Fungus-sourced high-temperature acid B-glucosidase as well as coding gene and application thereof

Abstract

Provided are a fungus-sourced high-temperature acid -glucosidase as well as a coding gene, and an application thereof. The provide -glucosidase has the optimal pH value of 4.5 and the optimal temperature of 75 C., and maintains over 90% enzyme activity in the optimal condition after being processed at 60 C. for 1 h. The re-engineering yeast strain GS115/bgl3A of the coding gene comprising the -glucosidase has high fermentation level.

Claims

1. A recombinant host cell comprising a heterologous acid -glucosidase comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

2. An isolated polynucleotide encoding the acid--glucosidase comprised in the recombinant host cell of claim 1.

3. A DNA constructor or a recombinant vector comprising the isolated polynucleotide of claim 2.

4. A recombinant vector pPIC9-bgl3A comprising the polynucleotide of claim 2.

5. A recombinant host cell comprising the isolated polynucleotide of claim 2.

6. A recombinant host cell GS115/bgl3 comprising the isolated polynucleotide of claim 2.

7. A method of producing a high-temperature acid -glucosidase comprising the steps of: (1) transforming a host cell with the DNA constructor or a recombinant vector of claim 3 to obtain the recombinant host cell; (2) cultivating the recombinant host cell to induce expression of -glucosidase; and (3) recovering said high-temperature acid -glucosidase.

8. The recombinant host cell of claim 1, said acid -glucosidase having an optimal pH value of 4.5 and an optimal temperature of 75 C., and being thermostable at 37 C., and maintaining over 90% of activity in an optimal condition after being processed at 60 C. for 1 hour.

9. The recombinant host cell of claim 1, wherein said cell is a yeast cell.

10. The recombinant host cell of claim 9, wherein said yeast cell is a Pichia cell.

11. The recombinant host cell of claim 9, wherein said yeast cell is an Aspergillus cell.

12. The recombinant host cell of claim 1, wherein said cell is an E. coli cell.

Description

BRIEF DESCRIPTIONS OF THE DRAWINGS

(1) FIG. 1 shows optimum pH values for novel -glucosidase.

(2) FIG. 2 shows pH stabilities for novel -glucosidase.

(3) FIG. 3 shows optimum temperature values for novel -glucosidase.

(4) FIG. 4 shows heat stability for novel -glucosidase.

EXAMPLES

(5) The present invention is further illustrated with reference to the following Examples and the appended drawings, which should by no means be construed as limitations of the present invention.

(6) Test Materials and Reagents 1. Strains and vectors: Talaromyces emersonii 12802; Pichia pastoris strain GS115 (Invitrogen); and vetor pPIC9 (Invitrogen, San Diego, Calif.). 2. Enzymes and other biochemical reagents: restriction endonucleases(TaKaRa); ligase (Invitrogen); and birch xylan(Sigma) 3. Medium: (1) taking potato dextrose medium as Talaromyces emersonii 12802 Medium, including 1000 mL of potato juice, 10 g of dextrose, and 25 g of arga, natural pH. (2) E. coli. LB medium: 1% of peptone, 0.5% of yeast extract, and 1% of NaCl, natural pH. (3) BMGY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 1% of glycerol(V/V). (4) BMMY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 0.5% of methanol (V/V).

(7) Suitable biology laboratory methods not particularly mentioned in the examples as below can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other kit laboratory manuals.

Example 1 Cloning -Glucosidase Gene from Talaromyces emersonii 12802

(8) Genomic DNA is isolated from Talaromyces emersonii 12802 by adding 2 mL of extract buffer mycelium, and grinding for 5 min, followed by decomposing for 120 min in a water bath at 65 C., and mixing well every 20 min, then centrifugating for 10 min at 13000 rpm at 4 C. The supernatant was extracted in phenol/chloroform to remove the impurities, followed by adding isopropanol in equal volume, settling for 30 min at 20 C., centrifugating for 10 min at 13000 rpm at 4 C. to remove supernatant, washing the precipitate with 70% ethanol twice followed by drying, dissolving in TE solution and storing at 20 C.

(9) It was possible to design a pair of degenerate primers to amplify part fragment of the (3-glucosidase gene based on the conserved fragment of the family 3 of -glucosidase from the Talaromyces emersonii 12802 DNA by PCR.

(10) TABLE-US-00005 P1: (SEQID.NO.7) 5-GGCCGCAAYTGGGARGGNTT-3; P2: (SEQID.NO.8) 5-GTCACCAGGCATNGHCATRTC-3.

(11) PCR amplification was performed by optimizing PCR parameters as follows: degenerating at 94 C. for 5 minutes, followed by 30 cycles at: degenerating at 94 C. for 30 seconds/annealing temperature at 45 C. for 30 seconds/extending at 72 C. for 1 minute, and a final extension of 10 minutes at 72 C. PCR product comprising 475 bp was obtained and linked to vector pEASY-T3 for sequencing.

(12) Based on the known 475 bp fragment, the nested insertion-specific primers for TAIL PCR were designed, and named respectively as shown in table 1, wherein primer sp2 located in the downstream of primer sp1, primer sp3 located in the downstream of primer sp2, the arbitrary distance between two primer, 2230 nt in length, and the annealing temperature at 6065 C.

(13) TABLE-US-00006 TABLE1 SpecificprimersforTAILPCR Sequence(5---3) Length Primer SEQIDNO. (bp) dsp1 CGAGGACGGAACCTACCGCGAGAGC/9 25 dsp2 CGAGGAGTACATCAAGCTTGCCTTCG/10 26 dsp3 CAAGGTCGACCCTAAGGCCAAGC/11 23 usp1 GTAGAGCTTGGCCTTAGGGTCGAC/12 24 usp2 GCGGCGGTCTCGAAGGCAAGCTTG/13 24 usp3 GGTAGGTTCCGTCCTCGTTCAGCG/14 24

(14) Two flanking sequences were obtained by Reverse TAIL-PCR, sequenced, and assembled into -glucosidase gene with 2682 bp in full length including five introns, coding 773 amino acids and one termination codon. Said -glucosidase gene comprised a mature gene of 2214 bp and a fragment coding signal peptide of 19 amino acids in N-terminal.

Example 2 Producing Recombinant -Glucosidase

(15) The coding region of mature protein was amplified. The amplification products were visualized by electrophoresis on agarose gel, and band of expected size was excised and DNA was extracted with Kit. The DNA purified was inserted into pPIC9 (Invitrogen, San Diego, Calif.) at the EcoRI and NotI sites, as described by the manufacturer instruction to obtain DNA construct pPIC-bgl3A. The construct was transformed into Pichia pastoris strain GS115 to obtain the recombinant cell GS115/bgl3A.

(16) The transformed Pichia pastoris strain GS115 (Invitrogen) were incubated in 400 mL of BMGY for 48 h at 30 C. and 250 rpm, and then the cells were spun down and suspended in 200 mL of BMMY to induce the -glucosidase gene expression. 72 hours after induction, the supernatant was recovered by spinning to test the activity of the -glucosidase. The expression amount of -glucosidase was 33 U/mL. And, the recombinant -glucosidase was expressed in Pichia pastoris strain GS115 as showed by SDS-PAGE.

(17) The expression vector comprising the full-length -glucosidase gene was constructed and transformed to Pichia pastoris strain GS115 by the same method as above, and the recombinant -glucosidase was also tested.

Example 3 Measuring Activity of the Recombinant -Glucosidase

(18) The amount of pNP produced by hydrolyzing substrate pNPG with enzyme in 405 nm. 125 l of substrate solution of pNPG in 2 mM mixed with 125 l buffer was added to 250 l of diluted enzyme solution, which was reacted at 60 C. for 10 minutes. Then, 1.5 mL of Na.sub.2CO.sub.3 in 1M was added to stop the reaction. OD 405 was measured.

(19) 1 unit of -glucosidase activity was determined to be the enzyme amount releasing 1 mol of pNP by decomposing substrate, pNPG, for 1 minute.

Example 4 Measuring the Properties of the Recombinant -Glucosidase Obtained in Example 2

(20) 1. Optimum pH Values and pH Stability

(21) The -glucosidase purified in example 2 was reacted in the different pH to determine optimum pH. The activity of -glucosidase was measured with xylan in 0.1 mol/L citric acid-sodium dimetallic phosphate buffer with different pH at 50 C. As is shown in FIG. 1, the activity of -glucosidase varied with pH. The highest activity was observed at pH 4.5. Part of the activity was still maintained at pH 3.0. FIG. 2 shows the enzyme activity was very stable, when the -glucosidase was maintained at 37 C. at different pH for 60 min followed by measuring the activity in buffer with pH 4.5 at 75 C.

(22) 2. Optimum Temperature and Heat Stability

(23) The -glucosidase was reacted in the different temperatures to determine optimum temperature. The activity of -glucosidase was measured with xylan in citric acid-sodium dimetallic phosphate buffer (pH 6.0) at different temperatures. As shown in FIG. 3, the activity of -glucosidase varied with temperatures. The highest activity was observed at 75 C. FIG. 4 showed the enzyme activity was thermalstable, more than 90% of the enzyme activity was still maintained when the enzyme was maintained at 60 C. for 1 h.

(24) 3. Measuring Enzyme Kinetics of -Glucosidase

(25) Testing the activity of -glucosidase at 75 C. with the different concentration of substrate, pNPG, in citric acid-sodium dimetallic phosphate buffer (pH4.5), and calculating K.sub.m as 0.18 mM, and V.sub.max as 1308.73 mol/min.Math.mg.

(26) 4. Effect of Metal Ions and Inhibitors on Activity of -Glucosidase

(27) The effect of metal ions on -glucosidase activity was investigated at the pH optimum (pH 4.5) and 75 C. in a final concentration of 5 mmol/L. The result showed that, among various metal ions, the enzyme activity of -glucosidase was weakly inhibited by many metal ions. As for inhibitors, the enzyme activity was strongly tolerant to SDS, and 78% of the enzyme activity was remained in SDS concentration of 5 mmol/L. However, the enzyme activity was inhibited by Ag.sup.+ and Cu.sup.2+.

(28) 5. Determination of Specific Activity

(29) As showed in table 2, -glucosidase BGL3A was specific, specifically hydrolizing aglycone of non-reducing end, almost didn't hydrolyze fiber polysaccharides.

(30) TABLE-US-00007 TABLE 2 Specific activity of -glucosidase BGL3A Substrate Specific activity (U/mg) p-Nitrophenyl -d-glucoside 826.9 0.12 p-Nitrophenyl -d-cellobioside 76.57 0.03 p-nitrophenyl -d-xylopyranoside 65.23 0.11 p-nitrophenyl -d-galactoside 103.71 0.07 p-nitrophenyl -l-arabinofuranoside 72.94 0.18 p-nitrophenyl 76.76 0.22 Gentiobiose 393.23 0.05 Amygdalin 377.4 0.21 Cellobiose 209.18 0.18 Genistin 175.3 0.3 Glycitin 75.63 0.6

Example 5 Synergetic Degradation of Filter Paper

(31) The activity of filter paper enzyme can be taken as an index measuring the total activity of cellulase system from microorganism, directly indicating cellulase's hydrolysis capacity.

(32) As assay group, 100 uL of supernatant of specific humicola culture and 100 uL of -glucosidase BGL3A solution diluted with dilution factor of 1, 10 and 50 corresponding to 30 U, 3 U and 0.6 U were added to citric acid-sodium dimetallic phosphate buffer (pH 4.5) using Whatman quantitative filter paper as substrate, to react for 1 h at 50 C., and the amount of reducing sugars was measured by DNS method. As a control, 100 uL of buffer substituting enzyme was added. The result showed assay groups had 1.296 times, 1.198 times and 1.129 times higher filter paper enzyme activity relative to the supernatant of specific humicola culture. As a result, -glucosidase BGL3A had good capability of hydrolizing cellulose, and synergistically decomposing complex substrates with exo-cellulase and cellobiohydrolase.