Use of octaketide synthases to produce kermesic acid and flavokermesic acid

Abstract

A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C.sub.14-C.sub.34 aromatic compound of interest (e.g. carminic acid).

Claims

1. A method for producing an octaketide derived aromatic compound, wherein the method comprises: (I): contacting in vivo in a recombinant host cell comprising a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS), wherein the OKS is of a different genus than the host cell: (i): a starter unit and an extender unit with said OKS such that the starter and extender units convert into a non-reduced octaketide; (II): converting in vivo within the recombinant host cell the non-reduced octaketide of step (I) into a C.sub.14-C.sub.34 aromatic aglycon compound via at least one in trans acting aromatase/cyclase, wherein the aromatic aglycon compound is not SEK4 and/or SEK4B; (III): the recombinant host cell further comprises a glycosyltransferase gene encoding a glycosyltransferase having at least 90% sequence identity to SEQ ID NO: 2 or amino acids 1 to 468 of SEQ ID NO:2, which glycosylates the aromatic aglycon compound produced in step (II) into a C.sub.14-C.sub.34 aromatic glycoside compound; and (IV): isolating the aromatic glycoside compound of step (III) so as to get a composition, wherein the composition comprises less than 1% w/w dry matter of recombinant host cell material, and wherein the recombinant host cell is a plant cell or a filamentous fungal cell.

2. The method of claim 1, wherein the recombinant host cell is a growing recombinant host cell and step (I) and step (II) comprise: (I): contacting in vivo in a growing recombinant host cell comprising a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS), wherein the OKS is of a different genus than the host cell: (i): a starter unit and an extender unit with said OKS such that the starter and extender units convert into a non-reduced octaketide; and (II): converting in vivo within the growing recombinant host cell the non-reduced octaketide of step (I) into a C.sub.14-C.sub.34 aromatic aglycon compound, wherein the aromatic aglycon compound is not SEK4 and/or SEK4B.

3. The method according to claim 1, wherein the plant cell is Nicotiana sp.

4. The method according to claim 1, wherein the plant cell is an Aspergillus cell.

5. The method according to claim 1, wherein the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a plant and wherein the plant is a plant selected from the group consisting of: Aloe spp. and Hypericum spp.

6. The method of claim 5, wherein the octaketide synthase (OKS) in step (I) is a OKS comprising an amino acid sequence, which has at least 70% sequence identity with amino acids 1 to 403 of SEQ ID NO:7 (AaOKS).

7. The method of claim 5, wherein the octaketide synthase (OKS) in step (I) is a OKS comprising an amino acid sequence, which has at least 70% identity with amino acids 1 to 393 of SEQ ID NO:15 (HpPKS2).

8. The method according to claim 1, wherein the starter unit is acetyl-CoA and/or malonyl-CoA.

9. The method according to claim 1, wherein the: recombinant host cell is a host cell selected from the group consisting of: Aspergillus and Nicotiana sp.; and the OKS of a different genus than the host cell is an OKS selected from the group consisting of: OKS from Aloe spp.) and Hypericum spp.

10. The method according to claim 1, wherein the aromatic aglycon compound is a C.sub.16 aromatic aglycon compound.

11. The method according to claim 10, wherein the C.sub.16 aromatic aglycon compound is flavokermesic acid (FK) or kermesic acid (KA).

12. The method of claim 1, wherein the aromatase/cyclase is a aromatase/cyclase comprising an amino acid sequence, which has at least 70% sequence identity with amino acids 1 to 169 of SEQ ID NO:17 (Streptomyces ZhuI); and/or wherein the aromatase/cyclase is a aromatase/cyclase comprising an amino acid sequence, which has at least 70% sequence identity with amino acids 1 to 256 of SEQ ID NO:19 (Streptomyces ZhuJ).

13. The method of claim 1, wherein the aromatic glycoside compound of interest is a C.sub.16 aromatic glycoside compound and wherein the C.sub.16 aromatic glycoside compound is a flavokermesic acid glycoside or a kermesic acid glycoside.

14. The method of claim 13, wherein the C.sub.16 aromatic glycoside compound is a flavokermesic acid glycoside and the flavokermesic acid glycoside is Dell.

15. The method of claim 13, wherein the C.sub.16 aromatic glycoside compound is a kermesic acid glycoside and the kermesic acid glycoside is carminic acid (CA).

Description

DRAWINGS

(1) FIG. 1: Schematic presentation of the herein relevant glycosyltransferase activity of the herein described isolated/cloned novel glycosyltransferase of SEQ ID NO:2 herein. As illustrated in the figure, it was found to be able to conjugate glucose to the aglycons flavokermesic acid (FK) and kermesic acid (KA).

(2) FIG. 2: Shows FIG. 5A of the Tang, Y. et al (2004) article. As can be seen in the figure and as further described in the article, the Act PKS (termed octaketide synthase (OKS)) creates a non-reduced octaketide and this octaketide is via the ZhuI aromatase/cyclase and ZhuJ cyclase converted into flavokermesic acid (FK) (called TMAC). The SEK4 and SEK4B compounds are also formed spontaneously (structures shown in FIG. 2 may be termed shunt products).

(3) FIG. 3: Shows an example of a model for a suitable biosynthetic pathway that may lead to carminic acid.

(4) FIG. 4: Shows 9,10-anthraquinone skeleton; anthrone skeleton and FK antrone compound structure.

DETAILED DESCRIPTION OF THE INVENTION

(5) A Recombinant Host Celle.g. Step (I)

(6) Based on e.g. the sequence information disclosed herein, it is routine work for the skilled person to make a herein relevant recombinant host cell. As an example, based on the prior art the skilled person knows numerous different suitable recombinant host cells that for years have been used as recombinant host cells for e.g. expression of different polypeptides of interest.

(7) The recombinant host cell in the method of the first aspect may be a growing recombinant host cell or e.g. in a so-called stationary phase.

(8) Preferably, the recombinant host cell in the method of the first aspect is a growing recombinant host cell and step (I) and step (II) of the first aspect are:

(9) (I): contacting in vivo in a growing recombinant host cell comprising a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) and wherein the OKS is of a different genus than the host cell: (i): suitable starter unit and extender units with the recombinantly introduced OKS capable of converting the starter and extender units into a non-reduced octaketide under suitable growth conditions wherein there in vivo is produced the non-reduced octaketide; and

(10) (II): converting in vivo within the growing recombinant host cell the non-reduced octaketide of step (I) into a C.sub.14-C.sub.34 aromatic aglycon compound of interest, wherein the aromatic aglycon compound of interest is not SEK4 and/or SEK4B.

(11) The recombinant host cell may be any suitable cell such as any eukaryotic cell [e.g. mammalian cells (such as e.g. Chinese hamster ovary (CHO) cells) or a plant cell] or any prokaryotic cell.

(12) It may be preferred that the recombinant host cell is a plant cell, preferably wherein the plant cell is a plant cell selected from the group consisting of: Nicotiana sp. (e.g. Nicotiana benthamiana cells); rhubarb, buckweed, Hypericum and Aloe sp. Preferably, the plant cell is a Nicotiana sp., more preferably the plant cell is Nicotiana benthamiana.

(13) The recombinant host cell may be a cell selected from the group consisting of a filamentous fungal cell and a microorganism cell.

(14) Filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are characterized by a vegetative mycelium composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.

(15) It may be preferred that the filamentous fungal cell is a cell of a species selected form the group consisting of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, and Trichoderma or a teleomorph or synonym thereof.

(16) A preferred Aspergillus cell is Aspergillus niger, Aspergillus oryzae or Aspergillus nidulans. The most preferred Aspergillus cell is Aspergillus nidulans.

(17) A preferred microorganism cell herein is a microorganism cell selected from the group consisting of a yeast cell and a prokaryotic cell.

(18) A preferred yeast cell is a yeast cell of a phylum selected from the group consisting of Ascomycetes, Basidiomycetes and fungi imperfecti. Preferably the yeast cell is of the phylum Ascomycetes.

(19) A preferred Ascomycetes yeast cell is of a genus selected from the group consisting of Ashbya, Botryoascus, Debaryomyces, Hansenula, Kluveromyces, Lipomyces, Saccharomyces, sush as Saccharomyces cerevisiae, Pichia and Schizosaccharomyces.

(20) A preferred yeast cell is a yeast cell of a genus selected from the group consisting of Saccharomyces, such as Saccharomyces cerevisiae and Pichia.

(21) A preferred prokaryotic cell is selected from the group consisting of: Bacillus, Streptomyces, Corynebacterium, Pseudomonas, lactic acid bacteria and an E. coli cell.

(22) A preferred Bacillus cell is B. subtilis, Bacillus amyloliquefaciens or Bacillus licheniformis.

(23) A preferred Streptomyces cell is Streptomyces setonii or Streptomyces coelicolor.

(24) A preferred Corynebacterium cell is Corynebacterium glutamicum.

(25) A preferred Pseudomonas cell is Pseudomonas putida or Pseudomonas fluorescens.

(26) Polyketide synthase (PKS) gene encoding an octaketide synthase (OKS)e.g. step (I) Step (I) of the first aspect relates to Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) and wherein the OKS is of a different genus than the host cell.

(27) As discussed above and as known in the artnon-reduced octaketides may spontaneously be converted in vivo to the SEK4 and SEK4B compounds (structures shown in FIG. 2 hereinmay herein be termed shunt products).

(28) As understood by the skilled person in the present contextidentification of SEK4 and/or SEK4B in vivo within the recombinant host cell demonstrates that non-reduced octaketide is present in vivo.

(29) Accordingly, the Type III octaketide synthase (OKS) of step (I) may be defined as an OKS, which in vitro is capable of producing the octaketide-derived shunt products SEK4 and/or SEK4B.

(30) Assay for such an in vitro analysis is described e.g. in working Example 9 herein.

(31) As discussed above, the skilled person knows if a specific PKS of interests is a Type III PKS.

(32) As discussed above, in the prior art is known several different type III PKSs from plants, bacteria and/or fungi.

(33) Accordingly, it may be preferred that the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a plant, a bacterium or a fungi,

(34) Preferably, the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a plant.

(35) If the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a plant it is preferred that the plant is a plant selected from the group consisting of: Aloe spp. (preferably Aloe arborescens), Hypericum spp. (preferably Hypericum perforatum), rhubarb, buckweed and Hawortia spp.

(36) Preferably the plant is a plant selected from the group consisting of: Aloe spp. and Hypericum spp.

(37) More preferably, the plant is a plant selected from the group consisting of: Aloe arborescens and Hypericum perforatum.

(38) If the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a bacterium it is preferred that the bacterium is a bacterium selected from the group consisting of: Streptomyces spp. (preferably Streptomyces coelicolor).

(39) If the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a fungi it is preferred that the fungi is a fungi selected from the group consisting of: Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, and Trichoderma.

(40) A preferred Aspergillus is Aspergillus niger, Aspergillus oryzae or Aspergillus nidulans. The most preferred Aspergillus is Aspergillus nidulans.

(41) As known in the art, a Type I PKS and/or a Type II PKS may be mutated to remove relevant elements (e.g. active sites) to convert it into what the skilled person in the present context would functionally consider being a Type III PKS. A PKS, which by the skilled person is functionally considered being a Type III PKS is herein understood to be a Type III PKS. As discussed above and in working examples herein, the present inventors recombinantly expressed plant (Aloe arborescens and/or Hypericum perforatum) type III polyketide synthases (PKS) octaketide synthases (OKS) in Aspergillus nidulans and identified that the OKS actually worked in the heterologous host, i.e. there were created non-reduced octaketides in vivo in the Aspergillus nidulans cells.

(42) As discussed herein, flavokermesic acid (FK) was also identified in the Aspergillus nidulans cells.

(43) Public available Aloe arborescens OKS sequences are herein shown with following SED ID numbers:

(44) Herein termed AaOKS: SEQ ID NO:6 [Genbank ID number AY567707 (nucleotide seq.) and SEQ ID NO:7: [Genbank ID number AAT48709 (polypeptide seq)];

(45) Herein termed AaOKS2(PKS4): SEQ ID NO:8 [Genbank ID number F3536166] (nucleotide seq.) and SEQ ID NO:9 [Genbank ID number ARC19997] (polypeptide seq);

(46) Herein termed AaOKS3(PKS5): SEQ ID NO:10 [Genbank ID number F3536167] (nucleotide seq.) and SEQ ID NO:11 [Genbank ID number ARC19998] (polypeptide seq);

(47) Herein termed AaPKS2_A207G: SEQ ID NO:12 (nucleotide seq.) and SEQ ID NO:13: (polypeptide seq).

(48) Public available Hypericum perforatum OKS amino acid sequence is herein shown with following SED ID Number:

(49) Herein termed HpPKS2: SEQ ID NO:14 [Genbank ID number HQ529467] (nucleotide seq.) and SEQ ID NO:15: [Genbank ID number AEE69029] (polypeptide seq);

(50) The level of identities (%) between Type III PKSs at amino acid level:

(51) TABLE-US-00001 AaOKS AaPKS2 AaOKS3 HpPKS2 AaPKS2_A207G BAaOKS 96.28% 89.88% 43.07% 91.32% AaOKS2 90.12% 43.81% 91.07% AaOKS3 45.07% 85.93% HpPKS2 43.56% AaPKS2_A207G

(52) It may be preferred that the octaketide synthase (OKS) in step (I) of the first aspect is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:7.

(53) It may be preferred that the octaketide synthase (OKS) in step (I) of the first aspect is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:9.

(54) It may be preferred that the octaketide synthase (OKS) in step (I) of the first aspect is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 405 of SEQ ID NO:11.

(55) It may be preferred that the octaketide synthase (OKS) in step (I) of the first aspect is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:13.

(56) It may be preferred that the octaketide synthase (OKS) in step (I) of the first aspect is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 393 of SEQ ID NO:15.

(57) Step (I)Other Matter

(58) As discussed above, step (I)(i) of the first aspect reads: suitable starter units and extender units with the recombinantly introduced OKS capable of converting the starter and extender units into a non-reduced octaketide under suitable conditions wherein there in vivo is produced the non-reduced octaketide.

(59) As discussed above, suitable starter units and extender units are known in the art.

(60) According to the art, suitable starter units may e.g. be acetyl-CoA or malonyl-CoA and suitable extender units may e.g. malonyl-CoA.

(61) It is routine work for the skilled person to identify suitable growth conditions wherein there in vivo is produced the non-reduced octaketide as known to the skilled person, such suitable growth conditions will generally depend on the specific used recombinant host cell.

(62) A Recombinant Host Cell and OKS of Different Genus

(63) As discussed above, step (I) of the first aspect reads: contacting in vivo in a recombinant host cell comprising a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) and wherein the OKS is of a different genus than the host cell

(64) It is herein most preferred to use a preferred recombinant host cell as discussed herein and a preferred OKS of a different genus as discussed herein.

(65) For instance, a preferred embodiment herein relates to wherein the: recombinant host cell is a host cell selected from the group consisting of: Aspergillus (preferably Aspergillus nidulans) and Nicotiana sp. (preferably Nicotiana benthamiana); and the OKS of a different genus than the host cell is an OKS selected from the group consisting of: OKS from Aloe spp. (preferably Aloe arborescens) and Hypericum spp. (preferably Hypericum perforatum).

(66) Preferably, the octaketide synthase (OKS) from Aloe spp is: an OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:7; or an OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:9; or an OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 405 of SEQ ID NO:11; or an OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:13.

(67) Preferably, the octaketide synthase (OKS) from Hypericum spp. is an OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 393 of SEQ ID NO:15.

(68) Aromatic Aglycon Compound of InterestStep (II) of First Aspect

(69) As discussed above, step (II) of the first aspect reads: converting in vivo within the recombinant host cell the non-reduced octaketide of step (I) into a C.sub.14-C.sub.34 aromatic aglycon compound of interest, wherein the aromatic aglycon compound of interest is not SEK4 and/or SEK4B.

(70) In a preferred embodiment, the aromatic aglycon compound of interest is a C.sub.14-C.sub.18 aromatic aglycon compound of interest.

(71) Preferably the aromatic aglycon compound of interest is at least one compound selected from the group consisting of: anthraquinone compound and anthrone compound.

(72) Within the group above, it is preferred that the aromatic aglycon compound of interest of step (II) is an anthraquinone compound.

(73) According to the art, anthraquinones (also known as anthraquinonoids) are a class of phenolic compounds based on the 9,10-anthraquinone skeleton (see FIG. 4 herein). For example and as understood by the skilled person, flavokermesic acid (FK) and kermesic acid (KA) are examples of anthraquinones.

(74) Anthrones are a class of phenolic compounds based on the anthrone skeleton (see FIG. 4 herein).

(75) In FIG. 4 is shown FK antrone compound structurei.e an example of a herein relevant anthrone compound.

(76) Preferably, the aromatic aglycon compound of interest is a C.sub.16 aromatic aglycon compound of interest.

(77) In a preferred embodiment, the C.sub.16 aromatic aglycon compound of interest is flavokermesic acid (FK) or kermesic acid (KA).

(78) As discussed above, the conversion in step (II) of the non-reduced octaketide into a C.sub.14-C.sub.34 (preferably C.sub.14-C.sub.18) aromatic aglycon compound of interest is generally done by involvement of suitable post-PKS enzymes (e.g. aromatases and/or cyclases) present in vivo in the host cell.

(79) Accordingly, it may be preferred that the conversion in vivo in step (II) of the method of the first aspect of the non-reduced octaketide into a C.sub.14-C.sub.34 aromatic aglycon compound of interest is done via involvement of at least one aromatase/cyclase.

(80) Preferably, it is done via involvement of at least one in trans acting (independent of the PKS enzyme) aromatase/cyclase.

(81) It may be preferred that step (II) of the method of the first aspect is:

(82) (II): converting in vivo within the recombinant host cell the non-reduced octaketide of step (I) into an aromatic aglycon compound of interest, wherein the conversion in vivo of the non-reduced octaketide into an aromatic aglycon compound of interest is done via involvement of at least one in trans acting (independent of the PKS enzyme) aromatase/cyclase and wherein the aromatase/cyclase is from a fungi or a bacteria and heterologous to the recombinant host cell and from a different genus than the PKS.

(83) SEQ ID NO: 17 herein is the public available amino sequence of Streptomyces ZhuI aromatase/cyclase (Genbank accession AAG30197) and SEQ ID NO: 19 herein is the public available amino sequence of Streptomyces ZhuJ aromatase/cyclase (Genbank accession AAG30196) (see e.g. herein discussed article of Tang, Y. et al (2004)).

(84) As discussed below, these aromatases/cyclases were successfully used in working examples herein.

(85) It may be preferred that the aromatase/cyclase is a aromatase/cyclase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 169 of SEQ ID NO:17.

(86) It may be preferred that the aromatase/cyclase is a aromatase/cyclase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 256 of SEQ ID NO:19.

(87) Aromatic Glycoside Compound of InterestStep (III) of First Aspect

(88) As discussed above, optional step (III) of the first aspect reads: the recombinant host cell also comprises a glycosyltransferase gene encoding a glycosyltransferase and the in step (II) produced aromatic aglycon compound of interest is in vivo glycosylated by the glycosyltransferase to produce a C.sub.14-C.sub.34 aromatic glycoside compound of interest.

(89) It may be preferred that this step (III) is fulfilled (i.e. not optional).

(90) In a preferred embodiment, the aromatic glycoside compound of interest is a C.sub.14-C.sub.18 aromatic glycoside compound of interest.

(91) As understood by the skilled person in the present contextpreferred aromatic aglycon compound of interest of step (II) may be converted into corresponding preferred aromatic glycoside compound of interest in step (III).

(92) Preferably the aromatic glycoside compound of interest is at least one compound selected from the group consisting of: anthraquinone compound, anthrone compound.

(93) Within the group above it is preferred that the aromatic glycoside compound of interest of step (III) is an anthraquinone compound.

(94) For example and as understood by the skilled personDcII and carminic acid (CA) are examples of anthraquinones.

(95) Preferably, the aromatic glycoside compound of interest is a C.sub.16 aromatic glycoside compound of interest.

(96) In a preferred embodiment, the C.sub.16 aromatic glycoside compound of interest is a flavokermesic acid glycoside or a kermesic acid glycoside.

(97) In a preferred embodiment, the flavokermesic acid glycoside is DcII.

(98) In a preferred embodiment, the kermesic acid glycoside is carminic acid (CA).

(99) The glycosyltransferase (GT) of step (III) may e.g. be herein described GT from Dactylopius coccus.

(100) Alternatively, it may e.g. be herein discussed glycosyltransferases from Aloe plants, Haworthia plants, Sorghum and/or rice plants.

(101) Preferably, the glycosyltransferase is a glycosyltransferase polypeptide capable of: (I): conjugating nucleotide activated glucose to flavokermesic acid (FK); and/or (II): conjugating nucleotide activated glucose to kermesic acid (KA).

(102) The polynucleotide sequence encoding herein described isolated/cloned novel Dactylopius coccus costa glycosyltransferase is shown in SEQ ID NO: 1 herein and the polypeptide amino acid sequence is shown in SEQ ID NO: 2 herein.

(103) The herein relevant glycosyltransferase enzyme of SEQ ID NO: 2 may herein be termed DcUGT2.

(104) Accordingly, it may be preferred that the glycosyltransferase is a glycosyltransferase polypeptide capable of: (I): conjugating nucleotide activated glucose to flavokermesic acid (FK); and/or (II): conjugating nucleotide activated glucose to kermesic acid (KA);
and wherein the glycosyltransferase polypeptide is at least one polypeptide selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence which has at least 70% identity with amino acids 1 to 515 of SEQ ID NO:2; (b) a polypeptide comprising an amino acid sequence which has at least 70% identity with amino acids 1 to 468 of SEQ ID NO:2; (c) a polypeptide which is encoded by a polynucleotide that hybridizes under at least medium stringency conditions with (i) nucleotides 1 to 1548 of SEQ ID NO:1 or (ii) a complementary strand of (i); and (d) a fragment of amino acids 1 to 515 of SEQ ID NO:2, which has the glycosyltransferase activity as specified in (I) and/or (II).

(105) A preferred embodiment relates to wherein the glycosyltransferase polypeptide of is: (a) a polypeptide comprising an amino acid sequence which has at least 80% identity with amino acids 1 to 515 of SEQ ID NO:2; more preferably (a) a polypeptide comprising an amino acid sequence which has at least 90% identity with amino acids 1 to 515 of SEQ ID NO:2; even more preferably (a) a polypeptide comprising an amino acid sequence which has at least 95% identity with amino acids 1 to 515 of SEQ ID NO:2; and most preferably (a) a polypeptide comprising an amino acid sequence which has at least 98% identity with amino acids 1 to 515 of SEQ ID NO:2.

(106) It may be preferred that the glycosyltransferase polypeptide of the first aspect is a polypeptide comprising an amino acid sequence with amino acids 1 to 515 of SEQ ID NO:2.

(107) As discussed herein, the identified data/results of working Examples 4 show that herein relevant GT enzymes can be identified in e.g. Sorghum and rice plants.

(108) The Sorghum polypeptide sequence (Genbank ID number: AAF17077.1) is shown as SEQ ID NO: 4 herein.

(109) The rice polypeptide sequence (Genbank ID number: CAQ77160.1) is shown as SEQ ID NO: herein.

(110) It may be relevant that the glycosyltransferase is a glycosyltransferase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 492 of SEQ ID NO:4.

(111) It may be relevant that the glycosyltransferase is a glycosyltransferase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 471 of SEQ ID NO:5.

(112) Alternatively, glycosyltransferases may also be a glycosyltransferase from a Haworthia plant.

(113) Isolating the Aromatic Compound of InterestStep (IV)

(114) As discussed above, step (IV) of the first aspect reads: isolating the aromatic aglycon compound of interest of step (II) and/or isolating the aromatic glycoside compound of interest of step (III) to get a composition, wherein the composition comprises less than 1% w/w dry matter of recombinant host cell material.

(115) In the present context, the skilled person routinely know how to isolate a specific herein relevant aromatic compound of interest in relation to step (IV), i.e. it is not believed herein necessary to discuss this in great details.

(116) In a preferred embodiment of the method as described herein is, wherein the isolated composition in step (IV) comprises aromatic glycoside compound of interest and wherein the aromatic glycoside compound of interest is flavokermesic acid glycoside (preferably DcII) and/or a kermesic acid glycoside (preferably carminic acid (CA)).

(117) It may be preferred to have a relative pure composition, accordingly it may be preferred that composition comprising at least 10% w/w dry matter of the aromatic compound of interest and wherein the composition comprises less than 0.5% w/w dry matter of recombinant host cell material; or that composition comprising at least 50% w/w dry matter of the aromatic compound of interest and wherein the composition comprises less than 0.1% w/w dry matter of recombinant host cell material.

(118) If there in step (IV) is obtained a composition comprising isolated aromatic aglycon compound of interest (e.g. flavokermesic acid (FK) or kermesic acid (KA)) the method of the first aspect may comprise an extra step of:

(119) (IVa): glycosylating the aromatic aglycon compound of interest to produce an aromatic glycoside compound of interest.

(120) This step may be done by chemical synthesis according to the art.

(121) Alternatively, it may be done by use of a glycosyltransferase capable of glycosylating the aglycon under suitable conditions wherein there is produced the aglycon glycoside.

(122) An embodiment of the invention relates to wherein the aromatic aglycon compound of interest of the isolated composition of step (IV) is flavokermesic acid (FK) and/or kermesic acid (KA) and the method of the first aspect comprises an extra step of: (IVa) contacting: (a1): flavokermesic acid (FK) with a glycosyltransferase capable of glycosylating the flavokermesic acid under suitable conditions wherein there is produced the flavokermesic acid glycoside; and/or (a2): kermesic acid (KA) with a glycosyltransferase capable of glycosylating the kermesic acid under suitable conditions wherein there is produced the kermesic acid glycoside. In a preferred embodiment, the flavokermesic acid glycoside is DcII.

(123) In a preferred embodiment, the kermesic acid glycoside is carminic acid (CA).

(124) As discussed herein, the glycosyltransferase (GT) of this step may e.g. be the herein described GT from Dactylopius coccus.

(125) Alternatively, it may e.g. be the herein discussed glycosyltransferases from Aloe plants, Haworthia plants, Sorghum and/or rice plants.

Aspects and Preferred Embodimentsin so-Called Claim Format/Language

(126) Herein described aspect(s) and preferred embodiments thereof may be presented in so-called claim format/language. This is done below for some of the herein described aspect(s) and preferred embodiments thereof.

(127) 1. A method for producing an octaketide derived aromatic compound of interest, wherein the method comprises the following steps:

(128) (I): contacting in vivo in a recombinant host cell comprising a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) and wherein the OKS is of a different genus than the host cell: (i): suitable starter unit and extender units with the recombinantly introduced OKS capable of converting the starter and extender units into a non-reduced octaketide under suitable conditions wherein there in vivo is produced the non-reduced octaketide; and

(129) (II): converting in vivo within the recombinant host cell the non-reduced octaketide of step (I) into a C.sub.14-C.sub.34 aromatic aglycon compound of interest, wherein the aromatic aglycon compound of interest is not SEK4 and/or SEK4B; and

(130) (III): optionally, the recombinant host cell also comprises a glycosyltransferase gene encoding a glycosyltransferase and the in step (II) produced aromatic aglycon compound of interest is in vivo glycosylated by the glycosyltransferase to produce a C.sub.14-C.sub.34 aromatic glycoside compound of interest; and

(131) (IV): isolating the aromatic aglycon compound of interest of step (II) and/or isolating the aromatic glycoside compound of interest of step (III) to get a composition, wherein the composition comprises less than 1% w/w dry matter of recombinant host cell material.

(132) 2. The method according to claim 1, wherein the recombinant host cell is a plant cell, a filamentous fungal cell, a yeast cell or a prokaryotic cell.

(133) 3. The method according to claim 2, wherein the recombinant host cell is a plant cell.

(134) 4. The method according to claim 3, wherein the plant cell is a plant cell selected from the group consisting of: Nicotiana sp. (e.g. Nicotiana benthamiana cells); rhubarb, buckweed, Hypericum and Aloe sp.

(135) 5. The method according to claim 4, wherein the plant cell is Nicotiana sp.

(136) 6. The method according to claim 5, wherein the plant cell is Nicotiana benthamiana.

(137) 7. The method according to claim 2, wherein the recombinant host cell is a filamentous fungal cell.

(138) 8. The method according to claim 7, wherein the filamentous fungal cell is Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.

(139) 9. The method according to claim 8, wherein the filamentous fungal cell is an Aspergillus cell.

(140) 10. The method according to claim 9, wherein the Aspergillus cell is Aspergillus niger, Aspergillus oryzae or Aspergillus nidulans.

(141) 11. The method according to claim 10, wherein the Aspergillus cell is Aspergillus nidulans.

(142) 12. The method according to any of the preceding claims, wherein the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a plant, a bacterium or a fungi.

(143) 13. The method of claim 12, wherein the Type III polyketide synthase (PKS) gene of step (I) is a PKS gene from a plant.

(144) 14. The method of claim 13, wherein the plant is a plant selected from the group consisting of: Aloe spp. (preferably Aloe arborescens), Hypericum spp. (preferably Hypericum perforatum), rhubarb, buckweed and Hawortia spp.

(145) 15. The method of claim 14, wherein the plant is a plant selected from the group consisting of: Aloe spp. and Hypericum spp.

(146) 16. The method of claim 15, wherein the plant is a plant selected from the group consisting of: Aloe arborescens and Hypericum perforatum.

(147) 17. The method of claim 13, wherein the octaketide synthase (OKS) in step (I) of claim 1 is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:7.

(148) 18. The method of claim 13, wherein the octaketide synthase (OKS) in step (I) of claim 1 is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:9.

(149) 19. The method of claim 13, wherein the octaketide synthase (OKS) in step (I) of claim 1 is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 405 of SEQ ID NO:11.

(150) 20. The method of claim 13, wherein the octaketide synthase (OKS) in step (I) of claim 1 is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 403 of SEQ ID NO:13.

(151) 21. The method of claim 13, wherein the octaketide synthase (OKS) in step (I) of claim 1 is a OKS comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 393 of SEQ ID NO:15.

(152) 22. The method according to any of the preceding claims, wherein the suitable starter unit is acetyl-CoA and/or malonyl-CoA.

(153) 23. The method according to any of the preceding claims, wherein the suitable extender units is malonyl-CoA.

(154) 24. The method according to any of the preceding claims, wherein the: recombinant host cell is a host cell selected from the group consisting of: Aspergillus (preferably Aspergillus nidulans) and Nicotiana sp. (preferably Nicotiana benthamiana); and the OKS of a different genus than the host cell is an OKS selected from the group consisting of: OKS from Aloe spp. (preferably Aloe arborescens) and Hypericum spp. (preferably Hypericum perforatum).

(155) 25. The method according to any of the preceding claims, wherein the aromatic aglycon compound of interest is a C.sub.14-C.sub.18 aromatic aglycon compound of interest.

(156) 26. The method according to claim 25, wherein the aromatic aglycon compound of interest is at least one compound selected from the group consisting of: anthraquinone compound and anthrone compound.

(157) 27. The method of claim 26, wherein the aromatic aglycon compound of interest is an anthraquinone and the anthraquinone is flavokermesic acid (FK) or kermesic acid (KA).

(158) 28. The method according to claim 25, wherein the aromatic aglycon compound of interest is a C.sub.16 aromatic aglycon compound of interest.

(159) 29. The method according to claim 28, wherein the C.sub.16 aromatic aglycon compound of interest is flavokermesic acid (FK) or kermesic acid (KA).

(160) 30. The method according to any of the preceding claims, wherein the conversion in vivo in step (II) of claim 1 of the non-reduced octaketide into a C.sub.14-C.sub.34 aromatic aglycon compound of interest is done via involvement of at least one aromatase/cyclase.

(161) 31. The method according to claim 30, wherein the conversion in vivo in step (II) of claim 1 of the non-reduced octaketide into a C.sub.14-C.sub.34 aromatic aglycon compound of interest is done via involvement of at least one in trans acting (independent of the PKS enzyme) aromatase/cyclase.

(162) 32. The method of claim 31,

(163) wherein the aromatase/cyclase is a aromatase/cyclase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 169 of SEQ ID NO:17 (Streptomyces ZhuI); and/or

(164) wherein the aromatase/cyclase is a aromatase/cyclase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 256 of SEQ ID NO:19 (Streptomyces ZhuJ).

(165) 33. The method according to any of the preceding claims, wherein step (III) is fulfilled (i.e. not optional)i.e. wherein step (III) is: the recombinant host cell also comprises a glycosyltransferase gene encoding a glycosyltransferase and the in step (II) produced aromatic aglycon compound of interest is in vivo glycosylated by the glycosyltransferase to produce a C.sub.14-C.sub.34 aromatic glycoside compound of interest.

(166) 34. The method of claim 33, wherein the aromatic glycoside compound of interest is a C.sub.14-C.sub.18 aromatic glycoside compound of interest.

(167) 35. The method of claim 34, wherein the aromatic glycoside compound of interest is a C.sub.16 aromatic glycoside compound of interest.

(168) 36. The method of claim 35, wherein the C.sub.16 aromatic glycoside compound of interest is a flavokermesic acid glycoside or a kermesic acid glycoside.

(169) 37. The method of claim 36, wherein the C.sub.16 aromatic glycoside compound of interest is a flavokermesic acid glycoside and the flavokermesic acid glycoside is DcII.

(170) 38. The method of claim 36, wherein the C.sub.16 aromatic glycoside compound of interest is a kermesic acid glycoside and the kermesic acid glycoside is carminic acid (CA).

(171) 39. The method according to any of the claims 33 to 38, wherein the glycosyltransferase

(172) (GT) of step (III) is a GT from Dactylopius coccus, a GT from Aloe plants, a GT from Haworthia plants, a GT from Sorghum or a GT from rice plant.

(173) 40. The method of claim 36, wherein the glycosyltransferase (GT) is a glycosyltransferase polypeptide capable of: (I): conjugating nucleotide activated glucose to flavokermesic acid (FK); and/or (II): conjugating nucleotide activated glucose to kermesic acid (KA).

(174) 41. The method according to any of the claims 33 to 40, wherein the glycosyltransferase is a glycosyltransferase polypeptide capable of: (I): conjugating nucleotide activated glucose to flavokermesic acid (FK); and/or (II): conjugating nucleotide activated glucose to kermesic acid (KA);

(175) and wherein the glycosyltransferase polypeptide is at least one polypeptide selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence which has at least 70% identity with amino acids 1 to 515 of SEQ ID NO:2; (b) a polypeptide comprising an amino acid sequence which has at least 70% identity with amino acids 1 to 468 of SEQ ID NO:2; (c) a polypeptide which is encoded by a polynucleotide that hybridizes under at least medium stringency conditions with (i) nucleotides 1 to 1548 of SEQ ID NO:1 or (ii) a complementary strand of (i); and (d) a fragment of amino acids 1 to 515 of SEQ ID NO:2, which has the glycosyltransferase activity as specified in (I) and/or (II).

(176) 42. The method according to any of the claims 33 to 40, wherein the glycosyltransferase is a glycosyltransferase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 492 of SEQ ID NO:4.

(177) 43. The method according to any of the claims 33 to 40, wherein the glycosyltransferase is a glycosyltransferase comprising an amino acid sequence which has at least 70% (preferably at least 80%, more preferably at least 90% and even more preferably at least 98%) identity with amino acids 1 to 471 of SEQ ID NO:5.

(178) 44. The method according to any of the claims 33 to 43, wherein the isolated composition in step (IV) comprises aromatic glycoside compound of interest and wherein the aromatic glycoside compound of interest is flavokermesic acid glycoside (preferably DcII) and/or a kermesic acid glycoside (preferably carminic acid (CA)).

(179) 45. The method according to claim 44, wherein the aromatic glycoside compound of interest is flavokermesic acid glycoside and the flavokermesic acid glycoside is DcII.

(180) 46. The method according to claim 44, wherein the aromatic glycoside compound of interest is kermesic acid glycoside and the kermesic acid glycoside is carminic acid (CA).

(181) 47. The method according to any of the preceding claims, wherein the isolated composition in step (IV) of claim 1 is comprising at least 10% w/w dry matter of the aromatic compound of interest and wherein the composition comprises less than 0.5% w/w dry matter of recombinant host cell material.

(182) 48. The method according to any of the preceding claims, wherein there in step (IV) is obtained a composition comprising isolated aromatic aglycon compound of interest (e.g. flavokermesic acid (FK) or kermesic acid (KA)) and the method then comprise an extra step of:

(183) (IVa): glycosylating the aromatic aglycon compound of interest to produce an aromatic glycoside compound of interest.

(184) 49. The method of claim 48, wherein the glycosylating the aromatic aglycon compound of interest is done by use of a glycosyltransferase capable of glycosylating the aglycon under suitable conditions wherein there is produced the aglycon glycoside.

(185) 50. The method of claim 49, wherein the aromatic aglycon compound of interest of the isolated composition of step (IV) is flavokermesic acid (FK) and/or kermesic acid (KA) and the method of the first aspect comprises an extra step of:

(186) (IVa): contacting: (a1): flavokermesic acid (FK) with a glycosyltransferase capable of glycosylating the flavokermesic acid under suitable conditions wherein there is produced the flavokermesic acid glycoside; and/or (a2): kermesic acid (KA) with a glycosyltransferase capable of glycosylating the kermesic acid under suitable conditions wherein there is produced the kermesic acid glycoside.

(187) 51. The method of any of claims 48 to 50, wherein the flavokermesic acid glycoside is DcII.

(188) 52. The method of any of claims 48 to 50, wherein the kermesic acid glycoside is carminic acid (CA).

(189) 53. The method of any of the preceding claims, wherein the recombinant host cell in claim 1 is a growing recombinant host cell and step (I) and step (II) of claim 1 are:

(190) (I): contacting in vivo in a growing recombinant host cell comprising a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) and wherein the OKS is of a different genus than the host cell: (i): suitable starter unit and extender units with the recombinantly introduced OKS capable of converting the starter and extender units into a non-reduced octaketide under suitable growth conditions wherein there in vivo is produced the non-reduced octaketide; and

(191) (II): converting in vivo within the growing recombinant host cell the non-reduced octaketide of step (I) into a C.sub.14-C.sub.34 aromatic aglycon compound of interest, wherein the aromatic aglycon compound of interest is not SEK4 and/or SEK4B.

EXAMPLES

(192) Relevant sequence information can be found in herein provided Sequence Listing document

Example 1Cloning of D. Coccus GT and Test of its FK and KA Activity

(193) Materials and Methods

(194) Purification of DNA and mRNA

(195) Fresh frozen Dactylopius coccus (were obtained from Lanzarote). Fresh frozen Porphyrophora polonica were obtained from Poland. The frozen insects were ground into powder under liquid nitrogen and DNA/RNA was purified: DNA was purified using DNeasy Blood & Tissue kit (Qiagen), according to the protocol of the supplier. RNA was purified using RNeasy mini kit (Qiagen) according to the protocol of the supplier. Eucaryote mRNA was made into cDNA using RT.sup.2 Easy First Strand Kit (Qiagen) according to the protocol of the supplier using poly-dT priming of the revers transcriptase reaction.

(196) Sequencing of DNA and RNA:

(197) DNA and cDNA were sent for sequencing at BGI (Shenzen, China) for sequencing using 100 bp paired-end Illumina technology according to the protocol of Illumina at a coverage of approximately 60-100 and the output in fastq data format.

(198) Analysis of DNA and RNA/cDNA Sequences:

(199) The obtained fastq-sequences of DNA and RNA/cDNA were imported into Genomic Workbench version 5.4 (CLC-bio, Arhus, Denmark) and assembled using the de novo assembling algorithm into contigs. Output files were exported as FASTA format. RNA/cDNA FASTA files were then imported into IOGMA v. 10 (Genostar, Grenoble, France) and putitative genes were identified using the hidden Markov-Matrix-based prokaryote gene-finder.

(200) Putative genes were annotated using BLAST (basic local alignment sequence tool) against genbank (NCBI) using as well the nucleotide sequence as the translated protein sequence. The putative genes were also annotated by similarity comparison to PFAM databases of protein families.

(201) Preparation of Protein Fractions from D. Coccus

(202) Three grams of fresh D. coccus insects were homogenized in 120 mL of isolation buffer [350 mM sucrose, 20 mM Tricine (pH 7.9), 10 mM NaCl, 5 mM DTT, 1 mM PMSF) containing 0.3 g polyvinylpolypyrrolidone. The homogenate was filtered through a nylon cloth (22 m mesh) and centrifuged for (10 min, 10,000g at 4 C.). The supernatant was centrifuged (1 h, 105,000g, at 4 C.), yielding a soluble and a membrane bound protein fraction. The soluble protein fraction was concentrated to 1 mL and buffer-exchanged with 20 mM Tricine (pH 7.9), 5 mM DTT by using Amicon ultrafugation-3K devices (Millipore). The membrane bound protein pellet was washed 3 times by resuspending the pellet in 60 mL of 20 mM Tricine (pH 7.9), 5 mM DTT using a marten paintbrush followed by re-centrifugation. The membrane bound protein pellet was finally resuspended in 1 mL 20 mM Tricine (pH 7.9), 5 mM DTT. The soluble protein fraction and the membrane bound protein fraction were analyzed for glycosylation activity.

(203) Purification of a Flavokermesic Acid/Kermesic Acid-Specific GT Activity from D. Coccus Membrane Proteins

(204) A membrane bound protein fraction isolated from 3 g fresh D. coccus insects was solubilized by adding 1% (v/v) Triton x-100 (reduced form) and gently stirring for 1.5 h in the cold. The Triton x-100 treated solution was centrifuged (1 h, 105,000g, at 4 C.) and the supernatant was isolated and applied to a column packed with 2 mL Q-sepharose Fast flow (Pharmacia). The column was washed in 4 mL of buffer A [20 mM Tricine (pH 7.9), 0.1% (v/v) Triton x-100 (reduced form), 50 mM NaCl] and proteins were eluted with 20 mM Tricine (pH 7.9), 0.1% (v/v) Triton x-100 (reduced form) using a discontinuous NaCl gradient from 100 mM-500 mM, (with 50 mM increments). 0.5-ml-fractions were collected, desalted, analyzed by SDS-PAGE and monitored for glucosylation activity using the described radiolabeled glucosylation enzyme assay. A fraction containing enriched flavokermesic acid/kermesic acid-specific GT activity was subjected to peptide mass fingerprinting analysis.

(205) Enzyme Assays and Glucoside Product Detection

(206) Glucosylation of flavokermesic acid and kermesic acid was performed in assay mixtures of 60 L containing 20 mM Tricine (pH 7.9), 3.3 m UDP[14C]glucose and 20 uL protein extract (membrane bound or soluble protein). Reactions were incubated for 0.5 h at 30 C. and terminated by adding 180 L of methanol. Samples were centrifuged at 16,000g for 5 min at 4 C. and supernatant was spotted on TLC plates (silica gel 60 F254 plates; Merck). Assay products were resolved in dichloromethane:methanol:formic acid (7:2:2, by volume). Radiolabeled products were visualized using a STORM 840 PhosphorImager (Molecular Dynamics).

(207) Expression of Codon Optimized DcUGT2, DcUGT4 and DcUGT5 in S. cerevisiae

(208) A synthetic codon optimized version of DcUGT2 and two other putative GT sequences from the Dactylopius coccus transcriptome termed DcUGT4 and DcUGT5 for yeast expression was purchased from GenScript with flanking gateway recombination attL sites. The synthetic fragments were used as PCR templates with specific primers to generate the corresponding C-terminal Strepli-tagged versions. The six gene constructs (tagged and non-tagged fragments) were cloned into the gateway destination plasmid pYES-DEST52 (Invitrogen) using LR clonasell enzyme mix. The six pYES-DEST52 plasmid constructs were transformed separately into the Invscl yeast strain (Invitrogen) and positive transformants were verified by PCR. Heterologous protein production was performed according to the instructions of the pYES-DEST52 gateway vector (Invitrogen). Production of heterologous Strepli-tagged protein was verified by western blotting using anti-Strep antibody. A membrane bound protein fraction was prepared from verified yeast transformants as described in (D. Pompon, B. Louerat, A. Bronine, P. Urban, Yeast expression of animal and plant P450s in optimized redox environments, Methods Enzymol. 272 (1996) 51-64) and screened for glucosylation activity towards flavokermesic acid/kermesic acid. The yeast optimized sequence is shown in SEQ ID NO: 3 herein.

(209) LC-MS-MS

(210) LC/MS was performed on an Agilent Q-TOF with the following HPLC system:

(211) Column Kinetix 2.6p XB-C18 100A (1004.60 mm, Phenomenex). Solvent A (900 ml deionized water, 100 ml methanol and 50 ml formic acid). Solvent B (700 ml methanol, 300 ml deionized water and 50 ml formic acid).

(212) Flow 0.8 ml/min. 35 C.

(213) Gradient elution. 0-1 min 100% A. Linear gradient to 83% A 3 min. linear gradient to 63% A 6 min, linear gradient to 45% A 9 min, linear gradient to 27% A 12 min, linear gradient to 10% A 15 min, linear gradient to 3% A 17 min, linear gradient to 2% A 19 min, linear gradient to 0% A 20 min, 0% A 22 min, linear gradient to 100% A 25 min. Retention times were 7.6 min for carminic acid, 7.8 min for DC II, 13.7 min for flavokermesic acid and 13.9 min for kermesic acid.

(214) Results:

(215) The ability to glycosylate flavokermesic acid/kermesic acid using C.sub.14-UDP-glucose as a substrate was detected in homogenized D. coccus insects. The activity was shown to be membrane bound and the activity was purified and the purified proteins were submitted to proteomics analysis. It was shown that the enzymatic activity was to come from a polypeptide with a sequence corresponding to our candidate gene DcUGT2.

(216) As discussed above, the herein relevant glycosyltransferase enzyme of SEQ ID NO: 2 may herein be termed DcUGT2.

(217) The amino acid sequence of DcUGT2 shows less than 45% homology to any known glycosyl transferase.

(218) Knowing that cloning the wildtype sequence into yeast had given no relevant enzyme activity, we redesigned the nucleotide sequence of DcUGT2 to a sequence coding for the same polypeptide but using nucleotide codons optimized for S. cerevisiae, a process called codon optimization (the S. cerevisiae optimized sequence is shown as SEQ ID No. 3 herein). Subsequently, the codon optimized sequence of DcUGT2 was cloned and expressed in yeast. The heterologous yeast strain contains a membrane bound enzyme activity capable of glucosylating kermesic acid and flavokermesic acid.

(219) After obtaining peptide mass fingerprinting data from a Dactylopius coccus protein fraction enriched with GT activity towards flavokermesic acid/kermesic acid, we matched the peptide masses to the transcriptomic dataset and identified three putative UGTs (DcUGT2, DcUGT4 and DcUGT5).

(220) Heterologous expression of the three candidates in yeast revealed that only one of these UGTs, namely DcUGT2 was responsible for the observed glucosylation activity towards flavokermesic acid/kermesic acid in the D. coccus protein fraction.

(221) A viscozyme treatment of the generated C-14 radiolabelled glucoside, showed that it was resistant towards hydrolysis, further suggesting that the DcUGT2 is a C-GT, responsible for producing DCII and carminic acid.

(222) A LC-MS-MS showed formation of products with the same retention time, spectrum, molecular mass and molecular degradation pattern as DcII and carminic acid respectively.

CONCLUSION

(223) The result of this Example 1 demonstrated that it was not an easy task to isolate/clone the herein relevant glycosyltransferase enzyme of SEQ ID NO: 2, which may herein be termed DcUGT2 or simply DcUGT.

(224) For instance, the identified gene sequences of the genome and transcriptome of D. coccus insects were analyzed for similarity to herein relevant public known C-glycosyltransferase sequences and the result was negative in the sense that none of the identified gene sequences of the genome/transcriptome showed herein significant similarity to publicly known herein relevant C-glycosyltransferase sequences.

(225) However, even though the bioinformatic sequence similarity analysis could be said to indicate that the genome of Dactylopius coccus would not comprise a gene encoding a herein relevant glycosyltransferasethe present inventors continued to investigate the matter and the present inventors identified a Dactylopius coccus extract (including extracts of the endosymbionts present in D. coccus) with herein relevant GT activity and by a combination of herein relevant purification and testing steps the inventors were finally able to get a relatively pure fraction/composition wherefrom it was possible to obtain several partial amino acid sequences of possible GT enzyme candidates.

(226) The present inventors tested the activity of the herein described isolated/cloned novel glycosyltransferase of SEQ ID NO: 2 (DcUGT2) and found that it was able to conjugate glucose to the aglycons flavokermesic acid (FK) and kermesic acid (KA)see FIG. 1 herein.

Example 2 Testing KA GT Activity of Prior Art Known UrdGT2

(227) As discussed above, the UrdGT2 is described in the article Baig et al (Angew Chem Int Ed Engl. 2006 Nov. 27; 45(46):7842-6).

(228) As discussed above, this article describes that UrdGT2 is capable of glycosylating different aglycon molecules that may be considered structurally similar to the herein relevant Kermesic acid (KA) and Flavokermesic acid (FK) aglycons.

(229) A codon optimized synthetic version of UrdGT2 for E. coli expression was cloned and recombinantly expressed in E. coli. A crude soluble protein extract containing the the recombinant UrdGT2 was obtained, i.e. an extract comprising the UrdGT2

(230) The UrdGT2 GT activity was analyzed in vitro using either UDP-glucose or TDP-glucose as a sugar donor and FA/KA as aglycone substrates. No activity was detected towards these aglycons, i.e. no herein relevant GT activity was identified in relation to these aglycons.

(231) However, it was confirmed that the recombinant UrdGT2 was active, as demonstrated by the in vitro formation of a C14-radiolabelled glucoside derived from the glucosylation of an unidentified compound in the crude E. coli extract.

Example 3 GT Activity in Aloe Plant and Haworthia Plant

(232) Isolation and Test of GT Activity from Aloe 1) The plant was washed from soil particles and separated into: A) Root, B) Green leaf tissue and C) the gel material from the leaf 2) 5 g of tissue was frozen immediately in liquid nitrogen and ground in a cold mortar with a pestle to a fine powder. 3) 20 mL of cold extraction buffer [20 mM Tricine-HCl, 10 mM NaCl, 5 mM DTT, 1 mM PMSF, pH 7.9] containing a Complete protease inhibitor without EDTA (Roche), 0.1% (w/v) proteamine sulfate and 0.5 g of PVPP were added to the powder and vortexed. 4) The homogenate was gently stirred at 4 C. for 10 min and then centrifuged at 12,000g at 4 C. for 5 min. 5) Supernatant was isolated and 1 mL of 2% (w/v) proteamine sulfate in 20 mM Tricine-HCl, pH 7.9 was added dropwise over 2 min at 4 C. under constant stirring. 6) The supernatant was filtered through 2 pieces of nylon mesh. The filtered supernatant was then centrifuged at at 12,000g at 4 C. for 5 min. 7) The supernatant was isolated and ultracentrifuged at 110,000g at 4 C. for 1 h. 8) The soluble protein fraction (supernatant) was isolated and buffer-exchanged 5 times with 20 mM Tricine-HCl, pH 7.9 containing 5 mM DTT using a Amicon Ultra centrifugal filter device-3K (Millipore) 9) 20 L soluble protein extract was incubated in a total reaction volume of 60 L containing UDP-glucose (1.25 mM final conc.) and either FK (50 M final conc.), KA (50 M final conc) or MeO-FK/EtO-FK (50 M/50 M final conc) for 2 h at 30 C., shaking at 650 rpm. 10) Enzyme reactions were terminated with 180 L cold methanol and filtered through a 0.45 micron filter and subjected to HPLC-MS analysis.

(233) TABLE-US-00002 TABLE 1 Glucosides formed in in vitro glucosylation assays using enzyme extracts from Aloe. Aloe m/z [M H].sup. values Soluble 475 m/z [M H].sup. 491 m/z [M H].sup. 489 m/z [M H].sup. 503 m/z [M H].sup. protein FK-monoglc KA-monoglc MeOFK-monoglc EtOFK-monoglc Leaf 3.73 3.71 5.81 6.63 Gel Root 3.71

(234) Crude soluble enzyme extracts of three Aloe tissues, green leaf material (Leaf), gel material from the leaf (Gel) and Root were tested for glucosylation activity towards flavokermesic acid (FK), kermesic acid (KA), methyl ester of flavokermesic acid (MeOFK) and ethyl ester of flavokermesic acid (EtOFK). Numbers correspond to retention times (min) after HPLC-MS separation of the novel glucosides formed in vitro (Table 1).

(235) The m/z values 475 and 491 are the same m/z values as are obtained for DcII and CA, respectively, solubilized in similar solutions. Both m/z values are 162 (m/z value of glucose in a glucoside) higher than the m/z values of the FK and KA indicating that the glucose moiety from UDP-glucose in the reaction buffer has been transferred to the aglycone by a GT in the extract. The m/z [M-H] values 489 and 503 are also 162 higher than the m/z values obtained with MeOFK and EtOFK, respectively, indicating that a glucose unit has been added to both MeOFK and EtOFK by a GT present in the extract.

(236) Isolation and Test of GT Activity from Haworthia limifolia

(237) The procedure was as described for Aloe but plant tissue analyzed were following: A) Green leaf tissue, B) Gel material from the leaf, C) Base tissue (pink part between root and stem) and D) Root tissue.

(238) Crude soluble enzyme extracts of four Haworthia limifolia tissues, green leaf material (Leaf), gel material from the leaf (Gel), pink tissue between root and stem (Base) and Root were tested for glucosylation activity towards flavokermesic acid (FK), kermesic acid (KA), methyl ester of flavokermesic acid (MeOFK) and ethyl ester of flavokermesic acid (EtOFK). Numbers correspond to retention times (min) after HPLC-MS separation of the novel glucosides formed in vitro (Table 2).

(239) TABLE-US-00003 TABLE 2 Glucosides formed in in vitro glucosylation assays using enzyme extracts from Haworthia limifolia. Haworthia m/z [M H].sup. values Soluble 475 m/z [M H].sup. 491 m/z [M H].sup. 489 m/z [M H].sup. 503 m/z [M H].sup. protein FK-monoglc KA-monoglc MeOFK-monoglc EtOFK-monoglc Leaf 3.73 3.71 5.81 6.63 Gel Base 3.73 3.71 5.81 6.63 Root 3.73 3.71 5.81 6.63

(240) The m/z values 475 and 491 are the same m/z values as are obtained for DcII and CA, respectively, solubilized in similar solutions. Both m/z values are 162 (m/z value of glucose in a glucoside) higher than the m/z values of the FK and KA indicating that the glucose moiety from UDP-glucose in the reaction buffer has been transferred to the aglycone by a GT in the extract. The m/z [M-H] values 489 and 503 are also 162 higher than the m/z values obtained with MeOFK and EtOFK, respectively, indicating that a glucose unit has been added to both MeOFK and EtOFK by a GT present in the extract.

CONCLUSION

(241) The results of this example demonstrate that herein relevant glycosyltransferase (GT) enzymes can be identified in Aloe plants and Haworthia plants.

(242) Said in other words, Aloe plants and Haworthia plants comprise a glycosyltransferase which is capable of glycosylating flavokermesic acid in order to produce flavokermesic acid glycoside; and/or capable of glycosylating kermesic acid in order to produce kermesic acid glycoside.

Example 4 GT Activity in Sorghum and Rice Plant

(243) As known the art, Sorghum and rice plants comprise glycosyltransferases.

(244) As known in the art, some of the Sorghum and rice glycosyltransferases may glycosylate low molecular weight aglycone compounds.

(245) The in the art described glycosyltransferases from Sorghum and rice plants have significant less than 70% identity with amino acids 1 to 515 of SEQ ID NO:2 as disclosed herein.

(246) It is not known in the art if glycosyltransferases of Sorghum and/or rice plants would be a herein relevant glycosyltransferase, i.e. a glycosyltransferase which is capable of glycosylating flavokermesic acid in order to produce flavokermesic acid glycosides; and/or capable of glycosylating kermesic acid in order to produce kermesic acid glycosides.

(247) The known glycosyltransferases from Sorghum (Sorghum bicolor), SbUGT85B1, with Genbank ID number AF199453.1 (nucleotide seq.)/AAF17077.1 (polypeptide seq) and rice (Oryza sativa), OsCGT, with Genbank ID number FM179712.1 (nucleotide seq.)/CAQ77160.1 (polypeptide seq) were expressed in E. coli strain Xjb and crude E. coli proteins extracts were prepared and tested for glucosylation activity on the substrates kermesic acid and flavokermisic acid as described by Kannangara et al. (2011) and Augustin et al. (2012).

(248) FIG. 2 in PCT/EP2014/078540 (PCT filing date 18 Dec. 2014) shows in LC-MS analyses of glucosylated products formed in assays containing crude lysate of E. coli strain Xjb expressing either SbUGT85B1 or OsCGT, UDP-glucose and flavokermesicc acid (FK) or kermesic acid (KA). As a negative control crude extract from the E. coli strain Xjb was used in the assays.

(249) There were identified KA glycosides (491 m/z [M-H]the m/z[M-H] value of CA) for both glycosyltransferases and FK glycosides (475 m/z [M-H] the m/z[M-H] value of DcII) for OsCGT.

CONCLUSION

(250) The result of this example demonstrated that herein relevant glycosyltransferase (GT) enzymes can be identified in Sorghum and/or rice plants.

(251) Said in other words, Sorghum and/or rice plants comprise a glycosyltransferase which is capable of glycosylating flavokermesic acid in order to produce flavokermesic acid glycoside; and/or capable of glycosylating kermesic acid in order to produce kermesic acid glycoside.

Example 5 Use of Endogenous GT Gene or GT Activity

(252) As known in the art glycosyltransferases able to glycosylate low molecular weight are present in a lot of different organisms. A method to contact the glycosyltransferase of the cells of an organism with a low molecular weight compound is to introduce one or more genes directing the biosynthesis of the low molecular weight compound and thus enabling the cells to glycosylate the low molecular weight compound. The low molecular weight compound may be e.g. flavokermesic acid or kermersic acid or decorated versions of these molecules.

(253) One or more genes directing the biosynthesis of flavokermesic acid or kermesic acid or decorated version of these molecules are introduced into a glycosyltransferase containing organism, e.g. the tobacco plant, Nicotiana benthamiana.

(254) When the gene/genes is/are transiently expressed according to the methods described in (D'Aoust et al. (Methods Mol Biol 483 (2009): 41-50) in e.g. plant tissue the low molecular weight compound or compounds is/are produced. Cells stably expressing the gene/genes are produced and selected according to the methods described in Gelvin (Microbiol Mol Biol Rev 67(1) (2003): 16-37)).

(255) In cells containing either stably expressed and/or transiently expressed gene/genes the low molecular weight compounds come into contact with the endogenous glycosyltransferases, resulting in the formation of one or more glycosides of flavokermesic acid, kermesic acid or decorated versions of these molecules.

(256) The presence of the glycosides is demonstrated by the extraction and the analytical methods described in Example 3.

(257) Samples are prepared for LC/MS by the method for extraction described by (Rauwald and Sigler (Phytochemical Analysis 5 (1994):266-270).

CONCLUSION

(258) The results of this example demonstrate that endogenous glycosyltransferases present in the cells of a recombinant organism can be used to convert flavokermesic acid, kermesic acid or decorated versions of these molecules into glycosides when a gene/genes directing the biosynthesis of the aglycons are introduced into the organism.

(259) Said in other words introduction of a gene or genes directing the biosynthesis of flavokermesic acid, kermesic acid, decorated versions of these molecules, or related low molecular weight compounds is a method to bring the low molecular weight compound in contact with glycosyltransferases and thus a method to produced glycosides of flavokermesic acid, kermesic acid or decorated version of these compounds.

Example 6: Stable Expression of Type III PKSs in Aspergillus nidulans

(260) Materials and Methods

(261) Media and Solutions

(262) All solutions were prepared with Milli-Q H.sub.2O and sterilized at 121 C. for 20 min.

(263) Trace Element Solution: For 1 L mix 0.4 g CuSO.sub.4.5H.sub.2O; 0.04 g Na.sub.2B.sub.4O.sub.7.10H.sub.2O; 0.8 g FeSO.sub.4.7H.sub.2O; 0.8 g MnSO.sub.4.2H.sub.2O; 0.8 g Na.sub.2MoO.sub.4.2H.sub.2O; and 8.0 g ZnSO.sub.4.7H.sub.2O.

(264) Mineral Mix (50): For 1 L solution mix 26 g KCl; 26 g MgSO.sub.4.7H.sub.2O; and 76 g KH.sub.2PO.sub.4; and 50 ml Trace element solution.

(265) 20 Nitrate Salts Solution: For 1 L solution: dissolve 120 g NaNO.sub.3, 10.4 g KCl, 10.4 g MgSO.sub.4.H.sub.2O, 30.4 g KH.sub.2PO.sub.4 in Milli-Q water.

(266) Trace element solution (1 L stock solution): For 1 L solution: dissolve 0.4 g CuSO.sub.4. 5H.sub.2O, 0.04 g Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 0.8 g FeSO.sub.4.7H.sub.2O, 0.8 g MnSO.sub.4.2H.sub.2O, 0.8 g Na.sub.2MoO.sub.4. 2H.sub.2O, 8 g ZnSO.sub.4.7H.sub.2O, up to 1 L Milli-Q water.

(267) Thiamine 1%: Final concentration 0.001%.

(268) D-Glucose 20% (w/Vol): For 1 L solution 200 g D-glucose in Milli-Q water

(269) Aspergillus Protoplastation Buffer (APB): Final concentration 1.1 M MgSO.sub.4 and 10 mM Na-phosphate buffer. pH is adjusted with 2 N NaOH to 5.8.

(270) Aspergillus Transformation Buffer (ATB): Final concentrations: 1.2 M Sorbitol; 50 mM CaCl.sub.2.2H.sub.2O; 20 mM Tris; and 0.6 M KCl. pH is adjusted with 2 N HCl to 7.2.

(271) PCT: Final concentration: 50% w/vol PEG 8000 (4000, 6000 and other PEG can also be used); 50 mM CaCl.sub.2); 20 mM Tris; and 0.6 M KCl. pH is adjusted with 2 N HCl to 7.5.

(272) Minimal Media (MM): For 1 L of solution: 1 ml Trace elements; 50 ml nitrate salts (1M); 50 ml 20%-w/vol glucose; 1 mL Thiamine; 20 g Agar (So.Bi gel). For liquid MM Agar is not added.

(273) Supplements to the Media: Supplements were added to the different media if necessary, based on the genotype of the Aspergillus nidulans strain, in the following amounts: Arginine 4 mM, uracile 10 mM and uridine 10 mM. For counter selection of the AfpyrG marker 5-fluororotic acid (5-FOA) is added to a concentration of 1.3 mg/mL.

(274) Solid Transformation Media (TM): For 1 L of solution: 1 ml Trace elements; 50 ml nitrate salts (1M); Sucrose 171.15 g; 1 mL Thiamine; 20 g Agar (So.Bi gel). For liquid MM Agar is not added.

(275) Transformation of Aspergillus nidulans

(276) Aspergillus nidulans protoplasts were generated following a standard protocol of the prior art, shortly summarized here: Aspergillus nidulans macromedia are geminated overnight, and the resulting biomass was harvested by filtering through a Miracloth filter (Merck Millipore). The mycelium was re-suspended in 10 ml APB buffer containing 40 mg Glucanex/ml (Novozymes A/S). The mixture was incubated on a shaker at 37 C. with 150 rpm for 3 hours. APB was added to yield a total volume of 40 ml. An overlay of 5 ml 50% ATB and 50% MQ-water was applied and the tubes were centrifuged at 3000 RCF, 16 C., for 12 minutes resulting in a two-phase system with the protoplast in the interphase. The protoplasts were washed using 40 ml of ATB and centrifugation at 3000 RCF, 16 C., for 12 minutes. The resulting pellet was re-suspended in 1 ml ATB.

(277) The resulting protoplasts were used for genetic transformation experiments in aliquots of 50 l mixed with 1.5-5 g DNA and 150 L PCT. The transformation mixture was incubated for 10 minutes. The mixture was then added 250 L ATB and transferred to a transformation plate with required supplements dispatched with a Drigalski spatula.

(278) Following incubation for 4 days at 37 C., the resulting Aspergillus nidulans transformants were isolated and sub-cultured on individual agar plates with a suitable selection regime. Targeted integration of the expression cassette was analyzed by PCR using the original primers used for amplifying the gene to be expressed, followed by primer pairs with one primer annealing inside the insert and one in the surrounding genome. In the case of AfpyrG based strains, the selection marker was eliminated, following the transformation, by counter selection on 5-FOA containing plates and homologous recombination between short directional repeats surrounding the AfpyrG marker gene in the expression cassette. Following removal of the marker gene, the strain was again verified by diagnostic PCR. Removal of the selection marker gene allowed for a subsequent transformation round with a new target gene, using the same selection marker gene as used during the first transformation.

(279) Construction of the Aspergillus nidulans Host Strains

(280) The used Aspergillus nidulans strains are listed in Table 3 below and Table 4 summarizes the modified loci/genes. Targeted gene deletion (or replacement) was achieved by constructing gene targeting cassettes, consisting of a recyclable selection marker gene surrounded by two ap. 1500 bp sequences identical to the sequences surrounding the locus that should be replaced in the genome. The targeting construct for replacement of the wA and yA genes were constructed via the split-marker PCR-based method described in (Nielsen M. L., Albertsen L., Lettier G., Nielsen J. B., Mortensen M. H., 2006. Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans. Fungal Genetics and Biology, Vol. 43:54-64). First the wA gene was targeted for deletion and the required targeting sequences were amplified from genomic DNA using the primers: ANwA-dl-Up-F (5-GGAAGAAGGTCGCATACCA-3; SEQ ID NO:34) combined with ANwA-dl-Up-Rad (5-gatccccgggaattgccatgGATCAGGAGAAGGAGAGTCAAG-3; SEQ ID NO:35) and ANwA-dl-Dw-Fad (5-aattccagctgaccaccatgGGCGAAAAGGCAAAGGAGC-3; SEQ ID NO:36) combined with ANwA-dl-Dw-R (5-GCTAGAAAAGGCAAGGGAGG-3; SEQ ID NO:37). The two marker fragments were amplified by combining the M1 primer (5-catggcaattcccggggatc-GCCGGCAATTTCTTTTTTAGGTAGC-3; SEQ ID NO:38) combined with the M2 primer (5-CCAGAAGCAGTACACGGC-3; SEQ ID NO:39) and the M3 primer (5-GTTGTCTGCTTGCGCTTCTTC-3; SEQ ID NO:40) with the M4 primer (5-catggtggtcagctggaatTCCTCCGCCATTTCTTATTCCC-3; SEQ ID NO:41). Following PCR amplification of the gene targeting and marker DNA fragments the fragments were fused by PCR, as described in Nielsen et al. 2006, the DNA fragments were gel purified and transformed into the recipient Aspergillus nidulans strain NID1 (described in Nielsen J. B, Nielsen M. L., Mortensen U. H, 2008, Transient disruption of non-homologous end-joining facilitates targeted genome manipulations in the filamentous fungus Aspergillus nidulans. Fungal Genetics and Biology, Vol. 45:165-170). The marker in the resulting strain was eliminated by counter selection on 5-FOA plates to identify transformants where the AfpyrG marker gene had looped out spontaneously. Targeted deletion of the yA gene was conducted as described for the wA gene, but using the following two primer pairs for amplifying the targeting sequences: Del-yA-5-F (5-GTGGGTTGAACCGCTTACTCAG-3; SEQ ID NO:42) combined with Del-yA-5-R (5-gatccccgggaattgccatg-CCCGGAGGAATCAAAATGACGC-3; SEQ ID NO:43) and Del-yA-3F (5-aattccagctgaccaccatgGTTTGGGATTCTTAGGTGAGCTC-3; SEQ ID NO:44) combined with Del-yA-3-R (5-CCTCCCTGGCGTATACACAAAC-3; SEQ ID NO:45). The resulting AfpyrG marker free strain is referred to as NID598 in the subsequent description.

(281) Targeted deletion of the asperthecin PKS (aptA) was performed in the NID598 background, using the experimental strategy described for the yA and wA gene deletions. The two targeting DNA fragments were PCR amplified using the primer AnAptA-UP-F (5-GCTCGAGCTTGCCAGCC-3; SEQ ID NO:46) combined with AnAptA-UP-R (5-gatccccgggaattgccatg-GCTGGTGTTGGGACACACG-3; SEQ ID NO:47) and the AnAptA-Dw-F (5-aattccagctgaccaccatgGCTTGGAAATCAGTATAGCTTTCTG-3; SEQ ID NO:48) combined with AnAptA-Dw-R (5-GCTTGTGGTCTGTCTGAATCG-3; SEQ ID NO:49). The gel purified targeting construct was then transformed into the marker free NID598 strain, resulting in the strain NID930.

(282) The Apt-cluster, mdp-cluster and stc-clusters were sequentially deleted in the NID598 background. For this, the required targeting constructs were constructed via directional Uracil-Specific Excision Reagent Cloning (USER) of the respective targeting fragments into the P1(P6) vector, as described in (Hansen B. G., Salomonsen B., Nielsen M. T., Nielsen J. B., Hansen N. B., Nielsen K. F., Regueira T. B., Nielsen J., Patil K. R., Mortensen U. H. 2011. Versatile enzyme expression and characterization system for Aspergillus nidulans, with the Penicillium brevicompactum polyketide synthase gene from the mycophenolic acid gene cluster as a test case. Appl Environ Microbiol. Vol. 77(9):3044-51). For deletion of the Apt-cluster the targeting fragments were amplified with the primers ANAPTcluster-Dl-Up-FU (5-GGGTTTAAdUGAGGAGCAGAGGATGCGG-3; SEQ ID NO:90) combined with ANAPTcluster-Dl-Up-RU (5-GGACTTAAdUGTAGTGGTGGTGCTGGTG-3; SEQ ID NO:91) and ANAPTcluster-Dl-Dw-FU (5-GGCATTAAdUCGCGTGGAATTTGGAAGAGAG-3; SEQ ID NO:92) combined with ANAPTcluster-Dl-Dw-RU (5-GGTCTTAAdUGTGCTCGGGGACGTGAAAG-3; SEQ ID NO:93). The used primers each included a 2-deoxyuridin (dU) based to allow for the creation of 3 overhangs. The resulting PCR fragments were gel purified and directionally cloned by USER cloning into the PacI/Nt.BbvCI digested P1(P6) vector. The resulting plasmid was SwaI digested to liberate the targeting fragment, including the AfpyrG marker. The digested plasmid was transformed into the marker-free NID598 strain. The AfpyrG marker was subsequently removed by 5-FOA counter selection, as described for wA above, to prepare the strain for deletion of the mdp-cluster. Targeted deletion of the mdp and stc clusters were conducted as described for the apt cluster. For construction of the targeting sequence for the mdp-cluster was PCR amplified using the ANMDPcluster-Dl-Up-FU (5-GGGTTTAAdUGGTCGTCTGTCAAGGAGTTG-3; SEQ ID NO:94) primer combined with the ANMDPcluster-Dl-Up-RU (5-GGACTTAAdUGCAGTGCTGTATATGGGTCTTG-3; SEQ ID NO:95) primer and the ANMDPcluster-Dl-Dw-FU (5-GGCATTAAdUGAGTTTGTGAGATGTTCAGGATGG-3; SEQ ID NO:96) primer combined with the ANMDPcluster-Dl-Dw-RU (5-GGTCTTAAdUGAGGTGAAGGACACAGCG-3; SEQ ID NO:97) primer. Moreover, the targeting sequence for the stc cluster were PCR amplified with the primers; ANSTCcluster-Dl-Up-FU (5-GGGTTTAAdUCGCAGAGACTAGGACACAAGTG-3; SEQ ID NO:98) combined with ANSTCcluster-Dl-Up-RU (5-GGACTTAAdUGCGGCGATCTGTGGTAGAG-3; SEQ ID NO:99) and ANSTCcluster-Dl-Dw-FU (5-GGCATTAAdUGCCAGCATATTCAAACCCAGTC-3; SEQ ID NO:100) combined with ANSTCcluster-Dl-Dw-RU (5-GGTCTTAAdUCACACAACCAACCTCCGATC-3; SEQ ID NO:101). The resulting strain with the deletion of the apt, mdp and stc clusters is referred to as NID_SMA.

(283) TABLE-US-00004 TABLE 3 The different Aspergillus nidulans strains used in the study Strain name Genotype NID1 nkuA argB2, pyrG89, veA1 NID598 nkuA, argB2, pyrG89, veA1, wA, yA NID930 nkuA, argB2, pyrG89, veA1, wA, yA, aptA NID_SMA nkuA, argB2, pyrG89, veA1, wA, yA, apt, mdp, stc

(284) TABLE-US-00005 TABLE 4 The affected genes Gene names and accession numbers in the Aspergillus- genome-database: yA = AN6635 Ascospore pigment biosynthesis (Laccase) wA = AN8209 Ascospore pigment biosynthesis (PKS) aptA = AN6000 Asperthecin PKS apt = aptA (AN6000) Asperthecin gene cluster to aptC (AN6002) mdp = mdpL (AN10023) Monodictyphenone/emondin gene cluster to mdpA (AN10021) stc = stcW (AN7804) to stcA Sterigmatocystin gene cluster (AN7825)

(285) Expression of Type III PKS in Aspergillus nidulans

(286) Synthetic (de novo synthesized) codon optimized versions of HpPKS2, AaOKS were made for yeast expression, and sequences with the natural codon usage were purchased from Genscript. Codon optimized genes are denoted with a ScOpt suffix, e.g. HpPKS2-ScOpt, while genes with the original codon usage from the natural host is denoted with an Orig suffix, e.g. HpPKS2-Orig. The synthetic DNA fragments were used as PCR template for PCR reactions with specific primers (IDT) for the coding sequences of the genes including stop codons. The used primers contained 5 overhangs compatible with Uracil Specific Excision Reagent (USER) cloning of the resulting PCR amplicons into expression vectors for targeted integration of the expression cassettes into one of seven possible sites in the Aspergillus nidulans genome. The plasmids features a fungal selection marker gene (Aspergillus fumigatus AfpyrG), a USER cloning site (AsiSI and Nb.btsI) and is flanked by two 1-1.5 kb Aspergillus nidulans DNA sequences (named Up and Down) to allow for integration into the Aspergillus nidulans genome by targeted homologous recombination (Hansen, B. G., Salomonsen, B., Nielsen, M. T., Nielsen, J. B., Hansen, N. B., Nielsen, K. F., . . . Mortensen, U. H. (2011)). Versatile enzyme expression and characterization system for Aspergillus nidulans, with the Penicillium brevicompactum polyketide synthase gene from the mycophenolic acid gene cluster as a test case. Applied and Environmental Microbiology, 77(9), 3044-3051). The PCR amplicons were amplified using PfuX7 DNA polymerase and the resulting DNA fragments were gel purified. The recipient vectors were prepared for USER cloning by digesting it with AsiSI and Nb.btsI overnight, followed by gel purification. The PCR amplicons were directionally cloned into the recipient vector by USER cloning, combined with transformation into E. coli. DH5a cells were thawed on ice, and the USER mix was added to 50 L of cells (110.sup.8 cfu/g pUC19). The mixture is placed on ice for 10 minutes, and heat shocked for 90 seconds at 45 C. Transferred to ice again and incubated for 5 minutes. The cells are plated on a LB-plate with selective antibiotic and incubated at 37 C. over night. The colonies are verified by PCR and the true transformants are grown in liquid LB-media with selective antibiotic over night for plasmid purification (Taylor, R. G., Walker, D. C., & McInnes, R. R. (1993). E. coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing. Nucleic Acids Research, 21(7), 1677-8).

(287) TABLE-US-00006 An_HpPKS2-ScOpt-F 5-AGAGCGAdUATGGGTTCCTTAGACAACGGTTC; SEQIDNO:102 An_HpPKS2-ScOpt-R 5-TCTGCGAdUTCACAAAGGAACACTTCTCAAAACC; SEQIDNO:103 An_AaOKS-ScOpt-F 5-AGAGCGAdUATGAGTTCACTCTCCAACGCTTCC; SEQIDNO:104 An_AaOKS-ScOpt-R 5-TCTGCGAdUTCACATGAGAGGCAGGCTGTG; SEQIDNO:105 An_HpPKS2-Orig-F 5-AGAGCGAdUGGGTTCCCTTGACAATGGTT; SEQIDNO:106 An_HpPKS2-Orig-R 5-TCTGCGAdUTTAGAGAGGCACACTTCGGAGAAC; SEQIDNO:107 An_AaOKS-Orig-F 5-AGAGCGAdUATGAGTAGTTTATCAAATGCCAGTC; SEQIDNO:108 An_AaOKS-Orig-R 5-TCTGCGAdUTCACATCAATGGCAAGGAA; SEQIDNO:109

(288) The verified expression plasmids were digested with SwaI (with AfpyrG marker), to liberate the expression cassette flanked by the up and down targeting sequences. The cassette was introduced into Aspergillus nidulans protoplast as specified above.

(289) The following expression plasmids and were constructed:

(290) TABLE-US-00007 pIS53(pyrG)::HpPKS2_ScOpt HpPKS2_ScOpt in IS53 locus pIS53(pyrG)::HpPKS2_Orig HpPKS2_Orig in IS53 locus pIS53(pyrG)::AaOKS_ScOpt AaOKS_ScOpt in IS53 locus pIS53(pyrG)::AaOKS_Orig AaOKS_Orig in IS53 locus

(291) The expression cassettes of the individual plasmids were liberated by SwaI digestion (with AfpyrG marker) and subsequently transformed into Aspergillus nidulans protoplasts. Following construction of the individual strain the used AfpyrG markers were eliminated by 5-FOA counter selection.

(292) Chemical Analysis of the Constructed Aspergillus nidulans Strains

(293) To access the effects the introduced genes had on the metabolism of the constructed Aspergillus nidulans strains, the strain were grown on MM, with appropriate supplements, for 5 to 14 days at 37 C. Metabolites were extracted by micro-scale extraction procedure described by Smedsgaard (Smedsgaard, J. (1997). Micro-scale extraction procedure for standardized screening of fungal metabolite production in cultures. Journal of Chromatography A, 760(2), 264-270). Summarized: Ten 0.4-0.6 mm circular plugs were cut from the culturing plates using a cork borer and placed in a 8 ml glass vial containing 2 ml of extraction solution made of methanol and 1% (v/v) formic acid. The tubes were ultrasonicated for 60 minutes in a water bath. The supernatant was transferred to a new vial and evaporated under a stream of nitrogen gas and heat (30 C.), and the resulting pellet was dissolved in 100 l of HPLC grade methanol and 1% formic acid (Sigma-Aldrich) by incubating the solution for 20 minutes in an ultrasonic bath. The resulting extraction solution was then filtered through a PTFE 0.45 um, 15 mm Premium Syringe Filters (Agilent Technologies) into HPLC vials. The extracted metabolites were analyzed using Agilent 1200 HPLC coupled to a Bruker micrOTOF-Q II mass spectrometer equipped with an electrospray ionization source. Chromatographic separation was obtained on a Luna Cis (2) column (150 354.6 mm, 3 m, 100 , Phenomenex) maintained at 40 C. The aqueous eluent (A) consisted of water/acetonitrile (95:5, v/v) and the organic eluent (B) consisted of water/acetonitrile (5:95, v/v); both acidified with 0.1% formic acid According to the purpose of the analysis, two different linear gradient elution profiles has been used: Method 1: 0 min, 0% B; 20 min, 100% B; 22 min 100% B; 24 min, 0% B. The flowrate was maintained at 0.8 mL/min and 7 min equilibration was used.

(294) Method 2:

(295) 0 min, 0% B; 30 min, 100% B; 33 min 100% B; 35 min, 0% B. The flowrate was maintained at 0.5 mL/min and 10 min equilibration was used.

(296) The samples were analyzed both in positive and negative ionization mode. The resulting dataset was analyzed using the following Software MassHunter (Agilent technologies). The resulting Base Peak Chromatograms (BPC) was inspected to identify changes in the metabolism of the fungus. While Extracted Ion Chromatograms (EIC) for masses fitting the expected intermediates in the biosynthetic pathway was generated to ease identification of the relevant peaks.

(297) Alternatively, the production of metabolites was analyzed in liquid MM cultures. For this 500 mL sterile Erlenmeyer flasks with 100 ml of liquid minimal medium, with appropriate supplements, were inoculated with a solution of macroconidia from the strains to be analyzed. The flasks were incubated for 1-15 days at 37 C. in a shake incubator with 150 rpm. The mycelium was poured through Miracloth (Merck Millipore) and separated from culture media. The mycelium was fast frozen with liquid nitrogen. The media was sterile filtered through an FPE-214-250 JET BIOFIL. The sterile media was then transferred to a 40 mL vial for chemical analysis.

(298) Extraction

(299) Fermentation broth (40 mL) was evaporated to dryness in vacuo and extracted with ethanol+10% formic (20 mL) acid by means of sonication (2 h) at 60 C. The solvent was decanted and dried in vacuo before being dissolved in 1.5 mL ethanol+10% formic acid using sonication. The supernatant was dried in a speedvac and dissolved in 180 L 90% methanol+10% formic acid, centrifuged and analyzed by HPLC-MS/MS

(300) Results:

(301) Analysis of the formed metabolites by UHPLC-HRMS of the strains comprising heterologous HpPKS2 or AaOKS showed that expression of the type III PKSs (HpPKS2 orAaOKS) resulted in the production of different compounds including the compounds SEK4, SEK4B and FK. Expression in the SMA cluster deletion strain resulted in a higher ratio of FK and SEK4/SEK4B.

CONCLUSION

(302) Expression of plant type III PKS (HpPKS2 or AaOKS) resulted in the production of different compounds including the compounds SEK4, SEK4B, FK anthrone, Mutactin and FK in vivo in Aspergillus nidulans. Expression in the strain with deleted asperthecin, sterigmatocystin and monodictyphenone/emodin gene clusters had a positive impact on production of the metabolites.

(303) Since there in this Example 6 were not inserted heterologous cyclases and/or aromatases into the Aspergillus strains and FK compound was identifiedit indicates that Aspergillus strains may comprise homologous cyclases and/or aromatases capable of converting in vivo non-reduced octaketide into FK compound.

Example 7: Stable Expression of Type III PKSs and Cyclases and/or Aromatases in Aspergillus nidulans

(304) Materials and Methods

(305) Expression of Bacterial Cyclases and Aromatases in Aspergillus nidulans

(306) Synthetic codon optimized version of ZhuI, ZhuJ for Aspergillus, S. cerevisiae and E. coli expression were purchased from Genscript. Similarly as described for the type III PKSs the cyclases and aromatases encoding genes were cloned into expression vectors targeting specific sites in the Aspergillus genome, different from the site used for expression of the Type III PKS (see Example 6). Said in other words, the ZhuI and ZhuJ genes were cloned into the Aspergillus strains of Example 5 that already comprised the heterologous type III PKS genes (HpPKS2, AaOKS).

(307) Primers used for the construction process, where dU represents 2-deoxyuridin:

(308) TABLE-US-00008 An_ZhuI_EcOpt-F 5-AGATATACCAdUGCGTCATGTTGAACATACCGT SEQIDNO:110 An_ZhuI_EcOpt-R 5-ATGGCTGCdUTTATGCGGTAACTGTACCAACACCA SEQIDNO:111 An_ZhuJ_EcOpt-F 5-ATATACATAdUGAGCGGTCGTAAAACCTTT SEQIDNO:112 An_ZhuJ_EcOpt-R 5-ATATCCAATdUTTAATCCTCTTCTTCTTGTTC SEQIDNO:113 An_ZhuI_ScOpt-F 5-AGAGCGAdUGAGACACGTTGAACACA SEQIDNO:114 An_ZhuI_ScOpt-R 5-TCTGCGAdUTTATGCAGTTACGGTACCA SEQIDNO:115 An_ZhuJ_ScOpt-F 5-AGAGCGAUGTCCGGTAGAAAGACCTT SEQIDNO:116 An_ZhuJ_ScOpt-R 5-TCTGCGAUTTAATCTTCTTCTTCTTGTTCG SEQIDNO:117

(309) The PCR amplified coding sequences were cloned into vectors for targeted integration in the Aspergillus nidulans genome: ZhuI in IS80 and ZhuJ in IS82. The verified expression cassettes were transformed into Aspergillus nidulans, by sequential targeted integration of the individual expression cassette, as described in Example 6. The AfpyrG marker was eliminated following each transformation round to allow for a subsequent transformation round introducing an additional expression cassette.

(310) Chemical analysis was performed as described in Example 6.

(311) Results:

(312) Analysis of the formed metabolites by UHPLC-HRMS showed that expression of ZhuI and ZhuJ did not significantly affect amount of produced metabolites (including the compounds SEK4, SEK4B and FK), i.e. the amounts produced by the strains of this Example 7 (comprising PKS (HpPKS2 or AaOKS)+ZhuI and ZhuJ) were similar to the amounts produced by the strains of Example 6 (comprising only PKS (HpPKS2 or AaOKS)).

CONCLUSION

(313) The results showed that expression of ZhuI and ZhuJ optimized for expression in E. coli did not significantly affect the produced metabolites in Aspergillus nidulans.

Example 8: Heterologous Expression of Type III PKSs and Dactylopius Coccus C-Glycosyltransferase in Aspergillus nidulans

(314) Materials and Methods

(315) Construction of plasmids, genetic transformation of Aspergillus nidulans and chemical analysis was performed as described in Example 6.

(316) Construction of Vectors for Expression of the Dactylopius Coccus C-Glycosyltransferase in Aspergillus nidulans

(317) The DcUGT2 gene was cloned/inserted into PKS (AaOKS) Aspergillus nidulans strain of Example 6.

(318) The full length DcUGT2 gene from Dactylopius coccus was codon optimized for expression in Aspergillus nidulans and purchased from GenScript as synthetic DNA. For PCR based amplification of the DcUGT2 coding sequence the following primers were used: DcUGT2_AnOpt-F: 5-AGAGCGAdUATGGAGTTTCGCTTGCTTATCCT (SEQ ID NO:118) and DcUGT2_AnOpt-R: 5-TCTGCGAdUTTAATTCTTCTTCAACTTTTCCGACTTAG (SEQ ID NO:119). The resulting PCR amplicon was cloned into an Aspergillus nidulans expression vector as described in Example 6. The used expression vector targeted the IS52 site in the genome of Aspergillus nidulans.

(319) Results:

(320) Analysis of the formed metabolites the Aspergillus nidulans strains comprising heterologous AaOKS and DcUGT2 showed that expression of resulted in the production of different compounds including the compounds CA, DCII, KA. The compounds FK, SEK4 and SEK4b were also identified, and co-expression of the DcUGT2 gave a higher yield of the before mentioned compounds.

CONCLUSIONS

(321) Co-expression of the heterologous PKS (AaOKS) and glycosyltransferase (DcUGT2) in Aspergillus nidulans resulted in production of CA, DCII, KA. The compounds FK, SEK4 and SEK4b were also identified, and co-expression of the DcUGT2 gave a higher yield of the before mentioned compounds.

Example 9: Expression of AaOKS in N, Benthamiana and In Vitro Activity Test

(322) Expression of AaOKS in N, Benthamiana

(323) AaOKS (Gene bank accession AY567707) (Abe I, Oguro S, Utsumi Y, Sano Y, Noguchi H (2005b). Engineered biosynthesis of plant polyketides: chain length control in an octaketide-producing plant type III polyketide synthase. J Am Chem Soc 127: 12709-12716.; Abe I, Utsumi Y, Oguro S, Morita H, Sano Y, Noguchi H (2005a). A plant type III polyketide synthase that produces pentaketide chromone. J Am Chem Soc 127:1362-1363) was synthesized by Genescript and amplified with primers containing a C-terminal his-tag and USER overhang for cloning into the USER-compatible pEAQ vector (Sainsbury F, Thuenemann E C, Lomonossoff G P (2009) pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol J 7: 682-693) with the USER-method (Nour-Eldin H H, Hansen B G, Nrholm MH, Jensen J K, Halkier B A (2006). Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments. Nucleic Acids Res 34: e122.) to give the resulting plasmid pEAQ-AaOKS. The plasmid was propagated in E. coli TOP10 cells and verified by sequencing. The plasmid was transformed into Agrobacterium tumefaciens by electroporation and positive clones were selected on Luria-Bertani (LB) agar supplemented with rifampicin (12.5 g/mL.), kanamycin (50 g/mL), and ampicillin (25 g/mL) followed by PCR to verify the presence of AaOKS. For expression, A. tumefaciens harboring pEAQ-AaOKS or pEAQ was cultured overnight in liquid LB supplemented with rifampicin (12.5 g/mL.), kanamycin (50 g/mL) and ampicillin (25 g/mL). The cells were pelleted by centrifugation and resuspended in infiltration medium (10 mM MES, 100 M acetosyringone, 10 mM MgCl.sub.2) to a final OD.sub.600: 0.5 and incubated at room temperature for 1 hr. A. tumefaciens was infiltrated into the leaves of 3-4 weeks old N. benthamiana plants by a needle-less syringe and the plants grew for a further 5 days in the green house.

(324) Extraction of Soluble Protein from N, Benthamiana

(325) 300 mg of plant material was grinded in a cold mortar with pestle and the addition of 0.5 g PVPP and 10 mL cold extraction buffer (50 mM sodium phosphate, 400 mM sucrose, 4 mM DTT, pH 7.2 containing Complete proteinase inhibitor (Roche)). The homogenate was filtered through nylon mesh into cold centrifuge tubes and centrifuged at 10.000g at 4 C. for 15 min. The supernatant was isolated and centrifuged at 100.000g at 4 C. for 60 min. The soluble fraction (supernatant) was isolated. Production of his-tagged AaOKS was verified by western blotting using anti-his antibody. His-tagged AaOKS was purified from the soluble fraction using His Spin Trap columns (GE health care biosciences) according to the manufacturer's instructions.

(326) Polyketide Synthase Assay

(327) Crude soluble enzyme extract of N. benthamiana leaves and affinity purified his-AaOKS were tested for polyketide synthase activity. The standard assay contain 100 l soluble protein or 20 l affinity purified his-AaOKS in a total reaction volume of 250 l containing 50 mM sodium phosphate, 500 mM sucrose, 1 mM DTT, 40 M malonyl-CoA, 20 M acetyl-coA, pH 7. The standard assay was supplemented with [2-.sup.14C]malonyl-CoA (1.8 mCi/mmol) for TLC analysis or [.sup.13C.sub.3]-malonyl-CoA for structural analysis. The reactions were incubated at 30 C. for 90 min, terminated by the addition of 25 l 20% HCl and extracted twice with 500 l ethyl acetate, 1% (w/v) acetic acid. The organic phase was dried in vacuo and resuspended in 20 l methanol, 1% (w/v) acetic acid and analyzed by TLC or LC-MS.

(328) ResultsIn Vitro Enzyme Activity of AaOKS:

(329) Crude enzyme extract from N. benthamiana expressing AaOKS were tested for octaketide synthase activity using malonyl-CoA as starter substrate. When .sup.14C-malonyl-CoA was incubated with crude enzyme extract or affinity-purified AaOKS the substrate was metabolized, as observed by the appearance of radioactive band on thin layer chromatogram, whereas no products were observed when using crude enzyme extract from tobacco plants infiltrated with plasmid alone. For structural elucidation .sup.13C-malonyl-coA was used as the substrate and the labelled products were identified by LC-MS as SEK4 and SEK4B. There was no difference in product formation when AaOKS was tagged with a C-terminal his-tag and this shows that the HIS-tag did not interfere with enzymatic activity. The results showed that AaOKS heterologously expressed in N. benthamiana has octaketide synthase activity and that the affinity purified enzyme in vitro produces the octaketide-derived shunt products SEK4 and SEK4B.

CONCLUSION

(330) The results showed that AaOKS heterologously expressed in N. benthamiana has octaketide synthase activity and that the affinity purified enzyme in vitro produces the octaketide-derived shunt products SEK4 and SEK4B.

Example 10: Cloning Truncated Versions of DcUGT2 in S. cerevisiae and Test of their In Vitro Activity Towards F K and KA

(331) Materials and Methods

(332) Expression Truncated DcUGT2 Gene Constructs in S. cerevisiae

(333) Truncated forms of DcUGT2 were generated lacking both the signal sequence and membrane anchor (SP_DcUGT2MD-Strep) or the membrane anchor (DcUGT2MD-Strep) alone. The fragments encoding SP_DcUGT2MD-Strep and DcUGT2MD-Strep were amplified separately from the pYES-DEST52-DcUGT2-Strep plasmid using specific PCR primers to incorporate a C-terminal Strepli-tag (see table below). Gateway recombination sites, attB1 and attB2, were introduced into the generated fragments in a following PCR using forward primer: 5-ggggacaagtttgtacaaaaaagcaggct-3 (SEQ ID NO:88) and reverse primer: 5-ggggaccactttgtacaagaaagctgggt-3 (SEQ ID NO:128). SP_DcUGT2MD-Strep and DcUGT2MD-Strep flanked with attB sites were cloned into pDONR207 plasmid (Invitrogen) and transferred into destination plasmid, pYES-DEST52 (Invitrogen) by using the Gateway technology system. The two pYES-DEST52 plasmid constructs were transformed separately into the Invscl yeast strain (Invitrogen) and positive transformants were verified by PCR. Heterologous protein production was performed according to the instructions of the pYES-DEST52 gateway plasmid (Invitrogen). Production of heterologous StrepII-tagged protein was verified by western blotting using anti-Strep antibody. A membrane bound and a soluble protein fraction were prepared from verified yeast transformants as described in (Pompon, D., Louerat, B., Bronine, A., Urban, P. (1996). Yeast expression of animal and plant P450s in optimized redox environments. Methods Enzymol. 272:51-64) and screened for glucosylation activity towards flavokermesic acid/kermesic acid as described above.

Example 11: In Planta Production of Carminic Acid and DcII by Heterologous Expression of Genes Encoding PKS, Cyclase and Full Length DcUGT Enzymes in Nicotiana benthamiana

(334) Transient Expression of Gene Constructs in Nicotiana benthamiana

(335) Synthetic DNA fragments encoding ZhuI (Genbank accession: AAG30197) and ZhuJ (Genbank accession: AAG30196) codon optimized for N. benthamiana expression and AaOKS (Genbank accession: AY567707) were purchased from Genscript. All synthetic fragments and the herein described pYES-DEST52-DcUGT2-Strep plasmid were used as PCR templates with compatible deoxyuracil (dU)-containing primers (see Table 5 below) to generate constructs that were cloned into pEAQ-HT-USER by USER technology. The truncated DcUGT2 version, DcUGT2MD-Strep, was transferred from the pDONR207 plasmid (Invitrogen) into destination plasmid, pEAQ-HT-DEST1 (Sainsbury, F., Saxena, P., Geisler, K., Osbourn, A., Lomonossoff, G. P. (2012). Using a Virus-Derived System to Manipulate Plant Natural Product Biosynthetic Pathways. Methods Enzymol. 517:185-202), using the Gateway technology system. All pEAQ-HT plasmid constructs were transformed into the Agrobacterium tumefaciens strain, AGL-1 and infiltrated into leafs of N. benthamiana plants as described in (Bach, S. S., Bassard, J. E., Andersen-Ranberg, J., Mldrup, M. E., Simonsen, H. T., Hamberger, B. (2014). High-Throughput Testing of Terpenoid Biosynthesis Candidate Genes Using Transient Expression in Nicotiana benthamiana. In M Rodriguez Concepcion, ed, Plant Isoprenoids, Methods in Molecular Biology, Vol. 1153. Humana Press, New York).

(336) TABLE-US-00009 TABLE5 Primersequencesforamplificationofdifferentgeneconstructs Gene fragments Primersequence AaOKS Forward 5-GGCTTAA/dU/ATGAGTTCACTCTCCAACGCTTCCCATC-3 (SEQIDNO:120) Reverse 5-GGTTTAA/dU/TTACATGAGAGGCAGGCTGTGGAGAAGGATAGT-3 (SEQIDNO:121) ZhuI Forward 5-GGCTTAA/dU/ATGAGGCATGTCGAGCAT-3 (SEQIDNO:122) Reverse 5-GGTTTAA/dU/TTATGCCGTGACAGTTCCGACAC-3 (SEQIDNO:123) ZhuJ Forward 5-GGCTTAA/dU/ATGTCCGGACGTAAGACG-3 (SEQIDNO:124) Reverse 5-GGTTTAA/dU/TTAATCTTCCTCCTCCTGTTCAA-3 (SEQIDNO:125) DcUGT2- Forward 5-GGCTTAA/dU/ATGGAATTCAGATTGTTGATATTGGCCT-3 (SEQIDNO:126) Strep Reverse 5-GGTTTAA/dU/TTATTTTTCGAATTGTGGATGAGACCAAGCAGA-3 (SEQIDNO:127) DcUGT2 Forward 5-ggggacaagtttgtacaaaaaagcaggct-3 (SEQIDNO:88) MD- (attB1) Strep Reverse 5- TTATTTTTCGAATTGTGGATGAGACCAAGCAGAGTGCAAAAAGGCACCT GCAGT-3 (SEQIDNO:89)

(337) Metabolite Extraction and LC-MS/MS Analysis

(338) Metabolites were extracted from discs (0=3 cm) of agroinfiltrated N. benthamiana leaves. Leaf discs, excised with a cork borer, were flash frozen in liquid nitrogen. 0.5 ml of extraction buffer (85% (v/v) methanol, 0.1% (v/v) formic acid), equilibrated to 50 C., were added to each frozen leaf disc followed by incubation for 1 hour at 50 C., agitating at 600 rpm. The supernatant was isolated and passed through a MultiscreenHTs HV 0.45 m filter plate (Merck Milipore). The filtered supernatant was subjected to LC-MS/MS analysis which was performed on an Agilent 1200 HPLC coupled to a Bruker micrOTOF-Q II mass spectrometer equipped with an electrospray ionization source. Chromatographic separation was obtained on a Luna Cis(2) column (1504.6 mm, 3 m, 100 , Phenomenex) maintained at 40 C. The aqueous eluent (A) consisted of water/acetonitrile (95:5, v/v) and the organic eluent (B) consisted of water/acetonitrile (5:95, v/v); both acidified with 0.1% formic acid. According to the purpose of the analysis, two different linear gradient elution profiles were used:

(339) Method 1: 0 min, 0% B; 30 min, 100% B; 33 min 100% B; 35 min, 0% B. The flow rate was maintained at 0.5 mL/min and 10 min equilibration was used. Retention times were 15.5 min for dcII, 15.6 min for carminic acid (CA), 17.1 min for flavokermesic-O-Glc 2 (FK-O-Glc 2), 17.2 min for SEK4, 17.7 min for SEK4B, 22.7 min for flavokermesic acid (FK) and 22.7 min for kermesic acid (KA).

(340) Method 2: 0 min, 10% B; 25 min, 20% B; 27 min 100% B; 35 min, 100% B; 36 min, 10% B. The flow rate was maintained at 0.5 mL/min and 10 min equilibration was used. Retention times were 16.1 min for flavokermesic-O-Glc 1 (FK-O-Glc 1), 17.0 min for dcII, 18.2 min for carminic acid (CA), 24.1 min for SEK4, 25.5 min for flavokermesic-O-Glc 2 (FK-O-Glc 2), 26.8 min for SEK4B, 35.5 min for flavokermesic acid (FK) and 36.0 min for kermesic acid (KA).

(341) O-glucosides were identified with viscozyme L-treatment and by the neutral loss of 162 Da in the MS/MS spectrum.

(342) Results:

(343) The AaOKS of Aloe arborescens has previously been characterized to be an octaketide synthase belonging to the type III PKS enzyme class. To investigate the possibility of using such a type III PKS enzyme to generate the octaketide precursor required for carminic acid production, the AaOKS gene was transiently expressed in N. benthamiana. The AaOKS gene, when compared to empty plasmid control, results in formation of SEK4 and SEK4B after agroinfiltration in to leaves of N. benthamiana. This demonstrates that AaOKS can function as an active octaketide synthase in vivo in N. benthamiana. Furthermore since no flavokermesic acid (FK) anthrone or FK could be observed when AaOKS is agroinfiltrated alone, N. benthamiana may lack endogenous enzymes to further metabolize SEK4 and SEK4B into these compounds. Thus the cyclase genes, ZhuI and ZhuJ, were co-agroinfiltrated with AaOKS. ZhuI and ZhuJ originate from the R1128 antibiotic biosynthetic pathway and have previously been combined in vivo with the actinorhodin minimal PKS in Streptomyces coelicolor to produce FK (Tang, Y., Lee, T. S., Khosla, C. (2004). Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases. PLOS Biol. 2(2):E31). In N. benthamiana, when ZhuJ is co-agroinfiltrated with AaOKS, accumulation of FK and flavokermesic acid-O-glucoside, FK-O-Glc 2 is observed and this is not the case when AaOKS is co-agroinfiltrated with ZhuI. The production of FK-O-Glc 2 suggests that one or several endogenous N. benthamiana UGT(s) are capable of efficiently using FK as substrate. Additionally, the co-agroinfiltration of ZhuI with AaOKS reduces the production of SEK4B by promoting the formation of SEK4 which is in accordance with the previous finding that ZhuI directs the initial C7-C12 cyclization (rather than the C10-C15 cyclization which results in SEK4B formation) of the linear octaketide (Ames, B. D., Lee, M. Y., Moody, C., Zhang, W., Tang, Y., Tsai, S. C. (2011). Structural and biochemical characterization of ZhuI aromatase/cyclase from the R1128 polyketide pathway. Biochemistry. 39: 8392-8406). This initial C.sub.7-C.sub.12 cyclization is also required for the biosynthesis of the anthraquinone backbone of FK/CA and when ZhuI is co-agroinfiltrated with AaOKS and ZhuJ, the total pool of FK and flavokermesic acid-O-glucoside is indeed markedly increased as compared to when it is absent.

(344) In planta production of DCII and CA was detected when full length DcUGT2_Strep was co-expressed with AaOKS, ZhuI and ZhuJ in N. benthamiana. The production of CA is only found in trace amounts when compared to levels of DCII. This CA production is likely due to an unspecific endogenous monooxygenase activity in N. benthamiana that either is capable of hydroxylating FK to kermesic acid (KA) or DCII to CA. However, it is noteworthy that KA is not detectable in any of the agroinfiltration studies, indicating that this compound is either produced at levels below our detection limit or it may be highly toxic for N. benthamiana and therefore rapidly metabolized into unknown products.

CONCLUSIONS

(345) The results of this Example demonstrated:

(346) (i): The AaOKS gene from Aloe arborescens was transiently expressed in N. benthamiana and in vivo this resulted in formation of SEK4 and SEK4B, which demonstrated that AaOKS can function as an active octaketide synthase in vivo in N. benthamiana;

(347) (ii): Since no flavokermesic acid (FK) anthrone or FK could be observed when AaOKS was agroinfiltrated alone, N. benthamiana may lack endogenous enzymes to further metabolize SEK4 and SEK4B into these compounds.

(348) (iii): The cyclase genes ZhuI and ZhuJ, from Streptomyces sp. R1128, were co-agroinfiltrated with AaOKS and when ZhuJ was co-agroinfiltrated with AaOKS, accumulation of FK and flavokermesic acid-O-glucoside, FK-O-Glc 2 was observed. When ZhuI was co-agroinfiltrated with AaOKS and ZhuJ, the total pool of FK and flavokermesic acid-O-glucoside was indeed markedly increased as compared to when it is absent. Accordingly, heterologous expression of Streptomyces sp cyclase genes resulted in in vivo the production of different compounds including FK;

(349) (iv): In vivo production of DCII and CA was detected when full-length DcUGT2 Strep was co-expressed with AaOKS, ZhuI and ZhuJ in N. benthamiana.

Example 12: Heterologous Expression of a Truncated Version of DcUGT2 and Test of its in Planta Activity in N. Benthamiana

(350) To investigate whether the DcUGT2 protein, could be solubilized and still retain glucosylation activity towards KA and FK, the membrane anchor was deleted. DcUGT2 is predicted via bioinformatics to be located to the ER with the C-terminal anchored in the ER membrane and the N-terminal active site facing the lumen. Therefore it was speculated whether the protein might be N-glycosylated and, if so this posttranslational modification might be required for the activity of the DcUGT2 enzyme. An N-glycosylation bioinformatics prediction analysis was carried out, identifying 3 putative N-glycosylation sites. To investigate whether glycosylation and the ER targeting play a role for the activity of the DcUGT2 enzyme, a truncated DcUGT2 form was generated where the signal peptide was intact but the membrane anchor deleted (DcUGT2MD-Strep). This DcUGT2MD-Strep protein is active in vivo and produced DCII when co-expressed with AaOKS and ZhuJ in N. benthamiana. The production of DCII was lower in these plants compared to the DCII levels in plants co-agroinfiltrated with the DcUGT2. This could imply that although the DcUGT2MD-Strep protein is active, the level of the enzyme activity may be compromised by the deletion of the membrane anchor. The fact that DcUGT2MD-Strep still possesses some glucosylation activity towards FK and/or KA indicates further that N-glycosylation and (or) ER-targeting of the protein might be crucial for the activity of the enzyme. Additionally it should be pointed out that the full-length DcUGT2 appears to compete efficiently with the N. benthamiana FK O-glucosylation activity, thereby significantly reducing the pool of flavokermesic acid-O-Glc (FK-O-Glc 1 and 2) and this is not observed for the truncated DcUGT2MD-Strep version.

CONCLUSIONS

(351) The results of this Example demonstrated that DcUGT2MD-Strep (lacking the membrane anchoramino acids 1 to 468 of SEQ ID NO:2) was active in vivo in N. benthamiana plant. The activity of DcUGT2MD-Strep (lacking the membrane anchor) was less than full-length DcUGT2 enzymehowever, the fact that it was active may indicate that it could be particular useful for heterologous production in e.g. prokaryotic organisms.

REFERENCES

(352) 1: U.S. Pat. No. 5,424,421 (European Colour, published 1995) 2: WO2006/056585A1 (Chr. Hansen A/S) 3: Stathopoulou et al (Analytica Chimica Acta 804 (2013) 264-272) 4: Zagrobelny et al (Cyanogenic glucosides and plant-insect interactions; Phytochemistry. 2004 February; 65(3):293-306) 5: Geuder et al (Journal of Chemical Ecology, Vol. 23, No. 5, 1997) 6: Genta et al, (Potential role for gut microbiota in cell wall digestion and glucoside detoxification in Tenebrio molitor larvae), Journal of Insect Physiology 52 (2006) 593-601 7: WO2004/111254A1 (Poalis A/S) 8: Gutmann et al (Pure Appl. Chem, 2013 Jul. 9) 9: Baig et al (Angew Chem Int Ed Engl. 2006 Nov. 27; 45(46):7842-6) 10: Radominska-Pandya A, Bratton S M, Redinbo M R, Miley M J. Drug Metab Rev. 2010 February; 42(1):133-44) 11: Plant Physiology, November 2008, Vol. 148, pp. 1295-1308 12: Esben Halkjaer Hansen et al. Phytochemistry 70(4): 473-482 13: Tang, Y., Lee, T. S., and Khosla, C. (2004) Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases. PLoS Biol. 2, e31 14. Mizuuchi Y, Shi S P, Wanibuchi K, Kojima A, Morita H, Noguchi H, Abe I. Novel type III polyketide synthases from Aloe arborescens. FEBS J. 2009 April; 276(8):2391-2401. 15. Karppinen K, Hokkanen J, Mattila S, Neubauer P, Hohtola A. Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins. FEBS J. 2008 September; 275(17):4329-4342. 16. Dayu Yu, Fuchao Xu, Jia Zeng, Jixun Zhan. Type III Polyketide Synthases in Natural Product Biosynthesis. IUBMB Life, 64(4): 285-295, April 2012 17. Supriya Jadhav, Prasad Phapale, Hirekodathakallu V. Thulasiram, Sujata Bhargava. Polyketide synthesis in tobacco plants transformed with a Plumbago zeylanica type III hexaketide synthase. Phytochemistry 98 (2014) 92-100.