Low-Cost Detection of Norovirus Using Paper-Based Cell-Free Systems And Synbody-Based Viral Enrichment
20190285620 · 2019-09-19
Inventors
- Alexander Green (Scottsdale, AZ)
- Duo MA (Tempe, AZ, US)
- Luhui Shen (Tempe, AZ, US)
- Chris Diehnelt (Chandler, AZ, US)
Cpc classification
C12Q1/6897
CHEMISTRY; METALLURGY
C07K19/00
CHEMISTRY; METALLURGY
C07K2318/20
CHEMISTRY; METALLURGY
G01N33/5434
PHYSICS
C07K2317/569
CHEMISTRY; METALLURGY
G01N33/5308
PHYSICS
C07K2317/60
CHEMISTRY; METALLURGY
International classification
G01N33/543
PHYSICS
G01N33/53
PHYSICS
C07K19/00
CHEMISTRY; METALLURGY
Abstract
Provided herein are methods and systems for low-cost, low-equipment detection of pathogens in biological sample. In particular, provided herein is a low-cost method for detecting norovirus that provides reliable, visible test with femtomolar, attomolar, and zeptomolar detection limits and that uses materials suitable for deployment of the methods in the field.
Claims
1. A method of detecting a target pathogen nucleic acid in a sample, the method comprising the steps of: (a) contacting a biological sample obtained from a subject to a pathogen detection agent under conditions that promote binding of the pathogen detection agent to the target pathogen if present in the sample; (b) isolating nucleic acids from pathogen bound by the pathogen detection agent; (c) amplifying the isolated nucleic acids using isothermal amplification; and (d) contacting the amplified nucleic acid to a toehold switch, wherein the toehold switch encodes at least a portion of a reporter protein and comprises one or more single-stranded toehold sequence domains that are complementary to a target pathogen nucleic acid or the reverse complement thereof, wherein the contacting occurs under conditions that allow translation of the coding domain in the presence of the target nucleic acid but not in the absence of the target nucleic acid, and detecting the reporter protein as an indicator that the target pathogen nucleic acid is present in the amplified nucleic acids.
2. The method of claim 1, wherein the pathogen detection agent is a norovirus detection agent and the target pathogen nucleic acid is norovirus RNA.
3. The method of claim 1, wherein target pathogen nucleic acid is detected at concentrations in a range of zeptomoles/liter (zM).
4. The method of claim 1, wherein target pathogen nucleic acid is detected at concentration between about 270 zM to about 270 aM.
5. The method of claim 1, wherein the pathogen detection agent is a synbody.
6. The method of claim 5, wherein the synbody comprises biotin.
7. The method of claim 6, wherein the biotin-containing synbody is bound to a streptavidin-coated magnetic bead.
8. The method of claim 6, wherein isolating comprises a magnetic capture assay.
9. The method of claim 1, wherein the toehold switch encodes at least a portion of lacZ.
10. The method of claim 1, wherein the toehold switch encodes lacZ and the amplified nucleic acids are contacted under conditions which promote formation of a lacZ tetramer.
11. The method of claim 10, wherein lacZ is provided on a substrate to which the amplified nucleic acids are contacted.
12. A synthetic norovirus-specific toehold switch sensor comprising a fully or partially double-stranded stem domain, a loop domain, a toehold domain, and at least a portion of a coding sequence of a reporter gene, wherein the toehold domain and at least a portion of the stem domain are complementary to a target norovirus RNA sequence.
13. The toehold switch sensor of claim 12, comprising a RNA sequence selected from SEQ ID NOs:1-12.
14. A kit for detecting a pathogen-associated nucleic acid, comprising a plurality of preserved test articles, a pathogen detection agent, a plurality of toehold switches that encode at least a portion of a reporter protein and comprise one or more single-stranded toehold sequence domains that are complementary to a target pathogen nucleic acid or the reverse complement thereof, and an electronic optical reader.
15. The kit of claim 14, wherein the pathogen detection agent is a synbody.
16. The kit of claim 14, wherein the plurality of preserved test articles comprises one or more selected from preserved paper test articles and preserved test tube articles.
17. The kit of claim 14, further comprising instructions for performing the method of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
DETAILED DESCRIPTION
[0037] The methods and compositions provided herein are based at least in part on the inventors' development of a highly sensitive assay for detecting pathogen nucleic acids down to concentrations of 200 attomoles/liter (aM) in reactions that can be directly read by eye. Advantages of the methods and compositions provided herein are multifold and include, for example, low-cost identification of infectious agents (e.g., foodborne pathogens) in a versatile diagnostic assay that provides visible test results, does not require expensive thermal cycling and other laboratory equipment, and can be easily deployed for rapid diagnosis in the field. Moreover, the methods and compositions provided herein obviate the need for expensive equipment and facilitate decentralized assays.
[0038] Accordingly, in a first aspect, provided herein is a method of detecting a target pathogen nucleic acid in a sample. The method can comprise or consist essentially of the following steps: (a) contacting a biological sample obtained from a subject to a pathogen detection agent under conditions that promote binding of the pathogen detection agent to the target pathogen if present in the sample; (b) isolating nucleic acids from pathogen bound by the pathogen detection agent; (b) amplifying the isolated nucleic acids using isothermal amplification; and (c) contacting the amplified nucleic acid to a toehold switch, wherein the toehold switch encodes at least a portion of a reporter protein and comprises one or more single-stranded toehold sequence domains that are complementary to a target nucleic acid or the reverse complement thereof, where the contacting occurs under conditions that allow translation of the coding domain in the presence of the target nucleic acid but not in the absence of the target nucleic acid, and detecting the reporter protein as an indicator that the target pathogen nucleic acid is present in the amplified nucleic acids. By enriching for and amplifying nucleic acids of the target pathogen, the method allows for detection of a pathogen in a biological sample that is dilute or contains few copies of the target pathogen. In some cases, the methods permit target nucleic acid detection with femtomolar, attomolar, and zeptomolar detection limits. As demonstrated in the Examples section, the method enables detection of norovirus GII.4 Sydney from a stool sample down to concentrations of 270 aM without the use of a concentration step. The SI prefix atto represents a factor of 10.sup.18, or in exponential notation, 1E-18. The Examples also demonstrate that synbody-based enrichment of the virus can lower the detection limit by 1000-fold to 270 zeptomoles/liter (zM). The SI prefix zepto represents a factor of 10.sup.21, or in exponential notation, 1E-21.
[0039] As used herein, the term pathogen refers to any infectious agent and includes viruses, parasites, bacteria, fungi, and prions. By way of non-limiting example, pathogens may comprise viruses including, without limitation, noroviruses (e.g., Norwalk virus), flaviruses, human immunodeficiency virus (HIV), Ebola virus, single stranded RNA viruses, single stranded DNA viruses, double-stranded RNA viruses, double-stranded DNA viruses. Other pathogens include but are not limited to parasites (e.g., malaria parasites and other protozoan and metazoan pathogens (Plasmodia species, Leishmania species, Schistosoma species, Trypanosoma species)), bacteria (e.g., Mycobacteria, in particular, M. tuberculosis, Salmonella, Streptococci, E. coli, Staphylococci), fungi (e.g., Candida species, Aspergillus species, Pneumocystis jirovecii, Pneumocystis carinii, and other Pneumocystis species), and prions. In some cases, the pathogenic microorganism, e.g. pathogenic bacteria, may be one which causes cancer in certain human cell types. An advantage of the methods described herein is that they can be applied for the detection and identification of essentially any nucleic acid-containing organism. Accordingly, the pathogen can be virtually any pathogen or infectious agent for which genetic information (e.g., gene sequences) is available. In other cases, the target nucleic acid is human in origin. In such cases, the methods can be employed to detect one or more target nucleic acids in a biological sample such as a biological sample obtained for forensic analysis, for genotyping, and the like.
[0040] Pathogen detection agents include, without limitation, antibodies, synbodies, peptides, polypeptides, and aptamers. Referring to
[0041] Specific binding refers to the binding of a compound to a target (e.g., a component of a sample) that is detectably higher in magnitude and distinguishable from non-specific binding occurring to at least one unrelated target. Specific binding can be the result of formation of bonds between particular functional groups or particular spatial fit (e.g., lock and key type) whereas nonspecific binding is usually the result of van der Waals forces. Specific binding does not however imply that a compound binds one and only one target. Thus, a compound can and often does show specific binding of different strengths to several different targets and only nonspecific binding to other targets. Preferably, different degrees of specific binding can be distinguished from one another as can specific binding from nonspecific binding.
[0042] In certain embodiments, the synbody is tagged with biotin and then contacted to streptavidin-coated magnetic beads. In this manner, pathogen protein (e.g., viral particles) bound to the synbody-bead can be captured and concentrated using magnets. Referring to
[0043] In certain embodiments, the method employs programmable riboregulators known as toehold switches. As used herein, the term toehold switch generally refers to a nucleic acid-based regulator of gene expression, configured to repress or activate translation of an open reading frame and thus production of a protein. Toehold switches, which are a type of prokaryotic riboregulator, activate gene expression in response to cognate RNAs with essentially arbitrary sequences. Gene regulation is achieved through the presence of a regulatory nucleic acid element (the cis-repressive RNA or crRNA) within the 5 untranslated region (5 UTR) of an mRNA molecule. The cis-repressive nucleic acid element (crRNA) forms a hairpin structure comprising a stem domain and a loop domain through complementary base pairing. The hairpin structure blocks access to the mRNA transcript by the ribosome, thereby preventing translation. In some embodiments, the stem domain of the hairpin structure sequesters the ribosome binding site (RBS). In some embodiments, including, for example, embodiments involving eukaryotic cells, the stem domain of the hairpin structure is positioned upstream of the start (or initiation) codon. As described in the Examples, that follow, toehold switches particularly useful for the methods provided herein are configured for lower leakage relative to previously described riboregulators. As illustrated in
[0044] In some cases, toehold switches are synthetic (engineered) molecules. In other cases, toehold switches comprise endogenous, naturally occurring RNAs or regions thereof. See, for example, U.S. 2015/0275203. The stem domain can be as small as 12 bps, but in some cases will be longer than 12 bps, including 13, 14, 15, 16, 17, 18, 19, 20, or more base pairs in length. In other cases, the loop domain is complementary to a non-naturally occurring RNA. The toehold domain can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides in length.
[0045] The toehold switch further comprises a fully or partially double-stranded stem domain comprising an initiation codon, a loop domain comprising a RBS, and a coding domain. The unpaired region upstream of the RBS in a toehold switch can be shortened or lengthened to modulate protein output and, in turn, device dynamic range. In some cases, the toehold and stem domains are complementary in sequence to a naturally occurring RNA. In other cases, the sequence detected can also be the complement of the naturally occurring RNA. For example, after isothermal amplification, it is possible to transcribe the antisense of the RNA rather than the sense.
[0046] The toehold switch can further comprise a thermodynamically stable double-stranded stem domain, a loop domain comprising a ribosome binding site, and a coding domain. Preferably, the loop domain is 11 nucleotides or 12 nucleotides in length. In some cases, the length of loop domains can be increased or decreased, for example, to alter reaction thermodynamics.
[0047] In certain embodiments, the toehold switch is configured to detect a portion of a pathogen genome that is conserved among two or more species or strains of the pathogen. For example, the Examples that follow describe identifying conserved sequence regions of a norovirus GII genome suitable for isothermal amplification and toehold-switch-based detection. In some cases, toehold switches useful for the methods provided herein include, without limitation, synthetic norovirus-specific toehold switches that comprise a fully or partially double-stranded stem domain, a loop domain, a toehold domain, and at least a portion of a coding sequence of a reporter gene, wherein the toehold domain and at least a portion of the stem domain are complementary to a target norovirus RNA sequence. In some cases, synthetic norovirus-specific toehold switches comprise an RNA sequence selected from SEQ ID NOs:1-12 set forth in Table 1.
[0048] As shown in
[0049] Any isothermal amplification protocol can be used according to the methods provided herein. Exemplary types of isothermal amplification include, without limitation, nucleic acid sequence-based amplification (NASBA), reverse transcriptase recombinase polymerase amplification (RT-RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), nicking enzyme amplification reaction (NEAR), signal mediated amplification of RNA technology (SMART), rolling circle amplification (RCA), isothermal multiple displacement amplification (IMDA), single primer isothermal amplification (SPIA), recombinase polymerase amplification (RPA), and polymerase spiral reaction (PSR, available at nature.com/articles/srep12723 on the World Wide Web).
[0050] In some cases, it may be advantageous to adapt the methods described herein for high-throughput, reproducible, and rapid detection, for example in a clinical setting. When output from the toehold switch is coupled to a reporter element, such as a LacZ reporter element or portion thereof, the riboregulator acts as a genetically encodable sensor and detectable probe for endogenous DNA or RNA (e.g., endogenous pathogen DNA, endogenous pathogen RNA) in a sample. For example, such toehold switches can be provided in a device configured for rapid, reproducible detection in a non-laboratory setting (e.g., clinical setting). In some cases, the device comprises a preserved paper test article, upon which any step(s) of the method provided herein can be performed. In preferred embodiments, the paper test article is preserved by freeze-drying. The reporter element can be a reporter protein, e.g., a polypeptide with an easily assayed enzymatic activity or detectable signal that is naturally absent from the host cell. Exemplary but non-limiting reporter proteins include lacZ, catalase, -glucoronidase, xylE, GFP, RFP, YFP, CFP, neomycin phosphotransferase, luciferase, mCherry, and derivatives or variants thereof. In some embodiments of any of the aspects, the reporter protein is suitable for use in a colorimetric assay. Examples of genes encoding fluorescent proteins that may be used in accordance with the invention include, without limitation, those proteins provided in U.S. Patent Application No. 2012/0003630 (see Table 59 therein), incorporated herein by reference.
[0051] In certain embodiments, alpha-complementation is employed to decrease assay times and strengthen output from the cell-free transcription-translation reactions. As shown in
[0052] In some cases, DNA encoding the norovirus-specific toehold switches may be cloned into vectors upstream of the lacZ open reading frame. Such constructs can be used in paper-based cell-free reactions when supplemented with lacZ. In some cases, lacZ is provided as a pre-synthesized compound on the reaction substrate (e.g., a paper-based cell-free reaction substrate). For example, the toehold switch can encode at least a portion of lacZ such as lacZ. The amplified nucleic acids are contacted to cell-free reaction substrate to which lacZ is provided as a pre-synthesized peptide and under conditions which promote formation of a lacZ tetramer.
[0053] Other complementation reporter systems can be used for the methods described herein. For example, Green Fluorescent Protein (GFP) can be split by removing a single beta strand from its barrel structures to generate a large molecular weight GFP1-10 peptide, comprising beta strands one through 10, and a small molecular weight GFP11 peptide, comprising the 11.sup.th beta strand. When both peptides are present, they spontaneously reassemble into a fluorescently active combined protein. Split GFP systems are described, for example, at nature.com/articles/ncomms11046 and nature.com/articles/s41467-017-00494-8 on the World Wide Web. sfCherry, an improved folding version of mCherry, and mNeonGreen2 can also be split in similar ways and provide analogous fluorescence readout via complementation. There are multiple versions of split cas9 that can also be activated through complementation. See, for example, nature.com/articles/nbt.3149 and pnas.org/content/112/10/2984 on the World Wide Web.
[0054] Any appropriate sample can be used according to the methods provided herein. In some cases, the sample is a biological sample obtained from an individual (e.g., a human subject, a non-human mammal). The sample is, in some cases, a diagnostic sample. The sample type will vary depending on the target pathogen. For example, norovirus, including human forms of norovirus (i.e., Norwalk virus), can be detected in stool specimens, sputum, blood or vomitus of diseased individuals. Norovirus can also be present in body tissues, such as brain tissue, in an infected mammalian organism. Accordingly, a diagnostic sample for detecting norovirus can be a stool sample, a sputum sample, a vomitus sample, a tissue sample, or a blood sample. Samples appropriate for use according to the methods provided herein can also include, without limitation, food samples, drinking water, environmental samples, and agricultural products. In some cases, samples appropriate for use according to the methods provided herein are non-biological in whole or in part. Non-biological samples include, without limitation, plastic and packaging materials, paper, clothing fibers, and metal surfaces. In certain embodiments, the methods provided herein are used in food safety and food biosecurity applications, such as screening food products and materials used in food processing or packaging for the presence of pathogens in biological and/or non-biological samples.
[0055] Other applications for which the methods provided herein include, without limitation, profiling species in an environment (e.g., water); profiling species in an human or animal microbiome; food safety applications (e.g., detecting the presence of a pathogenic species, determining or confirming food source/origin such as type of animal or crop plant); obtaining patient expression profiles (e.g., detecting expression of a gene or panel of genes (e.g., biomarkers)) to monitor the patient's response to a therapeutic regimen, to select a therapeutic regimen suitable for the patient, or to detect exposure of the patient to a toxin or environmental agent that affects expression of the gene or a panel of genes.
[0056] In some cases, the device is used with a portable electronic reader. In this manner, the electronic reader serves as companion technology that provides robust and quantitative measurements of device outputs. In some embodiments, the electronic reader comprises readily available consumer components, open-source code, and laser-cut acrylic housing, and is powered by a rechargeable lithium ion battery. The electronic reader can further comprise an onboard data storage unit. In some cases, to achieve sensitive detection of toehold switch signal output, an acrylic chip that holds the freeze-dried, paper-based reactions is placed into the reader between a light source (e.g., to read optical density at excitation and emission wavelengths of light appropriate for and characteristic of a particular detectable reporter) and electronic sensors. In some cases, the light source is a light emitting diode (LED) light source. Samples can be read using onboard electronics. In this manner, a portable electronic reader can provide low-noise measurements of changes associated with the reporter element including changes in light transmission due to LacZ-mediated color change.
[0057] In certain embodiments, provided herein is a device for identifying a pathogen-associated nucleic acid, comprising a preserved paper test article, wherein the methods described herein are performed using the preserved paper test article. In some cases, the paper test article is preserved by freeze-drying.
[0058] Articles of Manufacture
[0059] In another aspect, the present invention provides articles of manufacture useful for detecting a pathogen in a sample according to the methods provided herein. In certain embodiments, the article of manufacture is a kit for detecting norovirus, where the kit comprises a norovirus detecting agent, a plurality of preserved paper test articles as described herein, and an electronic optical reader. Optionally, a kit can further include instructions for performing the pathogen detection methods provided herein.
[0060] In certain embodiments, provided herein is a kit for detecting a pathogen-associated nucleic acid, where the kit comprises a plurality of preserved paper test articles, a pathogen detection agent, a plurality of toehold switches that encode at least a portion of a reporter protein and comprise one or more single-stranded toehold sequence domains that are complementary to a target pathogen nucleic acid or the reverse complement thereof, and an electronic optical reader. In some cases, the kit also comprises instructions for performing the pathogen detection methods provided herein.
[0061] In other embodiments, provided herein is a kit for detecting a pathogen-associated nucleic acid, where the kit comprises a plurality of preserved test tube test articles, a pathogen detection agent, a plurality of toehold switches that encode at least a portion of a reporter protein and comprise one or more single-stranded toehold sequence domains that are complementary to a target pathogen nucleic acid or the reverse complement thereof, and an electronic optical reader. In some cases, the kit also comprises instructions for performing the pathogen detection methods provided herein.
[0062] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0063] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
[0064] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0065] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0066] As used herein, the terms approximately or about in reference to a number are generally taken to include numbers that fall within a range of 5% in either direction (greater than or less than) the number unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). Where ranges are stated, the endpoints are included within the range unless otherwise stated or otherwise evident from the context.
[0067] The present invention has been described in terms of one or more preferred embodiments, and it should be appreciated that many equivalents, alternatives, variations, and modifications, aside from those expressly stated, are possible and within the scope of the invention.
EXAMPLES
[0068] This section demonstrates a paper-based, cell-free platform for the detection of the prevalent GII.4 Sydney norovirus genotype (
[0069] Materials and Methods
[0070] Norovirus samples and bacterial strains: Stool samples positive for the norovirus GII.4 Sydney genotype and the norovirus GI.2 genotype were generously provided by Jan Vinj from the National Calicivirus Laboratory at the Centers for Disease Control and Prevention (CDC). Escherichia coli MG1655 (ATCC, 700926), methicillin-resistant Staphylococcus aureus MRSA252 (ATCC, BAA-1720), and Bacillus subtilis 168 (ATCC, 23857) were used for assay cross-reactivity experiments. For these experiments, RNA from the bacteria was extracted using a Quick-RNA Fungal/Bacterial Miniprep Kit (Zymo Research) following the manufacturer's instructions. To obtain purified viral RNA for cross-reactivity experiments, 5 L of GII.4, GI.2, and GI.6 positive stool samples were suspended in 140 L RNase-free water. The viral RNA was extracted by using QIAamp DSP Viral RNA Mini Kit (Qiagen, U.S.A.) according to the manufacturer's instructions. RNAs were eluted with 50 L RNase-free water and stored at 80 C. E. coli DH5 (ThermoFisher Scientific) was used for cloning of toehold switch plasmids.
[0071] In silico selection of toehold switch designs: An updated version of the selection algorithm described previously.sup.32 was used to identify toehold switches for detection of norovirus RNA. The algorithm facilitated selection six promising designs from a set of over 100 candidate toehold switches generated from each norovirus target RNA. Candidate devices were designed to bind to a 36-nt continuous region of the norovirus target RNA. Putative toehold switches were generated at 1-nt increments along the norovirus target RNA and multiple ensemble defect levels were computed for each sensor based on its deviation from the ideal secondary structure of the toehold switch. Ensemble defects were calculated for the toehold switch 5 end through to the 3 end of the hairpin (d.sub.min_sensor), the toehold domain of the toehold switch (d.sub.toehold), the binding site of the toehold switch within the target RNA (d.sub.binding_site), and the toehold switch region starting with the base immediately 3 of the target RNA binding site and extending 31 nts beyond the last base on the 3 end of the hairpin (d.sub.active_sensor).
[0072] For the latter two parameters, the ensemble defect was calculated based on a completely single-stranded ideal secondary structure. The parameter d.sub.active_sensor was intended to provide a measure of any secondary structures in the activated toehold switch that could interfere with translation after binding to the target RNA. In addition to ensemble defects, the equilibrium fraction f of target/toehold switch complexes in a system with equimolar concentrations of target and toehold switch RNAs was calculated as a measure of the affinity of the two RNAs. In practice, this parameter was almost always equal to 1. Designs that produced in-frame stop codons in the output gene were eliminated from further consideration. Each of the parameters was then normalized such that their maximum value across the set of putative designs for a given target RNA was equal to 1. These normalized parameters, designated by an overscore, were then inserted into a scoring function s:
s=5
Toehold switches displaying the lowest values of s and screened to have f>0.9 were selected for experimental testing. Sequences of the toehold switches generated by the algorithm are provided in Table 1 along with those of the norovirus target regions. The weighting coefficients used in the scoring function were determined empirically based on testing of earlier toehold switch mRNA sensor designs.sup.30, 32.
TABLE-US-00001 TABLE1 ToeholdswitchandnorovirustargetRNAsequences Name RNASequence Toeholdswitch GGGCCAUCUUCAUUCACAAAACUGGGAGCCAGAUUGCGAGGACUUUA S1RNA GAACAGAGGAGAUAAAGAUGUCGCAAUCUGGAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:i) Toeholdswitch GGGAUCGCCCUCCCACGUGCUCAGAUCUGAGAAUCUCAUGGACUUUA S2RNA GAACAGAGGAGAUAAAGAUGAUGAGAUUCUCAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:2) Toeholdswitch GGGACAAAACUGGGAGCCAGAUUGCGAUCGCCCUCCCACGGACUUUA S3RNA GAACAGAGGAGAUAAAGAUGGUGGGAGGGCGAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:3) Toeholdswitch GGGCUGGGACGAGGUUGGCUGCGGACCCAUCAGAUGGGUGGACUUUA S4RNA GAACAGAGGAGAUAAAGAUGACCCAUCUGAUAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:4) Toeholdswitch GGGUCAUUCGACGCCAUCUUCAUUCACAAAACUGGGAGGGACUUUAG S5RNA AACAGAGGAGAUAAAGAUGCUCCCAGUUUUAACCUGGCGGCAGCGCA AGAAGAUG(SEQIDNO:5) Toeholdswitch GGGAGCCAGAUUGCGAUCGCCCUCCCACGUGCUCAGAUCGGACUUUA S6RNA GAACAGAGGAGAUAAAGAUGGAUCUGAGCACAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:6) Toeholdswitch GGGUCUGAUGGGUCCGCAGCCAACCUCGUCCCAGAGGUCGGACUUUA A1RNA GAACAGAGGAGAUAAAGAUGGACCUCUGGGAAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:7) Toeholdswitch GGGUGGGAGGGCGAUCGCAAUCUGGCUCCCAGUUUUGUGGACUUUAG A2RNA AACAGAGGAGAUAAAGAUGACAAAACUGGGAACCUGGCGGCAGCGCA AGAAGAUG(SEQIDNO:8) Toeholdswitch GGGUGUGAAUGAAGAUGGCGUCGAAUGACGCCAACCCAUGGACUUUA A3RNA GAACAGAGGAGAUAAAGAUGAUGGGUUGGCGAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:9) Toeholdswitch GGGAGAUCUGAGCACGUGGGAGGGCGAUCGCAAUCUGGCGGACUUUA A4RNA GAACAGAGGAGAUAAAGAUGGCCAGAUUGCGAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:10) Toeholdswitch GGGAUCGCAAUCUGGCUCCCAGUUUUGUGAAUGAAGAUGGGACUUUA A5RNA GAACAGAGGAGAUAAAGAUGCAUCUUCAUUCAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:11) Toeholdswitch GGGUCGAAUGACGCCAACCCAUCUGAUGGGUCCGCAGCCGGACUUUA A6RNA GAACAGAGGAGAUAAAGAUGGGCUGCGGACCAACCUGGCGGCAGCGC AAGAAGAUG(SEQIDNO:12) NorovirusGII.4 AUGGAUUUUUACGUGCCCAGGCAAGAGCCAAUGUUCAGAUGGAUGAG sensetarget AUUCUCAGAUCUGAGCACGUGGGAGGGCGAUCGCAAUCUGGCUCCCA GUUUUGUGAAUGAAGAUGGCGUCGAAUGACGCCAACCCAUCUGAUGG GUCCGCAGCCAACCUCGUCCCAGAGGUCAACAAUGAGGUUAUGGCUU UGGAGCCCGU(SEQIDNO:13) NorovirusGII.4 ACGGGCUCCAAAGCCAUAACCUCAUUGUUGACCUCUGGGACGAGGUU antisensetarget GGCUGCGGACCCAUCAGAUGGGUUGGCGUCAUUCGACGCCAUCUUCA UUCACAAAACUGGGAGCCAGAUUGCGAUCGCCCUCCCACGUGCUCAGA UCUGAGAAUCUCAUCCAUCUGAACAUUGGCUCUUGCCUGGGCACGUA AAAAUCCAU(SEQIDNO:14) Norovirus AUGGAUUUUUAUGUGCCCAGACAAGAGUCAAUGUUCAGAUGGAUGAG GII.P17sense GUUCUCAGAUCUAAGCACAUGGGAGGGCGAUCGCAAUCUGGCUCCCA target GUUUUGUGAAUGAAGAUGGCGUCGAAUGACGCCGCUCCAUCUAAUGA UGGUGCUGCUGGUCUCGUACCAGAGGGCAACAACGAG(SEQIDNO:15) NorovirusGII.17 AUGGAUUUUUAUGUGCCCAGACAAGAGUCAAUGUUCAGAUGGAUGAG sensetarget GUUCUCAGAUCUAAGCACAUGGGAGGGCGAUCGCAAUCUGGCUCCCA GUUUUGUGAAUGAAGAUGGCGUCGAAUGACGCCGCUCCAUCUAAUGA UGGUGCUGCUGGUCUCGUACCAGAGGGCAACAACGAG(SEQIDNO:16) NorovirusGII.6 UGGAGUUUUAUGUGCCCAGACAAGAGGCCAUGUUCAGGUGGAUGAGA antisensetarget UUCUCUGACCUCAGCACAUGGGAGGGCGAUCGCAAUCUUGCUCCCGA GGGUGUGAAUGAAGAUGGCGUCGAAUGACGCUGCUCCAUCGAAUGAU GGUGCUGCCAACCUCGUACCAGAGGCCAACAAUGAGGUUAUGGC (SEQIDNO:17)
[0073] Calculation of Ensemble Defects for Toehold Switch Designs: Ensemble defect levels were calculated using NUPACK for toehold switch designs over the regions specified in the main text and indicated in UAAAG
(SEQ ID NO:18), with the RBS and start codon shown in bold, and a 31-nt linker between the sensor and the output gene with the sequence AACCUGGCGGCAGCGCAAGAAGAUGCGUAAA (SEQ ID NO:19). The parameters d.sub.min_sensor and d.sub.toehold were calculated by first computing the pairwise binding probabilities for the toehold switch sequence from the 5 end through to the 31st base beyond the 3 end of the hairpin (i.e., the full sequence shown in
[0074] In addition to the four terms above, we calculated two additional ensemble defect parameters during the design process. The term d.sub.full_sensor was generated by computing the ensemble defect for the full toehold switch sequence and structure shown in
[0075] Assessment and Further Optimization of Toehold Switch Selection Algorithm: To determine the effectiveness of the described toehold switch selection method, we have taken experimental fold change in lacZ production data (
[0076]
[0077] We applied the same series of analyses to the set of toehold switches for the sense norovirus target. However, these devices showed much weaker correlations between design parameters and experimental results (see
[0078] Since the terms used in the scoring function were originally normalized for each target RNA, we could not use the scoring function directly to determine if it was highly correlated with the experimental results from all 12 devices since they bound to different target RNAs. Instead, we took the fold change experimental results and supplied the regression with the set of the four predictor variables used by the scoring function but in non-normalized form: d.sub.min_sensor, d.sub.toehold, d.sub.binding_site, and d.sub.active_sensor. (Note: The fifth predictor variable f, the equilibrium fraction, used in the scoring function was equal to one for all devices tested.). In this case, the linear regression provided limited correlation with R.sup.2=0.29 (see
[0079] The three- and four-parameter linear regressions generated the following equations for predicting the fold change for the toehold switch sensors:
Three Parameter Fit (R.SUP.2.=0.57):
[0080]
Fold change=71.7 d.sub.full_sensor49.1 d.sub.active_sensor22.6 d.sub.binding_site+54.3
Four-Parameter Fit (R.SUP.2.=0.60):
[0081]
Fold change=93.2 d.sub.full_sensor43.3 d.sub.active_sensor22.1 d.sub.binding_site9.4 d.sub.min_target+61.3
[0082] For both these linear fitting functions, negative coefficients are used in front of all of the ensemble defect parameters as expected, since lower defect levels should lead to higher toehold switch performance (i.e. fold change). In addition, the parameters d.sub.full_sensor, d.sub.active_sensor, and d.sub.binding_site are listed from highest to lowest fitting function weighting factor. These three parameters define the most critical functional elements of the toehold switch devices. A properly folded secondary structure of the full sensor is required to provide a toehold region for target binding and a strong hairpin structure to repress translational leakage. The active sensor requires a translation start site with low secondary structure to promote rapid production of the output gene. Lastly, a binding site with low secondary structure helps ensure that the site is accessible for sensor binding. We expect that design selection algorithms can be further improved using strategies similar to the one described here and using much larger libraries of toehold switches to probe a wider range of sensor and target sequences experimentally.
[0083] Toehold switch plasmid construction: Synthetic DNA (Integrated DNA Technologies) encoding the norovirus-specific toehold switch sensors was amplified by PCR and inserted into plasmids using Gibson assembly with 30-bp overlap regions. Sequences of the toehold switches and the norovirus targets are provided in Table 1. Plasmids and DNA templates for transcription were constructed using conventional molecular biology techniques. The sequences of the plasmids were confirmed using Sanger sequencing (DNASU Sequencing Core, Tempe). The list of plasmids used in this work are provided in Table 2. Maps of these plasmids are presented in
TABLE-US-00002 TABLE 2 List of Plasmids Name Marker Description pAT_T7_HisLacZ Amp T7 RNAP-driven expression of N-terminal His- (SEQ ID NO: 69) tagged lacZ. pET15b backbone. ZIKV_Sensor_27B_LacZ Kan T7 RNAP-driven expression of Zika virus sensing (Addgene #: 75006) toehold switch with lacZ reporter. pCOLAduet backbone. pDM_T7_HisLacZomega Amp T7 RNAP-drive expression of N-terminal His-tagged lacZ. pET15b backbone. pDM_noro_S1_lacZA Kan T7 RNAP-driven expression of norovirus sense (SEQ ID NO: 77) orientation toehold switches (S1 to S6) with a lacZ pDM_noro_S2_lacZA reporter. pCOLAduet backbone. (SEQ ID NO: 78) pDM_noro_S3_lacZA (SEQ ID NO: 79) pDM_noro_S4_lacZA (SEQ ID NO: 80) pDM_noro_S5_lacZA (SEQ ID NO: 81) pDM_noro_S6_lacZA (SEQ ID NO: 82) pDM_noro_A1_lacZA Kan T7 RNAP-driven expression of norovirus antisense (SEQ ID NO: 70) orientation toehold switches (A1 to A6) with a lacZ pDM_noro_A2_lacZA reporter. pCOLAduet backbone. (SEQ ID NO: 72) pDM_noro_A3_lacZA (SEQ ID NO: 73) pDM_noro_A4_lacZA (SEQ ID NO: 74) pDM_noro_A5_lacZA (SEQ ID NO: 75) pDM_noro_A6_lacZA (SEQ ID NO: 76) pDM_noro_A2_lacZ Kan T7 RNAP-driven expression of norovirus antisense (SEQ ID NO: 71) orientation toehold switch A2 with full-length lacZ reporter. pCOLAduet backbone.
TABLE-US-00003 TABLE3 ListofPCRPrimersUsedforPlasmidConstruction Destination PrimerName Sequence template plasmid(s) 1acZ_pET15b_fwd TAACTAGCATAACCC pET15b pAT_T7_HisLacZ CTTGGGG(SEQID (SEQIDNO:69) NO:20) 1acZ_pET15b_rev CATATGGCTGCCGCG CGG(SEQIDNO:21) lacZ_insert_fwd AGCGGCCTGGTGCCG E.coliMG1655 CGCGGCAGCCATATG genome CGTAAAATGACCATG ATTACGGATTCACT (SEQIDNO:22) lacZ_insert_rev TTTAGAGGCCCCAAG GGGTTATGCTAGTTAT TTTTGACACCAGACCA ACTGGT(SEQID NO:23) lacZomega_BB_fwd AACAGTTGCGCAGCC pAT_T7_HisLacZ pDM_T7_ TGA(SEQIDNO:24) HisLacZomega CCAGTGAATCCGTAA lacZomega_BB_rev TCATGGTCAT(SEQID NO:25) lacZomega_insert_L ATGACCATGATTACG lacZomega_insert_R GATTCACTGGCCGTCG CCCGCACCGA(SEQID NO:26) lacZomega_insert_R TCAGGCTGCGCAACT lacZomega_insert_L GTTGGGAAGGGCGAT CGGTGCGGGC(SEQID NO:27) lacZalpha_BB_fwd TAGCATAACCCCTTGG pDM_noro_A2_lacZA pDM_noro_A2_lacZA GGC(SEQIDNO:28) (SEQIDNO:72) (SEQIDNO:72) lacZalpha_BB_rev GCGCAACTGTTGGGA AGG(SEQIDNO:29) lacZalpha_insert_L CGCACCGATCGCCCTT lacZalpha_insert_R CCCAACAGTTGCGCA GCCTGAATGGCGAAT GGTAAT(SEQID NO:30) lacZalpha_insert_R CCCGTTTAGAGGCCCC lacZalpha_insert_L AAGGGGTTATGCTATT ATTACCATTCGCCATT CAGG(SEQIDNO:31) lacZ_BB_fwd ATGACCATGATTACG ZIKV_Sensor_27B_LacZ, pDM_noro_A#_lacZ, GATTCACTGGCCGTC pDM_noro_A2_lacZA pDM_noro_A#_lacZA, (SEQIDNO:32) pDM_noro_S#_lacZ, Dstar_lacZ_BB_rev CCGGCTACCGTAGAA pDM_noro_S#_lacZA, ACGCGAATTTACTAG where# = CATAAGGGAGAGCGT {1,2,3,4,5,6} CGAGATC(SEQID NO:33) Dnorm_TS_insert_fwd CTAGTAAATTCGCGTT ToeholdswitchDNA TCTACGGTAGCCGGG strands CGCTAATACGACTCA CTATAGGG(SEQID NO:34) TS_insert_linker_rev GACGGCCAGTGAATC CGTAATCATGGTCATC TTCTTGCGCTGCCGCC AGGTT(SEQIDNO:35)
TABLE-US-00004 TABLE4 ListofDNAStrandsUsedforToeholdSwitchesandSequencing PrimerName Sequence Description Toeholdswitch GCGCTAATACGACTCACTATAGGGCCATC ToeholdswitchDNA S1DNA TTCATTCACAAAACTGGGAGCCAGATTGC templates GAGGACTTTAGAACAGAGGAGATAAAGAT GTCGCAATCTGGAACCTGGCGGCAGCGCA AGAAGATG(SEQIDNO:36) Toeholdswitch GCGCTAATACGACTCACTATAGGGATCGC S2DNA CCTCCCACGTGCTCAGATCTGAGAATCTCA TGGACTTTAGAACAGAGGAGATAAAGATG ATGAGATTCTCAACCTGGCGGCAGCGCAA GAAGATG(SEQIDNO:37) Toeholdswitch GCGCTAATACGACTCACTATAGGGACAAA S3DNA ACTGGGAGCCAGATTGCGATCGCCCTCCC ACGGACTTTAGAACAGAGGAGATAAAGAT GGTGGGAGGGCGAACCTGGCGGCAGCGC AAGAAGATG(SEQIDNO:38) Toeholdswitch GCGCTAATACGACTCACTATAGGGCTGGG S4DNA ACGAGGTTGGCTGCGGACCCATCAGATGG GTGGACTTTAGAACAGAGGAGATAAAGAT GACCCATCTGATAACCTGGCGGCAGCGCA AGAAGATG(SEQIDNO:39) Toeholdswitch GCGCTAATACGACTCACTATAGGGTCATT S5DNA CGACGCCATCTTCATTCACAAAACTGGGA GGGACTTTAGAACAGAGGAGATAAAGATG CTCCCAGTTTTAACCTGGCGGCAGCGCAA GAAGATG(SEQIDNO:40) Toeholdswitch GCGCTAATACGACTCACTATAGGGAGCCA S6DNA GATTGCGATCGCCCTCCCACGTGCTCAGAT CGGACTTTAGAACAGAGGAGATAAAGATG GATCTGAGCACAACCTGGCGGCAGCGCAA GAAGATG(SEQIDNO:41) Toeholdswitch GCGCTAATACGACTCACTATAGGGTCTGA A1DNA TGGGTCCGCAGCCAACCTCGTCCCAGAGG TCGGACTTTAGAACAGAGGAGATAAAGAT GGACCTCTGGGAAACCTGGCGGCAGCGCA AGAAGATG(SEQIDNO:42) Toeholdswitch GCGCTAATACGACTCACTATAGGGTGGGA A2DNA GGGCGATCGCAATCTGGCTCCCAGTTTTGT GGACTTTAGAACAGAGGAGATAAAGATGA CAAAACTGGGAACCTGGCGGCAGCGCAAG AAGATG(SEQIDNO:43) Toeholdswitch GCGCTAATACGACTCACTATAGGGTGTGA A3DNA ATGAAGATGGCGTCGAATGACGCCAACCC ATGGACTTTAGAACAGAGGAGATAAAGAT GATGGGTTGGCGAACCTGGCGGCAGCGCA AGAAGATG(SEQIDNO:44) Toeholdswitch GCGCTAATACGACTCACTATAGGGAGATC A4DNA TGAGCACGTGGGAGGGCGATCGCAATCTG GCGGACTTTAGAACAGAGGAGATAAAGAT GGCCAGATTGCGAACCTGGCGGCAGCGCA AGAAGATG(SEQIDNO:45) Toeholdswitch GCGCTAATACGACTCACTATAGGGATCGC A5DNA AATCTGGCTCCCAGTTTTGTGAATGAAGAT GGGACTTTAGAACAGAGGAGATAAAGATG CATCTTCATTCAACCTGGCGGCAGCGCAA GAAGATG(SEQIDNO:46) Toeholdswitch GCGCTAATACGACTCACTATAGGGTCGAA A6DNA TGACGCCAACCCATCTGATGGGTCCGCAG CCGGACTTTAGAACAGAGGAGATAAAGAT GGGCTGCGGACCAACCTGGCGGCAGCGCA AGAAGATG(SEQIDNO:47) pCOLA_seq_fwd CGTTACTGGTTTCACATTCACCACCC Sequencingprimerusedfor (SEQIDNO:48) confirmingsequenceof toeholdswitchsensors insertedinpCOLA,pCDF, pACYCexpressionvectors. pET15b_seq_fwd1 CCTGCCACCATACCCACGC(SEQID Sequencingprimerusedfor NO:49) confirmingsequenceof genesinsertedintopET15b vectorswithinthe multiplecloningsite region.
[0084] Preparation of paper-based cell-free systems: Cell-free transcription-translation systems (NEB, PURExpress) were prepared for freeze-drying with the following components by volume: cell-free solution A, 40%; cell-free solution B, 30%; RNase Inhibitor (Roche, 03335402001, distributed by MilliporeSigma), 2%; chlorophenol red-b-D-galactopyranoside (Roche, 10884308001, distributed by MilliporeSigma, 24 mg/ml), 2.5%; with the remaining volume reserved for toehold switch DNA, water, and lacZ peptide added to a final concentration of 2 M. When testing the toehold switches expressed from a plasmid, the plasmid DNA was added to the cell-free reaction mix to a final concentration of 30 ng/L. When testing toehold switches expressed from linear DNA, the DNA was added to the cell-free reaction mix to a final concentration of 33 nM.
[0085] Filter paper (Whatman, 1442-042) for housing the cell-free reactions was first blocked with 5% bovine serum albumin (BSA) overnight. After blocking, the paper was washed three times in water for 5 to 10 minutes. The paper was then heated to 50 C. for drying and cut into 2-mm diameter paper disks using a biopsy punch. The disks were transferred into 200-L, PCR tubes and 1.8 L of the cell-free reaction mix was applied to each disk. PCR tubes containing the paper disks were then flash frozen in liquid nitrogen and transferred into a lyophilizer to dry overnight. Measurements were performed on the resulting paper disks two to four days after the freeze-drying process was completed. The paper disks remained active for at least a month of room-temperature storage using conditions described previously.sup.30, with the systems stored under nitrogen, shielded from light, and in the presence of silica gel desiccation packages.
[0086] Screening of norovirus-specific toehold switches: Norovirus target RNA was produced using T7 RNA polymerase-based transcription (Epicenter, ASF3257) from linearized DNA templates. 1.8 L of a 5 M solution of the target RNA was applied to a paper disk containing the embedded cell-free system and DNA for the toehold switch. The progress of the cell-free reaction was then monitored in a plate reader (Biotek, H1MF) at 37 C. in triplicate. The relative absorbance of the paper-based reactions at 575 nm wavelength or OD575 was calculated by taking the absorbance at 575 nm and subtracting from it the absorbance at 575 nm measured at the start of the reaction. This relative absorbance thus removes any absorbance contribution from the paper disk and the lacZ substrate chlorophenol red-b-D-galactopyranoside. The fold change in lacZ production rate was calculated by computing the rate of change in OD575 and dividing the rate obtained for the toehold switch in the presence of the target RNA by that obtained in the absence of the target RNA. The fold change in lacZ production rate was measured after one hour of cell-free reaction for assessment of the toehold switches. The change in OD575 or OD575 was calculated by taking the OD575 for the reaction with the toehold switch and the target RNA and subtracting from it the OD575 for the reaction of the toehold switch without the target RNA. OD575 was computed after two hours of cell-free reaction. Errors in OD575 were determined from the standard deviation of triplicate measurements. Errors in fold change lacZ production rate and OD575 were determined by adding the relative and absolute errors of OD575 in quadrature, respectively. Welch's unequal variances t-test was used to calculate p-values for plate reader detection experiments with p<0.05 used as the cutoff to define a statistically significant result.
[0087] Isothermal amplification of norovirus RNA: For NASBA experiments, reaction buffer (Life Sciences, NECB-24; 33.5%), nucleotide mix (Life Sciences NECN-24; 16.5%), RNase inhibitor (Roche, 03335402001; 0.5%), 12.5 mM of each DNA primer (2%), nuclease free water (2.5%), and RNA amplicon (20%) were assembled at 4 C. and incubated at 65 C. for 2 min, followed by a 10 min incubation at 41 C. Enzyme Mix (Life Sciences NEC-1-24; 25%) was then added to the reaction (for a final volume of 5 L), and the mixture was incubated at 41 C. for 2 hr. The amplified product was then diluted 1:6 in water and applied to paper disks containing the cell-free system and DNA for the toehold switch. Sequences of the primers used for NASBA and RT-RPA are provided in Table 5.
TABLE-US-00005 Norovirusisothermalamplificationprimers Norovirus Toehold Genotype Switch ForwardPrimer ReversePrimer GI1.4 S1 AATTCTAATACGACTCACTATAG ATTGTTGACCTCTGGGACGA GGAGAAGGATTCTCAGATCTGAG (SEQIDNO:51) CACGTGGGA(SEQIDNO:50) AATTCTAATACGACTCACTATAG CTCATTGTTGACCTCTGGGA S2 GGAGAAGGCAGGCAAGAGCCAA (SEQIDNO:53) TGTTCAGA(SEQIDNO:52) AATTCTAATACGACTCACTATAG S6 GGAGAAGGGCAAGAGCCAATGTT CTCATTGTTGACCTCTGGGA CAGATGGA(SEQIDNO:54) (SEQIDNO:55) AATTCTAATACGACTCACTATAG A1 GGAGAAGGGCTCCAAAGCCATAA GCAAGAGCCAATGTTCAGATGG CCTCA(SEQIDNO:56) A(SEQIDNO:57) AATTCTAATACGACTCACTATAG A2 GGAGAAGGCTCATTGTTGACCTC GATGGATGAGATTCTCAGATCT TGGGA(SEQIDNO:58) GA(SEQIDNO:59) AATTCTAATACGACTCACTATAG A4 GGAGAAGGCTCATTGTTGACCTC CAAGAGCCAATGTTCAGATGGA TGGGA(SEQIDNO:60) (SEQIDNO:61) AATTCTAATACGACTCACTATAG GII.6 S2 GGAGAAGGCAGACAAGAGGCCA TCATTGTTGGCCTCTGGTACGA TGTTCA(SEQIDNO:62) (SEQIDNO:63)
[0088] RT-RPA experiments used the commercial TwistAmp Basic RT kit (TwistDx). Reactions were prepared by combining 10 M forward primer (4.8%), 10 M reverse primer (4.8%), rehydration buffer, RNase Inhibitor (Roche, 03335402001; 4.4%), and RNA amplicon (22%) at room temperature and transferring the mixture to the freeze-dried reaction pellet. After mixing, 2.5 L of 280 mM magnesium acetate (5%) was added to start the reaction and it was incubated at 41 C. for 5-7 minutes. The reaction tube was then inverted vigorously 8-10 times, spun down briefly, and returned to incubation at 41 C. for 2 hours. The amplified product was then diluted 1:6 in water and applied to paper disks containing the cell-free system and DNA for the toehold switch.
[0089] For determination of assay detection limits, NASBA and RPA reactions were run in triplicate for each concentration of the target RNA or virus and applied to the paper-based toehold switch reactions as described above.
[0090] Synbody-based virus enrichment: A 30-L volume of MyOne Streptavidin C1 streptavidin-coated magnetic beads (Life Technologies, U.S.A.), corresponding to 2.110.sup.8 to 3.610.sup.8 total beads, was added to Protein LowBind tubes (Eppendorf, U.S.A.). The bead storage solution was removed and the beads were washed three times with 1 mL of PBST (0.05% Tween 20 in 1 phosphate-buffered saline). The beads were then blocked with 3% BSA in PBST overnight at 4 C. The following day, the beads were suspended in fresh 3% BSA in PBST and blocked for an additional 2 hours. The beads were then washed three times with PBST and suspended in 30 L of 1 PBS (phosphate-buffered saline) to yield a final suspension of blocked magnetic beads.
[0091] A dilution series of virus particles ranging from 1:10.sup.3 to 1:10.sup.7 was prepared by first taking a 1-L aliquot of a norovirus GII.4 Sydney positive stool sample and diluting it into 1 mL of PBS. The resulting 1:10.sup.3 sample was serially diluted by factors of ten into PBS to generate the rest of the dilution series. Biotin-labelled synbody ASU1052 (described in Gupta et al., (2017) Anal. Chem. 89:7174-7181, which is incorporated herein by reference) was then added to a concentration of 1 M into each diluted sample and incubated with shaking for 1 hour at room temperature. The solutions were then added to the blocked streptavidin-coated magnetic beads and shaken for an additional 15 minutes at room temperature. The beads were washed three times with PBST and one time with PBS and then suspended with 50 L water. The beads were incubated for 2 min at 95 C. to release the viral RNA for analysis. 50 L of each stool dilution was also incubated for 2 minutes at 95 C. and used for comparison.
[0092] For cross-reactivity testing and tests of the assay against the GII.6 genotype, 1 L of GII.4, GII.6, and GI.6 positive stool samples, as well as a norovirus-negative stool sample, were diluted into 1 ml of PBS and followed by the synbody enrichment procedure described above.
[0093] Results and Discussion
[0094] Design of Toehold Switches for Norovirus GII Detection
[0095] We first identified conserved sequence regions of the norovirus GII genome suitable for isothermal amplification and toehold-switch-based detection. Over 400 norovirus GII complete and partial genome sequences were downloaded from the NCBI database and aligned. A 200-nt target sequence that was highly conserved across the norovirus GII genomes was identified for subsequent amplification and detection experiments. This conserved sequence ran from the C-terminal region of the viral RNA-dependent RNA polymerase through to the N-terminal region of VP1, the major capsid protein.
[0096] Toehold switches for detection of the target sequence were then generated based on an updated design first applied to the detection of the Zika virus. The updated toehold switch design provided lower leakage compared to earlier toehold switches and was originally developed for evaluating AND logic expressions in E. coli. As illustrated in
[0097] Based on the modified operating mechanism of the toehold switches, we implemented an updated design selection algorithm to identify the toehold switches most likely to be effective at detecting the target RNA. This algorithm modelled the interaction of a series of toehold switches designed to bind along the target RNA in 1-nt increments using the NUPACK software package. Ensemble defect levels and the affinity of the toehold switch for the target RNA were used to select designs most likely to perform well. Since the target RNA can be transcribed in either the sense or antisense direction following amplification, the top six toehold switches for the sense and antisense target RNAs were selected for experimental testing (see Table 1).
[0098] Faster RNA Detection with Toehold Switches Using -Complementation of lacZ
[0099] In previous work using paper-based cell-free systems, the lacZ enzyme has been used as the output gene for the toehold switch to produce a visible test result through cleavage of a chromogenic substrate. LacZ, however, at 3.1 kb in length is a relatively long reporter gene compared to alternatives such as GFP (0.75 kb) and mCherry (0.72 kb), which leads to several drawbacks. In particular, the longer length of lacZ means that a greater fraction of the cell-free system resources is consumed during transcription and translation, which weakens the output from the assay, and longer times are required for the protein to be synthesized and fold, which increases the time required for the test.
[0100] In response to the above limitations, we investigated using -complementation of lacZ to decrease assay times and strengthen output from the cell-free transcription-translation reactions. Alpha-complementation is a widely applied technique often used for screening cloning vectors. It works by dividing the lacZ enzyme into two peptides termed and (
[0101] We thus implemented toehold switches that used lacZ as the output protein and added the much larger lacZ peptide as a pre-synthesized component to the paper-based cell-free reactions. Since lacZ is encoded in 180 bp, which is only 6% of the length of the full lacZ gene, transcription and translation of each lacZ molecule should occur faster compared to lacZ and could in principle impose a substantially smaller burden on the cell-free system for each active lacZ tetramer formed. DNA encoding the norovirus-specific toehold switches was cloned into vectors upstream of the lacZ open reading frame. Following sequence confirmation, the resulting plasmids were tested in paper-based cell-free reactions supplemented with lacZ, and cleavage of the chromogenic substrate chlorophenol red-b-D-galactopyranoside was monitored using a plate reader.
[0102] To determine the effect of a-complementation on detection speed, we took one of the better performing toehold switches, A2, and inserted it into a plasmid upstream of the full lacZ open reading frame. PCR was then used to amplify linear DNA fragments from both lacZ and full-length lacZ plasmids and equal concentrations of the two DNA products were tested in paper-based cell-free reactions in the presence of the norovirus target RNA. We observed a substantial increase in the speed of the colorimetric reaction for the lacZ systems compared to full-length lacZ (
[0103] Isothermal Amplification Using NASBA and RT-RPA
[0104] Since the concentrations of norovirus in stool samples from symptomatic patients range from 30 attomoles/liter (aM) to 3 picomoles/liter (pM), the toehold switches cannot be efficiently activated by viral nucleic acids without an amplification step. We investigated the NASBA and RT-RPA isothermal amplification techniques to determine which provided the lowest limit of detection against the norovirus GII target RNA. The six toehold switches providing the highest ON/OFF ratios were selected for testing with amplified RNA. Since each sensor targeted different regions within the conserved target sequence, we evaluated different amplification primers for each sensor. One primer from each pair contained a 5 T7 promoter sequence so that the resulting amplicon could be transcribed into RNA for optimal detection using the corresponding toehold switch.
[0105] Toehold switches S2 and S6 provided the lowest detection limits in the amplification tests. Two-hour amplification reactions were run with synthetic norovirus GII target RNAs ranging in concentration from 220 femtomoles/liter (fM) to 0.2 aM. The SI prefix femto represents a factor of 10.sup.15, or in exponential notation, 1E-15. The amplified products were then diluted seven-fold and applied to the toehold switch reactions. For the RT-RPA reactions, both S2 and S6 toehold switches could detect down to 22 fM of the norovirus RNA with colorimetric outputs that could be readily discerned by eye (
[0106] NASBA tests provided improved detection limits compared to RPA. For toehold switch S6, we could discern concentrations down to 2 fM by eye within 2 hours and by plate reader within 1 hour (
[0107] Diagnostic Validation with Active Norovirus
[0108] To validate the detection platform, we performed experiments with active norovirus samples and tested the assay for cross-reactivity against other potential pathogens. Following previous reports on norovirus and our earlier work on the Zika virus, we first evaluated a simple method for extracting viral RNA from infected stool samples using a brief heating step. A norovirus GII.4 Sydney positive stool sample was diluted 1:50 in PBS and heated for two minutes at 95 C. (
[0109] To further evaluate cross-reactivity, we extracted RNA from E. coli, B. subtilis, and a methicillin-resistant S. aureus (MRSA) strain and added the RNA at masses of 80.6 ng, 123.5 ng, and 100.8 ng, respectively, to the NASBA reaction. RNA was also extracted from stool samples containing norovirus GII.4 Sydney, GI.2, and GI.6 and added to the NASBA reaction at a concentration of approximately 20 fM. None of these samples of bacterial RNA nor the GI.2 and GI.6 norovirus genotypes were able to activate toehold switch S2 for visual detection. The system was strongly activated by norovirus GII.4 Sydney RNA (
[0110] Norovirus Enrichment Using a Synbody-Based Magnetic Bead Technique
[0111] The ability to identify norovirus in dilute solutions or from large solution volumes is valuable for improving diagnostic sensitivity and for confirming complete decontamination of an area following an outbreak. For instance, dilute liquids, such as cleaning solutions from kitchen and bathroom surfaces, can be tested for residual virus following cleanup. To this end, we employed a synbody-based magnetic bead capture assay to concentrate norovirus from dilute solutions (
[0112] To capture and concentrate the virus, we took stool samples positive for norovirus GII.4 Sydney at a concentration of 270 fM as determined by qRT-PCR and prepared a series of higher dilutions ranging from 1:10.sup.3 to 1:10.sup.7 in PBS. Biotin-labelled synbody ASU1052, which was previously validated against multiple norovirus strains.sup.35, and streptavidin-coated magnetic beads were added sequentially to the diluted samples with shaking at room temperature for 75 minutes total. After magnetic capture and washing, the beads were suspended with 50 L of water and heated to 95 C. for 2 min to release the virus RNA. These virus samples, along with comparison ones heated but not subjected to synbody capture, were then amplified using NASBA and applied to paper-based cell-free systems containing toehold switch S2.
[0113]
[0114] To determine if the assay could also be applied to closely related norovirus genotypes, we also tested the systems against a stool sample with the norovirus GII.6 genotype. Virus particles were enriched using the ASU1052 synbodies and subject to NASBA using the primers optimized for GII.4 Sydney amplification. Unfortunately, these primers were not effective for this genotype. Primers modified to match the GII.6 genome, however, enabled successful amplification. Despite the presence of some mismatches between toehold switch S2 and its binding site on the GII.6 amplicon (see
[0115] We have demonstrated a paper-based assay for detection of norovirus that does not require expensive thermal cycling equipment, provides test results that can be read directly by eye, and employs toehold switch riboregulators to eliminate false positives caused by non-specific amplification. The assay enables visual detection of norovirus down to a concentration of 270 aM from clinical stool samples containing live norovirus particles from the GII.4 Sydney genotype. The addition of a virus capture and concentration step using synbodies enables a further 1000-fold improvement in the sensitivity of the assay, allowing concentrations as low as 270 zM to be detected by eye after a three-hour paper-based reaction. This work also demonstrates that paper-based transcription-translation systems can remain active upon exposure to samples diluted from stool and confirms that RPA products can be successfully detected in the cell-free reactions, albeit with a higher detection limit than comparison NASBA products.
[0116] The norovirus assay provides significant improvements in sensitivity compared to our previously reported diagnostic assay for the Zika virus.sup.31. The Zika virus test provided a 1 fM detection limit against synthetic target RNAs and detected the virus from plasma at a concentration of 2.8 fM. In contrast, the norovirus assay demonstrated a 5-fold lower detection limit of 200 aM against a synthetic target and was successfully applied to a stool sample with a 270 aM concentration of norovirus. Addition of the synbody concentration step thus yielded an overall 5000-fold improvement in the detection limit. The Zika virus is known to be present at very low levels in symptomatic patients, with serum concentrations ranging from 8 zM to 6.1 fM with an average of 160 aM.sup.43. These concentrations are 10- to 100-fold lower than those observed for patients with the related dengue and chikungunya viruses.sup.44. Accordingly, our synbody-based concentration methods could prove valuable for extending the existing Zika test to more carriers of the virus. While the Zika diagnostic was only applied to a plasma sample from a viremic rhesus macaque, we have also demonstrated in this work that the diagnostic platform can be used on human stool samples, which can be used to identify many other causes of acute gastrointestinal illness beyond norovirus.
[0117] Although our norovirus assay provides sufficient sensitivity for detection from clinical samples, at present it requires 3-6 hours of processing time to reach a test result, which is substantially longer than many other diagnostics that employ isothermal amplification. We expect that large reductions in assay time can be obtained by further optimization of the synbody-based enrichment technique, by designing toehold switches optimized for quicker and stronger output, and by implementing new reporter proteins with faster activation. Indeed, the substantial decrease in reaction time that we observed using a-complementation of lacZ suggests that there is ample room for improvement using alternative reporters. Moreover, use of faster amplification techniques such as RT-RPA with improved primers or strand-displacement amplification (SDA) could further decrease the time to detection for the technique. We also expect that toehold switch dynamic range against pathogen RNAs can be improved with continued refinement of in silico selection algorithms. In particular, screening experiments examining larger numbers of toehold switches against diverse target RNAs will be essential for generating in silico design scoring functions that are able to accurately predict their performance when deployed in cell-free transcription-translation systems.
[0118] The assay can also be improved by reducing its cost. In addition to the $1/test price of the paper-based component of the assay.sup.30, the per test costs of NASBA, streptavidin-coated magnetic beads, and biotinylated synbodies are $2.25, $5.38, and $0.10, respectively. The total cost in materials for the assay is thus $8.73 and the overall assay requires approximately 35 minutes of hands on time. A previous study in South Africa to assess GeneXpert cartridge costs has reported an average lab technician salary of $9.07/hr,.sup.14 which brings the total assay cost to $14.02 with labor included. Materials costs for this estimate are based on retail prices for the components. It is likely that the quantities of magnetic beads used in the assay can be reduced substantially with further refinement of the experimental procedures, and materials costs can decrease with purchases at larger scales. Even without optimization of the assay toward reduced price, the total cost per assay remains lower than the $14.93 calculated for GeneXpert cartridges in South Africa where concessional pricing is in effect.sup.14. Furthermore, our assay does not require large initial expenditures for purchasing expensive equipment.
[0119] The continual emergence of new variants of norovirus means that our paper-based assay will need to be updated as other strains replace GII.4 Sydney to ensure that false negatives do not occur. For instance, the GII.P17-GII.17 norovirus strain has recently become predominant in Asia.sup.10 and immunochromatographic tests, which were developed for the GII.4 strain, have demonstrated 1000-fold poorer detection limits against the emergent strain.sup.45. To reduce the probability of false negatives, our assay employs a target sequence that is well conserved across different GII strains, including GII.P17 and GII.17. The toehold switch S2 sensor is predicted by NUPACK simulations to tolerate several mismatches in the target RNA, particularly within the toehold region, and still expose the RBS and start codon to enable translation of the reporter gene (see
[0120] Despite these areas for improvement, the reasonably low cost of the assay and its reliance on only inexpensive equipment enables it to be implemented in decentralized contexts such as remote clinics or cruise ships with trained operators. Furthermore, coupling the validated molecular components of the assay with companion hardware for incubation and readout.sup.31 or liquid handling.sup.46 has the potential to substantially reduce operator training requirements and lead to more widespread deployment in the future. Lastly, the demonstrated ability of synbodies and toehold switches to bind to proteins and nucleic acids, respectively, from a variety of different pathogens.sup.30-32, 41, 42 indicates that our combined concentration and detection approach can be successfully applied to a diverse range of infectious agents.