW mice before being used to infect experimental animals. Mice were infected with blood stages of either GFP-transgenic PbNK65 or PbNK65-hrfiJ1 or PbNK65-hrfl12 parasites by injecting 105, 104 or 103 infected red blood cells (iRBCs) intraperitoneally (i.p.). After injection, blood samples were taken daily from the tail and parasitemia assessed by flow cytometry. If mice did not develop parasites after challenge, they were recorded as completely protected.
[0167] Splenic index. Spleens from uninfected and infected mice were harvested at day 6 post-infection with WT or PbNK65-hrfiJ1 parasites. The splenic index for each individual mouse was calculated as follows: spleen weight (mg) / body weight (mg)100.
[0168] Sporozoite development in HepG2 cells. HepG2 cells (2-3.0104/well) were plated in eight-well chamber slides (Lab-Tek Chamber Slide) and cultured ovemight in DMEM+GlutaMAX-1media (Gibco) supplemented with 10% heat inactivated FBS (Fetal Bovine Serum, Gibco) at 37 C. in the presence of 5% C02 . Wild type or mutant purified P. berghei salivary gland sporozoites were used for HepG2 infection at a ratio of 1:1 (parasite/cells) for 36 h at 37 C., 5% C02 in the presence of PSN (Penicillin-Streptomycin-Neomycin solution, Sigma-Aldrich; St. Louis, Mo.). PbHRF was detected by immunofluorescence staining as described below.
[0169] Immunofluorescence assays (IFAs) for the intracellular detection of HRF. Fixation and permeabilization of sporozoites, infected HepG2 cells, iRBCs and purified gametocytes was performed using 4% paraformaldehyde (PFA) and 0.1% Triton X-1OO, and blocked with 1-3% gelatin from porcine skin (Sigma-Aldrich; St. Louis, Mo.). Thereafter, cells were incubated with specific rabbit anti-HRF antibodies (diluted 1:500) (Mathieu et al., 2015), and then incubated with Alexa 568-conjugated secondary antibodies (Life technologies, diluted 1:500) and 0.02 mg/ml 4, 6-diamidino-2-phenylindole (DAPI) for nuclear staining. The expression of PbHRF was detected using the fluorescence microscope AxioVert 200 (Carl Zeiss).
[0170] Preparation of total RNA and reverse transcription-quantitative PCR (RT-qPCR) analysis of mRNA. The spleens and livers of C57BL/6J mice infected with WT or PbNK65-hrfil l parasites were surgically removed 40 h p.i. or at day 2, 4, 6, 8, 10, 12, 14 and 20 p.i., respectively. Total RNAs were extracted from the spleen as well from the liver samples using the Guanidinium-thiocyanate-phenol-chloroform method (all Invitrogen, Waltham, Mass., USA). RNA was thereafter reverse transcibed by PCR (temparature profile: 65 C. for 5 min, 42 C. for 50 min, 70 C. for 15 min) using 100U SuperScript II reverse transcriptase (RT) (Invitrogen, Waltham, Mass., USA), 40U RNAse Inhibitor and 2 M oligo(dT) 18S rRNA primer (Eurofins MWG Operon, Ebersberg, Germany) per sample. The expression levels of diverse transcripts were analyzed by real time RT-qPCR using Power SYBR Green PCR Master Mix (Applied Biosystems Poster City, Calif., USA) and various primers sets (see table 1). All reactions were performed in the ABI PRISM 7000 Sequence Dectection System Real Time PCR machine (temperature profile: 50 C. for 2 min, 95 C. for 10 min, 40 cycles of 95 C. for 15 s and 60 C. for 1 min). The relative abundance of parasite and cytokines rRNA in the spleen was calculated using the C.sub.t method, and expressed as 2.sup.C. The mouse hypoxanthine phosphoribosyltransferase (HPRT) gene was used as an intemal control for the variation in input RNA amounts. No template control (NTC) was included to ensure that there was no cross-contamination during sample preparation.
TABLE-US-00003 TABLE1 ListofoligonucleotidesusedforRT-qPCRanalyses (5 -3). SEQ Fw/ ID Primer Rev Sequence No Pb18S Fw ATTAATCTTGAACGAGGAATGGCT 1 Rev TCAATCGGTAGGAGCGACG 2 PbLSP2 Fw GCCAAATGCTAAACCTAATG 3 Rev TGGGTTTGTATTGTATGCAC 4 PbHSP70 Fw TGCAGCTAATCAAACTC 5 Rev ACTTCAATTTGTGGAACACC 6 muIL-23 Fw CCACCAGGACTCAAGGACAACA 7 Rev GCAGGCTCCCCTTTGAAGA 8 muEBB Fw CAGAGTGCAATGCCATGCTCC 9 Rev GCCACACCGAGCCTGTAAGT 10 muIL- Fw TACTAGAGAGACTTCTTCCACAACAAG 11 12p35 AG 12 Rev GATTCTGAAGTGCTGCGTTGAT muIL- Fw GGAAGCACGGCAGCAGAATA 13 12p40 Rev AACTTGAGGGAGAAGTAGGAATGG 14 muIFN- Fw AAAGGATGCATTCATGAGTATTGC 15 Rev CGCTTCCTGAGGCTGGATT 16 muIL-6 Fw AAAGAAATGATGGATGCTACCAAAC 17 Rev CTTGTTATCTTTTAAGTTGTTCTTCATGT 18 ACTC muIL-10 Fw GGCGCTGTCATCGATTTCTC 19 Rev GACACCTTGGTCTTGGAGCTTATTAA 20 muHPRT Fw CTGGTGAAAAGGACCTCTCG 21 Rev TGAAGTACTCATTATAGTCAAGGGCA 22
[0171] Flow cytometry analysis of spleen leukocytes. Spleens were mechanically disrupted in 2 ml PBS and cells were filtered through a 70-mm strainer (BD Falcon). Erythrocytes were lysed using Gey's solution for 5 min on ice and washed twice in PBS. Single-cell suspensions were stained for FACS analysis according to standard protocols in cold PBS containing 2% FCS and 0.01% sodium azide (FACS buffer) with the following antibodies: phycoerythrin (PE)-labelled anti-CD4, phycoerythrin-Cy5 (PeCy5)-labelled anti-CD45, allo-phyco-cyanine (APC)-labelled anti-CD8, fluorescein isothiocyanate (FITC)-labelled anti-CD 11b, APC-labelled anti-CD 11c, APC-labelled anti-Ly6G, PeCy5-labelled anti-F4/80 and PE-labelled anti-IL-6 antibodies (all antibodies from BD Biosciences, Mountain View, Calif.). A total of 5105 living cells were analyzed using a four-colour FACSCalibur flow cytometer (Becton Dickinson, Grenoble, France) and ProCellQuest software (BD Biosciences, Mountain View, Calif.).
[0172] In vivo cell depletion. For neutrophils depletion, C57BL/6 mice were injected with 500 g of a rat anti-mouse neutrophils (clone NIMP-R14) provided by G. Milon (Institut Pasteur, Paris) at day 2 and day 4 post infection with PbNK65-hrfL1. For systemic DC depletion, CDI 1c-DTR-GFP transgenic mice were injected i.p. with 5.2 ng/g body weight diphteria toxin (DTX) (Sigma Chemical Co., St. Louis, Mo., USA) in PBS at day 2 and 4 after infection with PbNK65-hrfL1. To determine if CD3 plays a role in the anti-parasitic memory response developed by protected mice, cell-specific depletion experiments were performed. C57BL/6J Rj protected mice were injected i.p. with 20 g of anti-CD3 clone 145-2C11 Armenian hamster IgG (eBioscience, San Diego, Calif.) 24 h before the infection with PbNK65 WT and 48 h after the infection. The cell depletion was followed and confirmed by flow cytometry. Before the infection and every day p.i., 10 l of blood were collected from the tip of the mouse tail and analyzed to confirm neutrophils, DCs, and CD3 cell depletion, by FACS analysis.
[0173] Detection of specific IgG antibodies and IL6 cytokine in the serum of infected mice. To detect parasite-specific antibodies, protein extracts from blood stages obtained by saponin lysis (0.1%) of parasite pellets were sonicated in lysis buffer (10 mM Tris pH 7.4, 150 mM NaCl, 0.02% NaN3 , 20 mM MgCl.sub.2, 1% Triton X-100, and complex protease inhibitors) and centrifuged (10,000 g for 30 mM at 4 C.). The total amount of proteins in the supematant was measured using a Bio-Rad protein assay. 96-well plates (Nunc-immuno plate; Thermo Scientific, Rockford, Ill.) were coated with PbNK 65 WT protein extracts (2 g/ml) in carbonate buffer, pH 9.6, for 2 h at 37 C. and then saturated with 1% (w/v) BSA (Bovine Serum Albumin, Sigma-Aldrich; St. Louis, Mo.). Serum samples were assayed using serial dilutions and incubated for 2 h at 37 C. Specific binding was detected using HRP-conjugated goat anti-mouse secondary antibody (diluted 1:2000, Cell Signalling technology, Danvers, Mass.) followed by the addition of o-phenylenediamine dihydrochloride (OPD) substrate (Sigma-Aldrich; St. Louis, Mo.). Hydrogen chloride (HCl) 1N was used to block the reaction. The optical density (OD) was read at 490-630 nm. Each sample was tested against non-immune serum and PBS as background controls. Amounts of IL-6 in the serum were analysed following the instructions provided by the by ELISA kit supplier (BD Biosciences, Mountain View, Calif.).
[0174] Western blotting. 20 g of PbNK65 WT protein extract from asexual blood stages were separated by SDS-PAGE (4-12% Bis-Tris gels, BOLT mini gel system, Life Technologies) and transferred onto a PVDF membrane (iBLOT system, Life Technologies, Carlsbad, Calif.). Mice sera from uninfected, WT or PbNK65-hrfi1 were added (1:1000 dilution) and incubated ovemight at 4 C. After washing the membrane with PBS+Tween-20 (Sigma-Aldrich; St. Louis, Mo.), polyclonal anti-mouse IgGs (1:20000, P0260, DAKO; Carpinteria, Calif.) were added and specific bands visualized with the SuperSignal West Pico Kit (Thermo Scientific, Rockford, Ill.), according to manufacturer's instructions.
[0175] Adoptive transfer of IgG specific antibodies and CDIIb positive cells. C57BL/6J mice were infected with either WT or PbNK65-hrfi1 parasites as described above. Specifi c IgGs and CD 11b+ cells were obtained from challenged protected mice at day 15 p.i. Immune sera were collected and IgG fraction was purified on an immunoabsorbent protein G-sepharose column (BioVision, Milpitas, Calif., USA). 100 g of IgGs were transferred i.p. into nave mice 24 h before WT PbNK65 iRBC infection. Mice were then given 100 g of antibody on day 3 and 6 p.i. Single-cell suspension of CD 11b.sup.+ cells was obtained from nave or PbNK65-hrfiJ1-infected mice by FACs sorting of spleen and bone marrow cells stained with FITC-labelled anti-CD 1 1b. Each mouse received intravenous injections of 2.510.sup.6 CD11b.sup.+ cells 1 h after WT PbNK65 iRBC infection.
[0176] Statistical analysis. All data were analyzed using GraphPad Prism 5.0 software.
[0177] Unpaired data between two groups at a specific time point were analysed by Mann-Whitney test for nonparametric analysis when data did not fit a Gaussian distribution. A p-value of<0.05 was considered to be statistically significant. All experiments were replicated several times as indicated in the figure legends.
[0178] Generation and cloning of PbN K65-hrf parasites. For construction of targeting vector for pbhrf disruption, DNA fragments corresponding to the 5 untranslated (UTR) and 3UTR regions of the pbhrf gene were amplified by PCR using P. berghei NK65 genomic DNA (gDNA) as template. These primers (see table 2) were tailed with restriction sites for ApaI, PstI, KpnI and EcoRI respectively, to facilitate cloning into either side of the human dihydrofolate reductase (hDHFR) cassette (de Koning-Ward et al., 2000) in pUC18 backbone. The targeting construct was integrated into the pbhrf gene locus by double crossover recombination, resulting in the disruption of pbhrf and conferring WR992 10 or pyrimethamine resistance. Transfection into a GFP-PbNK65 parasite strain and selection of recombinant parasite clones were performed as previously described (Janse et al., 2006). Briefly, after overnight culture (37 C., 10%O2, 5%CO2, 90 rpm) of the blood of infected animals, mature schizonts were purified using a Nycodenz gradient and collected at room temperature. The electroporation mix was composed of 10 to 10.sup.8 merozoites resuspended in 50 l, 100 l of Human T cell Nucleofector solution (Amaxa) and 5 l of DNA (containing 5 g of digested DNA in water). Parasites were electroporated using the U33 program of the Nucleofector electroporator (Amaxa) and immediately resuspended in PBS and injected intravenously into 3-week-old female Swiss mice. Recipient mice were treated with pyrimethamine (0.07 mg/ml) in drinking water or with WR99210 (6 mg/kg) by subcutaneous injections, starting 24 h post-electroporation. At day 6 after electroporation, the emerging parasite population was collected, gDNA extracted and genomic integration of the hDHFR cassette within the pbhrf locus of GFP-PbNK65 transfectants confirmed using specific PCR primers: (i) Apa-5UTR PbHRF-F and EcoRI-3 UTR PbHRF-R, (ii) HRFS'-F and hDHFR5-R, and (iii) HRF3-R and hDHFR3-F. The first pair of primers (Apa-5UTR PbHRF-F and EcoRI-3 UTR PbHRF-R) amplified gDNA encompassed by the Apa1 and EcoRI restriction sites and inclusive of the pbhrf 5 and 3UTRs. A PCR product of 2681 bp was indicative of hrf , whilst a PCR product of 1760 bp denoted a WT genotype. The second pair of primers (HRF-5-F and hDHFR 5-R) amplified DNA ouside the hDHFR insert (inclusive of the 5UTR PbHRF) and within the 5 region of the hDHFR cassette, respectively. A PCR product of 700 bp indicated a hrf clone, whilst absence of a band denoted a WT genotype. The third pair of primers (hDHFR 3-F and HRF 3-R) amplified gDNA within the 3 region of the hDHFR cassette and outside the hDHFR insert (inclusive of the 3UTRpbhif), respectively. A PCR product of 1100 bp indicated a hrf clone, whilst absence of a band indicated a WT genotype.
TABLE-US-00004 TABLE2 ListofoligonucleotidesusedforPCRofwild-typeandrecombinantparasites. SEQ Primer Sequence IDNo Apa1-5UTR-PbHRF-F(a) 5-cgcgggcccgcgcattattaccgttgtca-3 25 Pst1-5UTR-PbHRF-R 5-cgcctgcagggcttatgcaagtatcgaacaa-3 26 Kpn1-3UTR-PbHRF-F 5-cgcggtaccttgctacatgacgcataaacc-3 27 EcoRI-3UTR-PbHRF-R(a) 5-cgcgaattctgtgaaatcgacaatgttttgg-3 28 HRF5-F(b) 5-gcgatacaaacaaatttattcagc-3 29 HRF3-R(c) 5-cgcaagatatcagagcttttca-3 30 hDHFR3-F(c) 5-tgttgtctcttcaatgattcataaatagttgg-3 31 hDHFR5-R(b) 5-tgctttgaggggtgagcatttaaagc-3 32 PbHRF-5 orf-F 5-ccatttggaaatgcggaat-3 33 PbHRF-3orf-R 5-tttttcttcaaataaaccatctga-3 34 Bold letters refer to the oligonucleotides position in FIGS. 5A, 5B.
[0179] Southern blotting. Genomic DNA was obtained as follows: parasite pellets obtained by saponin lysis of iRBCs were resuspended in PBS and treated with 150 g/ml proteinase K and 2% SDS at 55 C. for 20 min. The DNA was isolated from the parasite pellet using the DNeasy Blood and Tissue kit (QIAGEN, Hilden, Germany) The DNA was digested with EcoRV and probed with an hrf probe.
[0180] Mass spectrometry analysis, database search, protein identification and statistical analysis. After the immunoprecipitation, proteins were solubilized in denaturation buffer (2-amino-2-hydroxymethyl-1,3-propanediol (Tris) 10 mM pH8.0, 8M urea). Proteins were reduced and alkylated and digested with trypsin. Tryptic peptides were analyzed by nano LC-MS/MS using an EASY-nLC 1000 (Thermo Fisher Scientific) coupled to a Q Exactive Orbitrap mass spectrometer. About 1 g of each sample (dissolved in 0.1% FA) were loaded 250 nl.Math.min-1 on a home-made C18 50 cm capillary column picotip silica emitter tip (75 m diameter filled with 1.9 m Reprosil-Pur Basic C 18-HD resin, (Dr. Maisch GmbH, Ammerbuch-Entringen, Germany)) equilibrated in solvent A (0.1% FA). The peptides were eluted using a two slopes gradient of solvent B (0.1% FA in ACN) from 2% to 30% in 90 min and to 30% to 80% in 60 min at 250 nL/min flow rate (total length of the chromatographie run was 180 min). The Q Exactive (Thermo Fisher Scientific, Bremen) was operated in data-dependent acquisition mode with the XCalibur software 2.2 (Thermo Fisher Scientific, Bremen). Survey scan MS were acquired in the Orbitrap on the 300-1800 m/z range with the resolution set to a value of 70 000 at m/z =400 in profile mode (AGC target at 1E6). The 20 most intense ions per survey scan were selected for HCD fragmentation (NCE 28), and the resulting fragments were analyzed in the Orbitrap at 17500 of resolution (m/z 400). Isolation of parent ion was fixed at 2.5 m/z and underfill ratio at 0.1%. Dynamic exclusion was employed within 20 s. Each sample was prepared in triplicate.
[0181] Data were searched using MaxQuant (1.4.1.2 version) (with the Andromeda search engine) against the Plasmodium_berghei database (22006 entries). The following search parameters were applied: Carbamidomethylation of cysteines was set as a fixed modification. Oxidation of methionine and protein N-terminal acetylation were set as variable modifications. The mass tolerances in MS and MS/MS were set to 10 ppm for each, respectively. Two peptides were required for protein identification and quantitation. Peptides and proteins identified with an FDR lower than 0.01% were considered as valid identification. Statistical analysis of the data was performed using Perseus (http:/1141.61.102.17/perseus_doku/), R package, MSstat (http://msstats.org/) and internal tools. Two sample t-test was used to identify significantly regulated proteins between two groups. Results were visualized on volcano plots.
[0182] Immunoprecipitation. Immunoprecipitation of Pb proteins from parasites extracts was performed using the Pierce Direct IP Kit (Thermo Scientific, Rockford, Ill.). Before immunoprecipitation, 10 g of purified IgG antibodies from the serum of protected, infected and nave mice were directly immobilized onto an agarose support (AminoLink Plus Resin) using a short coupling protocol. Parasites extracts (500-700 g) were incubated with the immobilized antibody to form the immune complex with gentle end-over-end mixing overnight at 4 C. To remove non-bound material, beads were washed 3 times with wash buffer, and a low pH elution buffer is used to dissociate the bound antigen from the antibody Immunoprecipitated proteins were then used for mass spectrometry analysis.
Example 2: Deletion of the hrf Gene in PbNK65 Parasites Causes Abortive Blood-Stage Development
[0183] We generated hrf knock-out PbNK65 parasites (PbNK65 hrf) by replacing the coding sequence of pbhrf (PBANKA_111050) with the human dihydrofolate reductase selectable marker (hDHFR) in a GFP-expressing PbNK65 strain (
[0184] To assess the effect of pbhrf deletion on parasite blood-stage development, C57BL/6 mice were infected intraperitoneally with 10.sup.5, 10.sup.4 or 10.sup.3 WT or PbNK65-hrf1 infected iRBCs and parasite growth was monitored by flow cytometry. In mice infected with WT parasites, parasitemia increased steadily, resulting in severe malaria and death at day 20 p.i. When using 10.sup.5 or 10.sup.4 infectious doses, PbNK65-hrf1 parasites multiplied like WT until day 10 p.i., reaching parasitemia of 20%, and were cleared from mice at day 13 or 14 p.i., respectively. Mouse survival rate after injection of 10.sup.4 or 10.sup.5 PbNK65-hrf1 parasites was 90% and 70%, respectively. Notably, injection of 10.sup.3 PbNK65-hrf1 parasites did not lead to parasite clearance or mouse survival. Infection with PbNK65-hrf2, a second clone, gave similar results (
[0185] To determine whether clearance of mutant parasites from the circulation could be due to parasite retention in the spleen, the parasite load in this organ was measured by real-time PCR (RT-qPCR). After a dramatic retention of PbNK65-hrf1 parasites at day 6, parasites were no longer detected in the spleen at day 14 (
Example 3: IL-6, B Cells and T Cells are Critical for Inhibition of PbNK65-hrf Blood-Stage Growth
[0186] Since HRF-deficient PbANKA sporozoites induce IL-6 production in the liver during pre-erythrocytic infection (Mathieu et al., 2015), we compared IL-6 levels in mouse spleens 6 days p.i with WT or PbNK65-hrf1 iRBCs. Levels of IL-6 mRNA and plasmatic IL-6 protein were higher in PbNK65-hrf1-infected mice than in WT-infected mice (
[0187] Immunostaining with leukocyte surface markers and anti-IL-6 antibodies of cells collected from the spleen at days 6 and 20 p.i. identified IL-6 producing cells as Ly6G.sup.+ neutrophils at day 6 and both Ly6G.sup.+ neutrophils and CD 11c.sup.+ dendritic cells (DCs) at day 20 (
[0188] IL-6 is known to regulate the acute phase of the immune response and major B and T cell functions (Barton, 1997; Kishimoto et al., 1992). To test whether B or T cells were involved in self-resolution of mutant infection, we infected mice lacking B cells (s.sup.KO or T cells CD3.sup.KO with WT or PbNK65-hrf1 parasites and monitored parasite development. B cell- or T cell-deficient mice were unable to control PbNK65-hrf1 blood-stage multiplication and died with similar kinetics than WT mice infected by WT parasites (
Example 4: PbNK65-hrf1 Infection Confers Lasting Protection in a Species- and Stage-Transcendent Manner
[0189] To determine whether resolved PbNK65-hrf1 parasite infection might confer protection against challenge, mutant-infected mice were challenged with 10.sup.5 WT PbNK65 iRBCs at days 20, 35, 68, 168 and 396 p.i. Mice were protected in all cases, displaying no detectable parasitemia at any timepoint, and survived for more than a year (
Example 5: Mutant-Induced Immunity Involves Plasmodium-Specific IgG2c Antibodies
[0190] To assess whether antibodies were involved in the anti-PbNK65-hrf1 response, anti-parasite specific antibodies of various isotypes were quantified by ELISA in sera of mice 15 days p.i. with WT or PbNK65-hrf1 parasites. As shown in
[0191] Immunoprecipitation of P. berghei blood stage proteins with the IgG antibodies from mutant-infected mice and mass spectrometry of the immunoprecipitate revealed five P. berghei proteins targeted by the protective IgG response (
[0192] Next, to test if IgG antibodies may mediate parasite clearance via FcR-expressing cells, WT or FcR.sup.KO C57BL/6 mice were infected with PbNK65-hrf1 parasites. As shown in
Example 6: Antibodies and CD11b Cells from Mutant-Infected Mice Mediate Protective Immunity
[0193] Finally, to assess what immune effectors are important for protection, we performed passive transfer experiments. First, antibodies purified from protected mice were transferred to nave mice before challenge with WT PbNK65 parasites. As shown in
[0194] Last, we asked if CD11b.sup.+ cells such as phagocytic leukocytes from PbNK65-hrf1-protected mice might be sufficient to protect naive mice from WT infection. WT C57BL/6 mice with adoptively transfered CD11b.sup.+ cells from naive or PbNK65-hrf1-infected mice at day 15 p.i. were challenged with 10.sup.5 WT parasites. As shown in
Discussion
[0195] These data reported in the examples show that abortive blood-stage infection leading to lasting protection can be achieved not just by impairing parasite intracellular growth but also by enhancing protective immune responses. Indeed lack of HRF, and the increase in IL-6, do not affect parasite growth per se since PbNK65-hrf blood stages multiply normally in mice until day 10. Rather, IL-6, which is involved in B and T cell differentiation, boosts anti-parasite adaptive responses that clear parasites. Like with previously reported blood-stage GAPs that induce abortive infections, the protective response to PbNK65-hrf parasites is both solid, conferring cross-stage and cross-species immunity, and durable. the inventors found that the protective response relies on the combination of anti-parasite IgG2c antibodies and FcR.sup.+ CD11b.sup.+ cells phagocytic cells, in particular neutrophils, which are sufficient for solid protection. Interestingly, the discovery of a B-helper neutrophil population in the spleen that can act as professional helper cells for marginal zone B-cells (Puga et al., 2012) highlights a neutrophil-B cell interplay that may be critical for B cell differentiation into antibody-producing plasma cells and may also contribute to inhibit the well-known Plasmodium capacity to induce short-lived B-cell memory (Wykes et al., 2005). Opsonic phagocytosis was also described as a protective mechanism induced by the plasmepsin-4-deficient mutant (Spaccapelo et al., 2010). Whether this represents the essential protective mechanism common to all self-resolving infections remains to be determined. Finally, although not formally demonstrated in these data, the contribution of parasite-specific CD8.sup.+ cells to self-resolution cannot be precluded and awaits further investigation.
[0196] II. Impaired Immunological Memory Against Blood Stage Malaria in Mice is Restored by the Histamine Releasing Factor (HRF) Deficient Murine Parasite
Example 7. Methods and Materials
[0197] Ethics statements. All animal care and experiments described in the present study involving mice were conducted at the Institut Pasteur, approved by the Direction Dpartementale des Services Vtrinaires de Paris, France (Permit Number N 75-066 issued on Sep. 14, 2009) and performed in compliance with institutional guidelines and European regulations (http://ec.europa.eu/environment/chemical?s/lab_animals/home_en.htm). A statement of compliance with the French Government's ethical and animal experiment regulations was issued by the Ministre de l'Enseignement Suprieur et de la Recherche under the number 00218.01.
[0198] Rodents. Five- to eight-week-old wild-type female C57BL/6J Rj and Swiss Webster (SW) mice were purchased from Janvier laboratory (Le Genest-Saint-Isle, France). Transgenic AID/YFP 45 were kindly provided by Dr. Antonio A. Freitas (Institut Pasteur, Paris, France).
[0199] Parasites. Mice were inoculated with red blood cells infected (iRBCs) or sporozoites collected from salivary glands of infected Anopheles stephensi with either GFP-transgenic Plasmodium berghei (Pb) NK65 wild-type or mutant (hrf) GFP-transgenic clones.
[0200] Mouse infections. Mice were infected with blood stages of either GFP-transgenic P. berghei NK65 or PbNK65 hrf parasites by injecting 10.sup.5 infected red blood cells (iRBCs) intraperitoneally (i.p) or 10.sup.3 sporozoites intravenous (i.v.). After the infection, blood samples were taken daily from the tail and the parasitemia was assessed by flow cytometry and the results expressed in percentage of iRBC. Infected mice were monitored for clinical symptoms of the disease: weight loss, anemia, fever and death.
[0201] Drug treatment. Once mice infected with PbNK65 WT iRBCs reach 2% of parasitemia were treated with for three consecutive days with 6 mg/kg of WR99210 (Sigma-Aldrich, Saint Louis, USA) by subcutaneous (s.c.) injections. Once the parasites were completely eliminated from blood stream mice were infected either with 10.sup.5 PbNK65 WT or hrf iRBCs. The group of mice who received the PbNK65 hrf and eliminated it from the blood stream were additionally challenged with 10.sup.5 PbNK65 WT iRBCs.
[0202] Preparation of total RNA and reverse transcription-quantitative PCR (RT-qPCR) analysis of mRNA. The livers and spleens of C57BL/6J mice infected with WT or PbNK65 hrf1 parasites were surgically removed 48 h, 72 h, 96 h and 120 h p.i. or at day 2, 4, 6, 8, 10, 12, 14 and 20 p.i., respectively. Total RNAs were extracted from the spleen as well from the liver samples using the guanidinium-thiocyanate-phenol-chloroform method (all Invitrogen, Waltham, Mass., USA). RNA was thereafter reverse transcibed by PCR (temparature profile: 65 C. for 5 min, 42 C. for 50 min, 70 C. for 15 min) using 100U SuperScript II reverse transcriptase (RT) (Invitrogen, Waltham, Mass., USA), 40U RNAse Inhibitor and 2 M oligo(dT) 18S rRNA primer (Eurofins MWG Operon, Ebersberg, Germany) per sample. The expression levels of diverse transcripts were analyzed by real time RT-qPCR using Power SYBR Green PCR Master Mix (Applied Biosystems Foster City, Calif., USA) and various primers sets (table 51). All reactions were performed in the ABI PRISM 7000 Sequence Dectection System Real Time PCR machine (temparature profile: 50 C. for 2 min, 95 C. for 10 min, 40 cycles of 95 C. for 15 s and 60 C. for 1 min). The relative abundance of parasite and cytokines rRNA in the spleen was calculated using the AG method, and expressed as 2.sup.c.sub.t. The mouse hypoxanthine phosphoribosyltransferase (HPRT) gene was used as an internal control for the variation in input RNA amounts. No template control (NTC) was included to ensure that there was no cross-contamination during sample preparation.
[0203] Detection of specific antibodies, cytokines, and chemokines in the serum of infected mice. To detect parasite-specific antibodies, 96-well plates (Nunc-immuno plate; Thermo Scientific, Rockford, Ill.) were coated with parasite protein extract from asexual blood stages in carbonate buffer, pH 9.6, for 2h at 37 C. After the plates were saturated with 1% (w/v) pork gelatine, each serum was assayed at serial dilutions and incubated overnight for 2 h at 37 C. Specific binding was detected using HRP-conjugated goat anti-mouse secondary antibody (Cell Signalling technology, Danvers, Mass.) followed by the addition of o-phenylenediamine dihydrochloride (OPD) substrate (Sigma-Aldrich; St. Louis, Mo.). Hydrogen chloride (HCl) 1N was used to block the reaction. The optical density (OD) was read at 490-655 nm. Each sample was tested against non-immune serum and PBS as background controls. Amounts of IL-12p70, IFN- and IL-6 in the serum were analysed by cytokine-specific ELISA kits (BD Biosciences, Mountain View, Calif.).
[0204] Flow cytometry analysis of spleen leukocytes. Spleens were mechanically disrupted in 2 ml PBS and cells were filtered through a 70-mm strainer (BD Falcon). Erythrocytes on the cell suspension were lysed using Gey's solution for 5 min of incubation on ice and after washed two times in PBS. Single-cell suspension were stained for FACS analysis according to standard protocols in cold PBS containing 2% FCS and 0.01% sodium azide (FACS buffer) with the following monoclonal antibodies conjugated to fluorescein isothiocyanate (MC), phycoerythrin (PE), phycoerythrin-cyanine 5 (PeCy5), phycoerythrin-cyanine 7 (PeCy7), peridinin chlorophyll protein-cyanine 5.5 (PerCp-cy5.5), allophycocyanine (APC) and Qdot-605: anti-CD4 (FITC), anti-CD8a (PE), anti-GL7 (PE), anti-CD62L (PeCy5), anti-CD95 (PeCy7), anti-IgM (PerCp-cy5.5), anti-PD1 (APC), anti-IgG (APC) and CD19 (Qdot-605)(all antibodies from BD Bioscience, Mountain View, Calif.). Before staining, a total of 510.sup.5 living cells, were treated with Fc-Block (clone 2.4G2, BD Bioscience, Mountain View, Calif.). Dead cells were excluded during analysis according to their light-scattering characteristics. All data and analyses were performed with LSRFortessa (Becton Dickinson, Grenoble, France) using FlowJo software (Tree Star, Ashland, Oreg., USA).
[0205] In vivo cell depletion. To determine if the protection induced by PbNK65 hrf is dependent on effector CD4.sup.| or CD8.sup.| T cells, cell-specific depletion experiments were performed. C57BL/6J Rj protected mice were injected i.p. with 20 g of anti-CD8 clone 53-6.7 Armenian hamster IgG (eBioscience, San Diego, Calif.) or 100 g of rat anti mouse CD4 clone GK1.5 (ATCC TIB207) 48 h before the infection with PbNK65 WT followed by 6 injections administered every other day after the infection. The cell depletion was followed and confirmed every day by taking 10 l of blood from the tip of the mouse tail and analysed by flow cytometry.
[0206] Statistical analysis. All data were analyzed using GraphPad Prism 5.0 software. Unparied data between two groups at a specific time point were analysed by Mann-Whitney test for nonparametric analysis when data did not fit a Gaussian distribution. A p-value of <0.05 was considered to be statistically significant. All experiments were replicated several times as indicated in the figure legends.
Example 8: HRF Plays a Critical Role in Parasite Development Both at the Pre-Erythrocytic and Erythrocytic Stages
[0207] As demonstrated above, inoculation of mice with PbNK65-hrf iRBCs resulted, after an initial phase of parasite development, in self-resolved infection with a long lasting protection and mouse survival (
Example 9: Prior Exposure to WT Parasite Followed by Drug Treatment Does Not Hamper PbNK65-hrf-Induced Parasite Clearance and Immune Protection
[0208] Results reported above, obtained from mice infected firstly with PbNK65-hrf parasites and, upon the complete clearance of PbNK65-hrf parasites, challenged with either PbNK65, PbANKA or PyYM WT lethal parasites demonstrated that the sterile protection conferred by this GAP is long-lasting in a species- and stage-transcendent manner. In endemic areas pre-exposure to WT parasites followed by antimalarial chemotherapy could induce epigenetic marks that may negatively influence anti-parasite immunity. In this situation the protective effect induced by the PbNK65-hrf mutant will not be effective. The question is to assess whether these individuals who had been exposed to WT parasites and drug cured will be equally efficiently protected following PbNK65-hrf infection as in naive mice. To address this issue, mice were first infected with 10.sup.5 PbNK65 WT iRBCs, and when parasitemia reached around 2%, were treated for three consecutive days with 6 mg/kg WR99210 by subcutaneous injections. Once the parasites were completely eliminated from the blood stream, at day 19 p.i., mice were infected either with 10.sup.5 WT or with PbNK65-hrf iRBCs (
Example 10: Pattern of Cytokines Associated with PbNK65-hrf Induced Protection
[0209] It is known from previous studies that both CD4.sup. and CD8.sup.+ T cells play a central role in the elimination of blood-stage malaria parasites through the release of cytokines that activate other effector cells such as NK cells, macrophages and dendritic cells. In addition, Th1 cytokines IL-12, IFN-, and TNF-, were shown to confer immunity against blood-stage Plasmodium infection.sup.25. To examine whether the infection of C57BL/6 mice with either the WT or PbNK65 hrf parasite induces a particular set of cytokines, we first examined the mRNA expression of a variety of cytokines by RT-PCR in the spleen of infected mice at various time intervals after infection, starting from day 2 until day 14, p.i. (
Example 11: Protection Conferred by Mutant Parasites is Dependent on Effector CD4.SUP.+ T Cells
[0210] The inventors have shown in the results reported above the critical role of T cells in the development of an amnestic response in mice previously infected with PbNK65 hrf1 parasites. Indeed, when CD3.sup. T cells were depleted, this group of mice were not able to control further infections with WT parasites. In order to show that the protection induced by PbNK65 hrf parasites is dependent on effector CD8.sup.+ or CD4.sup.+ T cells, protected mice were treated with normal mouse IgG, or with anti-CD8 or with anti-CD4 depleting antibodies. Efficacy of CD4 and CD8 depletion was continuously monitored during administration of T-cell depleting antibodies and after this treatment was discontinued (
Example 12: Protection Induced by PbNK65-hrf Parasites is Associated with Down-Regulation of PD-1 on T Cells
[0211] As previously observed, mice lacking T cells were unable to control the parasitemia of PbNK65 hrf parasites suggesting that the activation of T lymphocytes may be indispensable for immune memory against malaria infection. In order to better characterize the molecular signatures of the T cell response and given that chronic malaria infection results in an increased frequency of T cells expressing surface markers of exhaustion such as programmed cell death-1 (PD-1).sup.13, we asked whether the self-resolving nature of PbNK65 hrf infection could be correlated to a change in PD-1 expression on the surface of effector T cells. Analysis of PD-1 expression by flow cytometry at day 6 and day 20 p.i. (
Example 13: Infection with PbNK65 hrf Parasites is Associated with a Marked Increase in the Number of Effector Memory B Cells
[0212] In above reported data, in contrast to mice infected with the WT parasite, we found that mice infected with the mutant parasite developed a strong and long lasting antibody response associated with the opsonisation and the priming of CD11b.sup.+ cells that were essential for infection resolution. Here we went further in a detailed analysis of the generation of memory B cells upon infection with the mutant parasite. The germinal centers (GCs) are the main site where somatic hypermutations and class switch recombination occur. During the immune response, B cells express the activation-induced cytidine deaminase (AID) enzyme, which induces the two major alterations in Ig gene loci to enhance antibody and B cell function. These B cells that have activated AID transcription, which we can visualize using AID/YFP transgenic mice, are defined as memory B cells containing populations of central memory (AID/YFP+CD19+IgM+IgG) and effector memory (AID/YFP+CD19+IgMIgG+) B cells. Analysis of central and memory B cell populations is based on a combination of cell surface markers using a first gating on CD19+ AID-YFP+ cells followed by another gate on GL7+ CD95+ cell population and finally gating on IgG+ or IgM+ cell populations (
Discussion
[0213] In recent years, in addition to subunit vaccines and RASs, researchers have used rodent models to test the efficacy of GAPs as vaccines against pre-erythrocytic and blood stage infections of malaria parasites. Indeed, some of the pre-erythrocytic GAP studies have been extended to human malaria parasites: for example, P. falciparum p52p36sap1 GAPs that arrest in pre-erythrocytic stages, when tested in human adult volunteers, they conferred safety and immunogenicity.sup.29. Similar mutations in rodent malaria parasites engendered complete, protracted immunity against infectious sporozoite challenge in mice.sup.29. However, few candidates for blood stage GAP vaccines have been explored. To address this, we genetically depleted the immunomodulatory secreted molecule HRF from the severe malaria-causing mouse parasite strain P. berghei NK65 and found that this resulted in a developmental arrest at the pre erythrocytic stage, with infections self-resolving at day 12 p.i. This self-resolution was characterized by an immune signature that comprised elevated IL-6 levels, activation of T cells and B cells, and antigen-specific IgG2c production. Importantly, the PbNK65 hrf genetically modified parasites induced strong, long-lasting cross-stage and cross-species protection against subsequent malaria infections suggesting that the immune effector mechanisms were directed against antigens shared by different stages and parasite species. Therefore, we present this novel GAP as a putative blood stage malaria vaccine.
[0214] The reasons for the abortive infection and subsequent protection by PbNK65 hrf parasites are likely multifactorial. But, induction of IL-6 upon infection with the PbNK65 hrf parasite appears to be a key mechanism which is commonly encountered at both pre-erythrocytic and erythrocytic stages and regardless of the parasite genetic background, i.e. PbNK65 hrf or PbANKA hrf.sup.24. Indeed, similar to infection with PbANKA hrf sporozoites.sup.24, a delayed development of PbNK65 hrf sporozoites in the liver was associated with a sharp peak of IL-6 up-regulation in this tissue at 48 h p.i (
REFERENCES
[0215] 1. WHO. World Malaria Report (2015). [0216] 2. Gardner, M. J. et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419, 498-511 (2002). [0217] 3. Scherf, A., Lopez-Rubio, J. J. & Riviere, L. Antigenic variation in Plasmodium falciparum. Annu. Rev. Microbiol. 62, 445-470 (2008). [0218] 4. Langhorne, J., Ndungu, F. M., Sponaas, A. M. & Marsh, K. Immunity to malaria: more questions than answers. Nature Immunol. 9, 725-732 (2008). [0219] 5. van der Heyde, H. C., Huszar, D., Woodhouse, C., Manning, D. D. & Weidanz, W. P. The resolution of acute malaria in a definitive model of B cell deficiency, the JHD mouse. J. Immunol. 152, 4557-4562 (1994). [0220] 6. Janssen, E. M. et al. CD4+ T cells are required for secondary expansion and memory in CD8+ T lymphocytes. Nature 421, 852-856 (2003). [0221] 7. Su, Z. & Stevenson, M. M. Central role of endogenous gamma interferon in protective immunity against blood-stage Plasmodium chabaudi AS infection. Infect. Immun. 68, 4399-4406 (2000). [0222] 8. Xu, W. & Zhang, J. J. Statl -dependent synergistic activation of T-bet for IgG2a production during early stage of B cell activation. J. Immunol. 175, 7419-7424 (2005). [0223] 9. Sponaas, A. M. et al. Migrating monocytes recruited to the spleen play an important role in control of blood stage malaria. Blood 114, 5522-5531 (2009). [0224] 10. Waddell, S. J. et al. Dissecting interferon-induced transcriptional programs in human peripheral blood cells. PloS one 5, e9753, doi:10.1371/journal.pone.0009753 (2010). [0225] 11. Del Portillo, H. A. et al. The role of the spleen in malaria. Cell Microbiol. 14, 343-355 (2012). [0226] 12. Chandele, A., Mukerjee, P., Das, G., Ahmed, R. & Chauhan, V. S. Phenotypic and functional profiling of malaria-induced CD8 and CD4 T cells during blood-stage infection with Plasmodium yoelii. Immunology 132, 273-286 (2011). [0227] 13. Butler, N. S. et al. Therapeutic blockade of PD-L1 and LAG-3 rapidly clears established blood-stage Plasmodium infection. Nature Immunol. 13, 188-195 (2012). [0228] 14. Illingworth, J. et al. Chronic exposure to Plasmodium falciparum is associated with phenotypic evidence of B and T cell exhaustion. J. Immunol. 190, 1038-1047 (2013). [0229] 15. Wykes, M. N., Horne-Debets, J. M., Leow, C. Y. & Karunarathne, D. S. Malaria drives T cells to exhaustion. Front. Microbiol. 5, 249 (2014). [0230] 16. Butler, N. S. et al. Superior antimalarial immunity after vaccination with late liver stage-arresting genetically attenuated parasites. Cell host & microbe 9, 451-462 (2011). [0231] 17. van Dijk, M. R. et al. Genetically attenuated, P36p-deficient malarial sporozoites induce protective immunity and apoptosis of infected liver cells. Proc. Natl. Acad. Sci. USA 102, 12194-12199 (2005). [0232] 18. Mueller, A. K., Labaied, M., Kappe, S. H. & Matuschewski, K. Genetically modified Plasmodium parasites as a protective experimental malaria vaccine. Nature 433, 164-167 (2005). [0233] 19. Mueller, A. K. et al. Plasmodium liver stage developmental arrest by depletion of a protein at the parasite-host interface. Proc. Natl. Acad. Sci. USA 102, 3022-3027 (2005). [0234] 20. Ting, L. M., Gissot, M., Coppi, A., Sinnis, P. & Kim, K. Attenuated Plasmodium yoelii lacking purine nucleoside phosphorylase confer protective immunity. Nature Med. 14, 954-958 (2008). [0235] 21. Aly, A. S., Downie, M. J., Mamoun, C. B. & Kappe, S. H. Subpatent infection with nucleoside transporter 1-deficient Plasmodium blood stage parasites confers sterile protection against lethal malaria in mice. Cell. Microbiol. 12, 930-938 (2010). [0236] 22. Spaccapelo, R. et al. Plasmepsin 4-deficient Plasmodium berghei are virulence attenuated and induce protective immunity against experimental malaria. Am. J. Pathol. 176, 205-217 (2010). [0237] 23. Demarta-Gatsi, C. et al. Protection against malaria in mice is induced by blood stage-arresting histamine-releasing factor (HRF)-deficient parasites. J. Exp. Med. 213, 1419-1428 (2016)24. Mathieu, C. et al. Plasmodium berghei histamine-releasing factor favours liver-stage development via inhibition of IL-6 production and associates with a severe outcome of disease. Cell. Microbiol. 17, 542-558 (2015). [0238] 25. Perlmann, P. & Troye-Blomberg, M. Malaria and the immune system in humans. Chem. Immunol. 80, 229-242 (2002). [0239] 26. van der Heyde, H. C., Pepper, B., Batchelder, J., Cigel, F. & Weidanz, W. P. The time course of selected malarial infections in cytokine-deficient mice. Exp. Parasitol. 85, 206-213 (1997). [0240] 27. Taylor-Robinson, A. W. A model of development of acquired immunity to malaria in humans living under endemic conditions. Med. Hypotheses 58, 148-156 (2002). [0241] 28. Oehen, S. & Brduscha-Riem, K. Differentiation of naive CTL to effector and memory CTL: correlation of effector function with phenotype and cell division. J. Immunol. 161, 5338-5346 (1998). [0242] 29. Spring, M. et al. First-in-human evaluation of genetically attenuated Plasmodium falciparum sporozoites administered by bite of Anopheles mosquitoes to adult volunteers. Vaccine 31, 4975-4983 (2013). [0243] 30. Sam, H. & Stevenson, M. M. In vivo IL-12 production and IL-12 receptors betal and beta2 mRNA expression in the spleen are differentially up-regulated in resistant B6 and susceptible A/J mice during early blood-stage Plasmodium chabaudi AS malaria. J. Immunol. 162, 1582-1589 (1999). [0244] 31. Sam, H. & Stevenson, M. M. Early IL-12 p70, but not p40, production by splenic macrophages correlates with host resistance to blood-stage Plasmodium chabaudi AS malaria. Clin. Exp. Immunol. 117, 343-349 (1999). [0245] 32. Luty, A. J. et al. Low interleukin-12 activity in severe Plasmodium falciparum malaria. Infect. Immunol. 68, 3909-3915 (2000). [0246] 33. Perkins, D. J., Weinberg, J. B. & Kremsner, P. G. Reduced interleukin-12 and transforming growth factor-betal in severe childhood malaria: relationship of cytokine balance with disease severity. J. Infect. Dis. 182, 988-992 (2000). [0247] 34. Nish, S. A. et al. T cell-intrinsic role of IL-6 signaling in primary and memory responses. eLife 3, e01949 (2014). [0248] 35. Day, C. L. et al. PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression. Nature 443, 350-354 (2006). [0249] 36. Hofmeyer, K. A., Jeon, H. & Zang, X. The PD-1/PD-L1 (B7-H1) pathway in chronic infection-induced cytotoxic T lymphocyte exhaustion. J. Biomed. Biotechnol. 2011, 451694 (2011). [0250] 37. Wherry, E. J. T cell exhaustion. Nature Immunol. 12, 492-499 (2011). [0251] 38. Good, M. F. et al. Cross-species malaria immunity induced by chemically attenuated parasites. J. Clin. Invest. 123, 3353-3362 (2013). [0252] 39. Bommarito, D., Hall, C., Taams, L. S. & Corrigall, V. M. A2.03 The PD-1/PD-L1 axis is modulated by pro-inflammatory cytokines. Annals Rheum. Dis. 75 (2016). [0253] 40. Ryg-Cornejo, V. et al. Severe Malaria Infections Impair Germinal Center Responses by Inhibiting T Follicular Helper Cell Differentiation. Cell Rep. 14, 68-81 (2016). [0254] 41. Muramatsu, M. et al. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102, 553-563 (2000). [0255] 42. Brake, D. A., Weidanz, W. P. & Long, C. A. Antigen-specific, interleukin 2-propagated T lymphocytes confer resistance to a murine malarial parasite, Plasmodium chabaudi adami. J. Immunol. 137, 347-352 (1986). [0256] 43. Langhorne, J., Gillard, S., Simon, B., Slade, S. & Eichmann, K. Frequencies of CD4+ T cells reactive with Plasmodium chabaudi: distinct response kinetics for cells with Th1 and Th2 characteristics during infection. Int. Immunol. 1, 416-424 (1989). [0257] 44. Raja, A. I. et al. Chemically Attenuated Blood-Stage Plasmodium yoelii Parasites Induce Long-Lived and Strain-Transcending Protection. Infect. Immun. 84, 2274-2288 (2016). [0258] 45. Crouch, E. E. et al. Regulation of AID expression in the immune response. J. Exp. Med. 204, 1145-1156 (2007). [0259] 46. Ghorbal M. et al Genome editing in the human malaria parasite Plasmodium falciparum using CRISPR-Cas9 system. Nat Biotechnol. 2014 August; 32 (8):819-21 [0260] 47. Alaro, J. R., A Partridge, K. Miura, A Diouf, A M. Lopez, E. Angov, C. A. Long, and J. M. Burns, Jr. 2013. A chimeric Plasmodium falciparum merozoite surface protein vaccine induces high titers of parasite growth inhibitory antibodies. Infection and immunity 81:3843-3854.
[0261] 48. Aly, A S., M. J. Downie, C. B. Mamoun, and S. H. Kappe. 2010. Subpatent infection with nucleoside transporter 1-deficient Plasmodium blood stage parasites confers sterile protection against lethal malaria in mice. Cellular microbiology 12:930-938.
[0262] Barton, B. E. 1997. IL-6: insights into novel biological activities. Clinicat immunology and immunopathology 85: 16-20.
[0263] 49. Beghdadi, W., A Porcherie, B. S. Schneider, D. Dubayle, R. Peronet, M. Huerre, T. Watanabe, H. Ohtsu, J. Louis, and S. Mecheri. 2008. Inhibition of histamine-mediated signaling confers significant protection against severe malaria in mouse models of disease. The Journal of experimental medicine 205:395-408.
[0264] 50. Bhisutthibhan, J., M. A. Philbert, H. Fujioka, M. Aikawa, and S. R. Meshnick. 1999. The Plasmodium falciparum translationally controlled tumor protein: subcellular localization and calcium binding. European journal of cell biology 78:665-670.
[0265] 51. Bodescot, M., O. Silvie, A Siau, P. Refour, P. Pino, J. F. Franetich, L. Hannoun, R. Sauerwein, and D. Mazier. 2004. Transcription status of vaccine candidate genes of Plasmodium falciparum during the hepatic phase of its life cycle. Parasitology research 92:449-452.
[0266] 52. Coutelier, J. P., J. T. van der Logt, F. W. Heessen, G. Warnier, and J. Van Snick. 1987. IgG2a restriction of murine antibodies elicited by viral infections. The Journal of experimental medicine 165:64-69.
[0267] 53. de Koning-Ward, T. F., D. A. Fidock, V. Thathy, R. Menard, R. M. van Spaendonk, A. P. Waters, and C. J. Janse. 2000. The selectable marker human dihydrofolate reductase enables sequential genetic manipulation of the Plasmodium berghei genome. Molecular and biochemical parasitology 106:199-212.
[0268] 54. Janse, C. J., J. Ramesar, and A. P. Waters. 2006. High-efficiency transfection and drug selection of genetically transformed blood stages of the rodent malaria parasite Plasmodium berghei. Nature protocols 1:346-356.
[0269] 55. Jung, S., D. Unutmaz, P. Wong, G. Sano, K. De los Santos, T. Sparwasser, S. Wu, S. Vuthoori, K. Ko, F. Zavala, E. G. Pamer, D. R. Littman, and R A Lang. 2002. In vivo depletion of CDI 1e+ dendritic cells abrogates priming of CD8+ T cells by exogenous cell-associated antigens. Immunity 17:211-220.
[0270] 56. Kishimoto, T., S. Akira, and T. Taga. 1992. Interleukin-6 and its receptor: a paradigm for cytokines. Science (New York, N.Y.) 258:593-597.
[0271] 57. Mathieu, C., C. Demarta-Gatsi, A Porcherie, S. Brega, S. Thiberge, K. Ronce, L. Smith, R. Peronet, R. Amino, R. Menard, and S. Mecheri. 2015. Plasmodium berghei histamine-releasing factor favours liver-stage development via inhibition of IL-6 production and associates with a severe outcome of disease. Cellular microbiology 17:542-558.
[0272] 58. Miyagami, T., 1. Igarshi, and M. Suzuki. 1987. Plasmodium berghei: long lasting immunity induced by a permanent attenuated mutant. Zentralblatt fur Bakteriologie, Mikrobiologie, and Hygiene. Series A, Medical microbiology, infectious diseases, virology, parasitology 264: 502-512.
[0273] 59. Ndungu, F. M., E. T. Cadman, J. Coulcher, E. Nduati, E. Couper, D. W. Macdonald, D. Ng, and J. Langhorne. 2009. Functional memory B cells and long-lived plasma cells are generated after a single Plasmodium chabaudi infection in mice. PLoS pathogens 5:el 000690.
[0274] 60. Nimmerjahn, F., and J. V. Ravetch. 2005. Divergent immunoglobulin g subclass activity through selective Fe receptor binding. Science (New York, N.Y.) 310: 1510-1512.
[0275] 61. Pied, S., L. Renia, A Nussler, F. Miltgen, and D. Mazier. 1991. Inhibitory activity of IL-6 on malaria hepatic stages. Parasite immunology 13:211-217.
[0276] 62. Pombo, D. J., G. Lawrence, C. Hirunpetcharat, C. Rzepczyk, M. Bryden, N. Cloonan, K. Anderson, Y. Mahakunkijcharoen, L. B. Martin, D. Wilson, S. Elliott, S. Elliott, D. P. Eisen, J. B. Weinberg, A. Saul, and M. F. Good. 2002 Immunity to malaria after administration of ultra-low doses of red cells infected with Plasmodium falciparum. The Lancet 360:610-617.
[0277] 63. Puga, l., M. Cols, C. M. Barra, B. He, L. Cassis, M. Gentile, L. Comerma, A. Chorny, M. Shan, W. Xu, G. Magri, D. M. Knowles, W. Tarn, A. Chiu, J. B. Bussel, S. Serrano, J. A. Lorente, B. Bellosillo, J. Lloreta, N. Juanpere, F. Alameda, T. Barn, C. D. de Heredia, N. Toran, A. Catala, M. Torrebadell, C. Fortuny, V. Cusi, C. Carreras, G. A. Diaz, J. M. Blander, C. M. Farber, G. Silvestri, C. Cunningham-Rundles, M. Calvillo, C. Dufour, L. D. Notarangelo, V. Lougaris, A. Plebani, J. L. Casanova, S. C. Ganal, A. Diefenbach, J. I. Arostegui, M. Juan, J. Yague, N. Mahlaoui, J. Donadieu, K. Chen, and A. Cerutti. 2012. B cell-helper neutrophils stimulate the diversification and production of immunoglobulin in the marginal zone of the spleen. Nature immunology 13:170-180.
[0278] 64. Putrianti, E. D., A. Schmidt-Christensen, l. Arnold, V.T. Heussler, K. Matuschewski, and O. Silvie. 2010. The Plasmodium serine-type SERA proteases display distinct expression patterns and non-essential in vivo roles during life cycle progression of the malaria parasite. Cellular microbiology 12:725-739.
[0279] 65. Spaccapelo, R., E. Aime, S. Caterbi, P. Arcidiacono, B. Capuccini, M. Di Cristina, T. Dottorini, M. Rende, F. Bistoni, and A. Crisanti. 2011. Disruption of plasmepsin-4 and merozoites surface protein-7 genes in Plasmodium berghei induces combined virulence-attenuated phenotype. Scientific reports 1:39.
[0280] 66. Spaccapelo, R., C. J. Janse, S. Caterbi, B. Franke-Fayard, J. A. Bonilla, L. M. Syphard, M. Di Cristina, T. Dottorini, A. Savarino, A. Cassone, F. Bistoni, A. P. Waters, J. B. Dame, and A. Crisanti. 2010. Plasmepsin 4-deficient Plasmodium berghei are virulence attenuated and induce protective immunity against experimental malaria. The American journal ofpathology 176:205-217.
[0281] 67. Ting, L. M., M. Gissot, A Coppi, P. Sinnis, and K. Kim. 2008. Attenuated Plasmodium yoelii lacking purine nucleoside phosphorylase confer protective immunity. Nature medicine 14:954-958.
[0282] 68. Waki, S., J. Tamura, M. Imanaka, S. Ishikawa, and M. Suzuki. 1982. Plasmodium berghei: isolation and maintenance of an irradiation attenuated strain in the nude mouse. Experimental parasitology 53:335-340.
[0283] 69. Wykes, M. N., Y. H. Zhou, X. Q. Liu, and M.F. Good. 2005. Plasmodium yoelii can ablate vaccine-induced long-term protection in mice. Journal of immunology (Baltimore, Md.: 1950) 175:2510-2516.
[0284] 70. Thathy and Mnard, Gene targeting in Plasmodium berghei Methods Mol Med. 2002; 72:317-31.
[0285] 71. McRobert and McConkey, 2002 RNA interference (RNAi) inhibits growth of Plasmodium falciparum Mol Biochem Parasitol. 2002 February; 119(2):273-8
[0286] 72. Mohmmed et al. RNA interference: biology, mechanism, and applications Microbiol Mol Biol Rev. 2003 December; 67(4):657-85.
[0287] 73. Gissot et al., PfMyb1, a Plasmodium falciparum Trascription Factor, Is Required for Intra-Erythroeytic Growth and Controls Key Genes for Cell Cycle Regulation J Mol Biol 346 (1), 39-42. 2004 Dec. 21.
[0288] 74. Leef et al. BULL WORLD HEALTH ORGAN vol. 57, no. 1, 1979, pages 87-91
[0289] 75. Orjih et al. J TROP MED HYG. vol. 29, no. 3, Mai 1980, pages 343-7
[0290] 76. Trager; Jensen SCIENCE vol. 193, 1976, pages 673-5