Nucleic acid amphiphiles and nanostructures
10415040 ยท 2019-09-17
Assignee
Inventors
- Efrosini Kokkoli (Minneapolis, MN)
- Timothy R. Pearce (Minneapolis, MN, US)
- Huihui Kuang (Minneapolis, MN, US)
Cpc classification
A61K47/6925
HUMAN NECESSITIES
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y30/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y40/00
PERFORMING OPERATIONS; TRANSPORTING
A61K9/0092
HUMAN NECESSITIES
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
A61K47/26
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61K47/69
HUMAN NECESSITIES
Abstract
Provided herein are nucleic acid amphiphiles and nanostructures such as nanotubes twisted nanotapes and helical nanotapes that comprise the amphiphiles as well as methods to deliver therapeutic agents with the nanostructures.
Claims
1. A self-assembled nanotube comprising a nucleic acid amphiphile of formula I:
A-B-C-D I wherein: A has the formula: ##STR00023## wherein: each A.sup.1 is independently a saturated or unsaturated (C.sub.5-C.sub.30) hydrocarbon chain; A.sup.2 is a saturated or unsaturated (C.sub.5-C.sub.25) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NRgroup and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain; and n is 1, 2, 3 or 4; B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain, or B is absent provided that when B is absent, the polynucleotide comprises one or more guanine nucleotides and is greater than 10 nucleotides in length; C is absent, or C is a saturated or unsaturated (C.sub.2-C.sub.10)hydrocarbon chain; and D is single stranded DNA comprising 5-50 nucleotides or a single stranded RNA comprising 5-50 nucleotides; or a salt thereof; and provided that D is not the nucleotide sequence TABLE-US-00018 (SEQIDNO:2) GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT.
2. The nanotube of claim 1, wherein each A.sup.1 is independently a saturated or unsaturated (C.sub.10-C.sub.30) hydrocarbon chain.
3. The nanotube of claim 1 wherein A is ##STR00024##
4. The nanotube of claim 1, wherein B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain are replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain are substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
5. The nanotube of claim 1, wherein B is ##STR00025##
6. The nanotube of claim 1 wherein C is a saturated or unsaturated (C.sub.2-C.sub.10)hydrocarbon chain.
7. The nanotube of claim 1, wherein D is selected from the group consisting of: TABLE-US-00019 (SEQIDNO:4) 5-TTCTATTCTC-3; (SEQIDNO:5) 5-CCAATTAATT-3; (SEQIDNO:6) 5-TTCTATTCTCACATTTCATCTATTA-3; (SEQIDNO:7) 5-TTCTATTCTCACATTTCATCTATTAAACCACCAATTAATT-3; (SEQIDNO:3) 5-GGGGGTTCTC-3; (SEQIDNO:8) 5-GGGGGTAATT-3; (SEQIDNO:9) 5-GGGGGTTCTCACATTTCATCTATTA-3; (SEQIDNO:10) 5-GGGGGTTCTCACATTTCATCTATTAAACCACCAATTAATT-3; (SEQIDNO:11) 5-GGGTGGGTGGGTATTTCATCTATTA-3; (SEQIDNO:12) 5-GGGTGGGTGGGTATTTCATCTATTAAACCACCAATTAATT-3; (SEQIDNO:13) 5-GGGTGGGTGGGTGGGTCATCTATTA-3; (SEQIDNO:14) 5-GGTGGTGGTGGTATTTCATCTATTA-3; (SEQIDNO:15) 5-GGGTGGGTGGGTGGGTCATCTATTAAACCACCAATTAATT-3 and (SEQIDNO:16) 5-CCCTATTCCCAGATCCCATTACCC-3.
8. A pharmaceutical composition comprising a nanotube as described in claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceuticaly acceptable carrier.
9. The nanotube of claim 1 wherein A.sup.2 is a saturated (C.sub.10-C.sub.20) hydrocarbon chain wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NR group and wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
10. The nanotube of claim 1 wherein A.sup.2 is a saturated (C.sub.10-C.sub.16) hydrocarbon wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
11. The nanotube of claim 1 wherein each A.sup.1 is independently a saturated (C.sub.10-C.sub.25) hydrocarbon chain.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION
(14) The nanostructures (e.g., nanotubes, twisted nanotapes and helical nanotapes) described herein are generally formed via the self-assembly of nucleic acid amphiphiles (e.g., ssDNA-amphiphiles). The nucleic acid amphiphiles as used herein refers to an amphiphile comprising a hydrophilic headgroup (e.g., polynucleotide) which is generally a single stranded polynucleotide segment that is covalently bonded to a hydrophobic (lipophilic) group or tail (e.g., hydrocarbon chain). In one embodiment the polynucleotide headgroup is separated from the hydrophobic group by a spacer and/or a linker.
(15) The term saturated hydrocarbon chain as used herein refers to a straight or branched chain of the specified number of carbon atoms that is saturated. It is to be understood that a branched chain can have multiple braches (e.g., 1, 2, 3, 4 or more)
(16) The term unsaturated hydrocarbon chain as used herein refers to a straight or branched chain of the specified number of carbon atoms that has one or more carbon-carbon double bonds or carbon-carbon triple bonds or a combination thereof. It is to be understood that a branched chain can have multiple braches (e.g., 1, 2, 3, 4 or more)
(17) The term oxo as used herein is an O group
(18) The term thioxo as used herein is an S group
(19) Polynucleotide
(20) The polynucleotides that make up the hydrophilic headgroup of the nucleic acid amphiphiles are single stranded polynucleotides. The nucleotides contain a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate groups. Bases include purines and pyrimidines, which further include natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, and synthetic derivatives of purines and pyrimidines. The polynucleotide can contain any single stranded nucleic acid (e.g., ssDNA) sequence or mixture of sequences and can of variable length. In one embodiment the polynucleotide comprises 5-50 nucleotides. In one embodiment the polynucleotide comprises 5-100 nucleotides. In one embodiment the polynucleotide comprises 5-200 nucleotides. In one embodiment the polynucleotide comprises 2-50 nucleotides. In one embodiment the polynucleotide comprises 2-100 nucleotides.
(21) The polynucleotide segment can be connected to the spacer (B) or the hydrophobic group (A) at the 3 or 5 end of the polynucleotide. In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through the oxygen atom of the 3 or 5 phosphate. In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through the oxygen atom of the 5 phosphate. In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through the oxygen atom of the 3 phosphate. In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through the oxygen atom of the sugar ring at the 3 position. The polynucleotides can also be connected to the spacer or the hydrophobic tail at an internal nucleotide of the polynucleotide.
(22) The polynucleotide segment can be also be connected to the spacer (B) or the hydrophobic group (A) at the 3 or 5 end of the polynucleotide through a linker (C). In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through a linker that is bonded to the oxygen atom of the 3 or 5 phosphate. In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through a linker that is bonded to the oxygen atom of the 5 phosphate. In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through a linker that is bonded to the oxygen atom of the 3 phosphate. In one embodiment the polynucleotides can be connected to the spacer or the hydrophobic tail through a linker that is bonded to the oxygen atom of the sugar ring at the 3 position.
(23) The polynucleotides can also be connected to the linker at an internal nucleotide of the polynucleotide.
(24) Polynucleotides may be modified. Such modifications may be useful to increase stability of the polynucleotide in certain environments. Modifications can include modifications to the nucleic acid sugar, the base or backbone or any combination thereof. The modifications can be synthetic, naturally occurring, or non-naturally occurring. A polynucleotide can include modifications at one or more of the nucleic acids present in the polynucleotide.
(25) Polynucleotides can be produced in vitro or in vivo. For instance, methods for in vitro synthesis include, but are not limited to chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for in vitro synthesis are well known. Methods for in vitro synthesis also include, for instance, in vitro transcription using a circular or linear expression vector in a cell free system.
(26) Hydrophobic group or hydrophobic tail
(27) The hydrophobic group (A) or tail segment of the nucleic acid amphiphile is lipophilic in nature. In general the hydrophobic group includes hydrocarbon chains that are connected to the spacer or polynucleotide headgroup via functional groups such as but not limited to amide, ester, thioamide and thioester groups. In one embodiment the hydrophobic group is a saturated or unsaturated (C.sub.10-C.sub.150) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain. In one embodiment the hydrophobic group is a saturated or unsaturated (C.sub.10-C.sub.150) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain. In one embodiment the hydrophobic group is a saturated or unsaturated (C.sub.10-C.sub.150) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain. In one embodiment the hydrophobic group is a saturated or unsaturated (C.sub.10-C.sub.150) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(28) Spacer
(29) The spacer group (B), if present separates the polynucleotide from the hydrophobic group. In one embodiment the spacer is hydrophobic. In one embodiment the spacer is a saturated or unsaturated (C.sub.5-C.sub.50) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain. In one embodiment the spacer is a saturated or unsaturated (C.sub.5-C.sub.50) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(30) Linker
(31) The linker group (C), if present separates the polynucleotide from the spacer group or hydrophobic group. In one embodiment the linker is attached to the oxygen of the 5 phosphate of the polynucleotide. In one embodiment the linker is attached to the oxygen of the 3 phosphate of the polynucleotide. In one embodiment the linker is attached to the oxygen of the 3 phosphate of the polynucleotide or the 5 phosphate of the polynucleotide. The linker can be any combination of functional groups and hydrocarbon chains either alone or in combination. The linker may be a synthetic handle for which to join the polynucleotide to the spacer or hydrophobic group of the amphiphile. In one embodiment the linker group is a saturated or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain wherein one of the carbon atoms of the hydrocarbon chain is optionally replaced with an O, S or NR group and wherein one of the carbon atoms of the hydrocarbon chain is optionally substituted with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(32) It is to be understood that a saturated or unsaturated hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group provides certain functional groups, for example, but not limited to amides (C(O)NR), esters (C(O)O), ureas (NRC(O)NR), carbonates (OC(O)O), carbamates (OC(O)NR) and all thioxo and S variants thereof. These groups are the result of the one or more carbons being replaced by a group selected from O, S or NR and one or more adjacent carbons being substituted with an oxo or thioxo group. In one embodiment no O, S or NR can be adjacent to another O, S or NR group.
(33) Embodiments
(34) It is to be understood that one or more of the following embodiments may be combined and that the embodiments are for amphiphiles of formula I (nanostructures and amphiphiles) and all subformulas of formula I (e.g., formula Ia, Ib, Ic).
(35) One embodiment provides a nanostructure (e.g., a nanotube, twisted nanotape or helical nanotape) comprising a nucleic acid amphiphile of formula I which is a compound of formula Ia:
A-D Ia
or a salt thereof.
(36) One embodiment provides a nanostructure (e.g., a nanotube, twisted nanotape or helical nanotape) comprising a nucleic acid amphiphile of formula I which is a compound of formula Ib:
A-B-D Ib
or a salt thereof.
(37) One embodiment provides a nanostructure (e.g., a nanotube, twisted nanotape or helical nanotape) comprising a nucleic acid amphiphile of formula I which is a compound of formula Ic:
A-C-D Ic
or a salt thereof.
(38) One embodiment provides a nucleic acid amphiphile of formula I which is a compound of formula Ia:
A-D Ia
or a salt thereof.
(39) One embodiment provides a nucleic acid amphiphile of formula I which is a compound of formula Ib:
A-B-D Ib
or a salt thereof.
(40) One embodiment provides a nucleic acid amphiphile of formula I which is a compound of formula Ic:
A-C-D Ic
or a salt thereof.
(41) One embodiment provides a nanostructure (e.g., a nanotube, twisted nanotape or helical nanotape) comprising a nucleic acid amphiphile of formula I:
A-B-C-D I
(42) wherein:
(43) A is a saturated or unsaturated (C.sub.10-C.sub.150) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain;
(44) B is absent, or B is a spacer group wherein the spacer group is a saturated or unsaturated (C.sub.5-C.sub.50) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain;
(45) C is absent or C is a linker group wherein the linker group is a saturated or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain wherein one of the carbon atoms of the hydrocarbon chain is optionally replaced with an O, S or NR group and wherein one of the carbon atoms of the hydrocarbon is optionally substituted with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain; and
(46) D is a polynucleotide;
(47) or a salt thereof.
(48) One embodiment provides a nucleic acid amphiphile of formula I:
A-B-C-D I
(49) wherein:
(50) A is a saturated or unsaturated (C.sub.10-C.sub.150) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain;
(51) B is absent, or B is a spacer group wherein the spacer group is a saturated or unsaturated (C.sub.5-C.sub.50) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain;
(52) C is absent or C is a linker group wherein the linker group is a saturated or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain wherein one of the carbon atoms of the hydrocarbon chain is optionally replaced with an O, S or NR group and wherein one of the carbon atoms of the hydrocarbon is optionally substituted with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain; and
(53) D is a polynucleotide;
(54) or a salt thereof.
(55) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.80) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(56) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(57) In one embodiment A is a saturated or unsaturated (C.sub.30-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(58) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.80) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(59) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(60) In one embodiment A is a saturated or unsaturated (C.sub.30-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(61) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.80) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(62) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(63) In one embodiment A is a saturated or unsaturated (C.sub.30-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(64) In one embodiment A includes one or more saturated or unsaturated (C.sub.10-C.sub.22) hydrocarbon chain segments.
(65) In one embodiment A includes 1, 2, 3 or 4 saturated or unsaturated (C.sub.10-C.sub.22) hydrocarbon chain segments.
(66) In one embodiment A includes 1, 2 or 3 saturated or unsaturated (C.sub.10-C.sub.22) hydrocarbon chain segments.
(67) In one embodiment A includes for 2 saturated or unsaturated (C.sub.10-C.sub.22) hydrocarbon chain segments.
(68) In one embodiment A includes 1, 2 or 3 saturated (C.sub.12-C.sub.20) hydrocarbon chain segments.
(69) In one embodiment A includes 1 or 2 saturated (C.sub.12-C.sub.20) hydrocarbon chain segments.
(70) In one embodiment 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain of A is replaced independently with an O, S or NR group and wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain of A is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(71) In one embodiment 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain of A is replaced independently with an O, S or NR group and wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain of A substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(72) In one embodiment A has the formula:
(73) ##STR00001##
(74) wherein:
(75) each A.sup.1 is independently a saturated or unsaturated (C.sub.5-C.sub.30) hydrocarbon chain;
(76) A.sup.2 is a saturated or unsaturated (C.sub.5-C.sub.25) hydrocarbon wherein one or more of the carbon atoms of the hydrocarbon is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain; and
(77) n is 1, 2, 3 or 4.
(78) It is to be understood that each A1 can be connected to A2 at any atom of A2 (provided that the atom has the open valence to allow for the bonding of A1 to A2)
(79) In one embodiment each A.sup.1 is independently a saturated or unsaturated (C.sub.10-C.sub.30) hydrocarbon chain.
(80) In one embodiment each A.sup.1 is independently a saturated (C.sub.10-C.sub.30) hydrocarbon chain.
(81) In one embodiment each A.sup.1 is independently a saturated (C.sub.10-C.sub.25) hydrocarbon chain.
(82) In one embodiment A has the formula:
(83) ##STR00002##
(84) wherein:
(85) each A.sup.1 is independently a saturated or unsaturated (C.sub.5-C.sub.30) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain; and
(86) A.sup.2 is a saturated or unsaturated (C.sub.5-C.sub.25) hydrocarbon wherein one or more of the carbon atoms of the hydrocarbon is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain; and
(87) n is 1, 2, 3 or 4.
(88) In one embodiment each A.sup.1 is independently a saturated or unsaturated (C.sub.10-C.sub.30) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(89) In one embodiment each A.sup.1 is independently a saturated (C.sub.10-C.sub.30) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(90) In one embodiment each A.sup.1 is independently a saturated (C.sub.10-C.sub.25) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(91) In one embodiment n is 1, 2 or 3.
(92) In one embodiment n is 1 or 2.
(93) In one embodiment A.sup.2 is saturated or unsaturated (C.sub.10-C.sub.20) hydrocarbon wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(94) In one embodiment A.sup.2 is saturated (C.sub.10-C.sub.20) hydrocarbon wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(95) In one embodiment A.sup.2 is saturated (C.sub.10-C.sub.16) hydrocarbon wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(96) In one embodiment A.sup.2 is saturated (C.sub.10-C.sub.16) hydrocarbon wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain and wherein A.sup.2 is connected to B by an ester, amide, thioester or thioamide group.
(97) In one embodiment A is
(98) ##STR00003##
(99) In one embodiment
(100) ##STR00004##
is
(101) ##STR00005##
(102) In one embodiment
(103) ##STR00006##
is
(104) ##STR00007##
(105) In one embodiment: (a) B is a spacer group or (b) B is absent provided that when B is absent, the polynucleotide comprises one or more guanine nucleotides and is greater than 25 nucleotides in length.
(106) In one embodiment: (a) B is a spacer group or (b) B is absent provided that when B is absent, the polynucleotide comprises one or more guanine nucleotides and is greater than 10 nucleotides in length.
(107) In one embodiment B is a spacer group.
(108) In one embodiment B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(109) In one embodiment B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon. chain
(110) In one embodiment B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain are replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain are substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(111) In one embodiment B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(112) In one embodiment B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon. chain
(113) In one embodiment B is a saturated or unsaturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1 or 2 of the carbon atoms of the hydrocarbon chain are optionally replaced independently with an O, S or NR group and wherein 1 or 2 of the carbon atoms of the hydrocarbon chain are substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(114) In one embodiment B is
(115) ##STR00008##
(116) In one embodiment B is
(117) ##STR00009##
(118) wherein B.sup.1 is saturated or unsaturated (C.sub.5-C.sub.20) hydrocarbon chain.
(119) In one embodiment B is not a polyethylene glycol (PEG).
(120) In one embodiment C is absent.
(121) In one embodiment C is a saturated or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(122) In one embodiment C is a saturated or unsaturated (C.sub.4-C.sub.8) hydrocarbon chain.
(123) In one embodiment C is a saturated (C.sub.4-C.sub.8) hydrocarbon chain.
(124) In one embodiment C is hexyl.
(125) In one embodiment C is a saturated or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain, wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo, thioxo or hydoxyl group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(126) In one embodiment C is a saturated or unsaturated (C.sub.4-C.sub.8) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo, thioxo or hydoxyl group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(127) In one embodiment C is a saturated (C.sub.4-C.sub.8) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is optionally replaced independently with an O, S or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo, thioxo or hydoxyl group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(128) In one embodiment C is:
(129) ##STR00010##
(130) In one embodiment D is single stranded DNA
(131) In one embodiment D is single stranded RNA
(132) In one embodiment D is single stranded DNA comprising 5-50 nucleotides.
(133) In one embodiment D is single stranded RNA comprising 5-50 nucleotides.
(134) In one embodiment D is any of the polynucleotides of
(135) In one embodiment D is single stranded DNA does not include any guanine nucleotides.
(136) In one embodiment D is an aptamer.
(137) In one embodiment D is connected to the C or B of formula I at the 5 end of the polynucleotide.
(138) In one embodiment D is connected to the C or B of formula I at the 3 end of the polynucleotide.
(139) In one embodiment D is not a polynucleotide which has fractalkine binding activity
(140) In one embodiment D is not the nucleotide sequence
(141) TABLE-US-00001 (SEQIDNO:2) GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT.
(142) In one embodiment D is the nucleotide sequence
(143) TABLE-US-00002 (SEQIDNO:2) GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT
(144) In one embodiment D is not the nucleotide sequence
(145) TABLE-US-00003 (SEQIDNO:2) GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT
or a sequence having at least 80% identity to said sequence.
(146) In one embodiment D is the nucleotide sequence
(147) TABLE-US-00004 (SEQIDNO:2) GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT
or a sequence having at least 80% identity to said sequence.
(148) In one embodiment D is the nucleotide sequence
(149) TABLE-US-00005 (SEQIDNO:3) GGGGGTTCTC
or a sequence having at least 80% identity to said sequence.
(150) In one embodiment D is not the nucleotide sequence
(151) TABLE-US-00006 (SEQIDNO:2) 5-GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT-3.
(152) In one embodiment D is the nucleotide sequence
(153) TABLE-US-00007 (SEQIDNO:2) 5-GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT-3.
(154) In one embodiment D is not the nucleotide sequence
(155) TABLE-US-00008 (SEQIDNO:2) 5-GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT-3
or a sequence having at least 80% identity to said sequence.
(156) In one embodiment D is the nucleotide sequence
(157) TABLE-US-00009 (SEQIDNO:2) 5-GGGGTGGGTGGGGGGCACGTGTGGGGGCGGCCAGGGTGCT-3
or a sequence having at least 80% identity to said sequence.
(158) In one embodiment D is the nucleotide sequence
(159) TABLE-US-00010 (SEQIDNO:3) 5-GGGGGTTCTC-3
or a sequence having at least 80% identity to said sequence.
(160) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.80) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(161) In one embodiment A is a saturated or unsaturated (C.sub.20-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is independently replaced with an O, S, N or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(162) In one embodiment A is a saturated or unsaturated (C.sub.30-C.sub.70) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(163) In one embodiment 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain of A are replaced independently with an O, S, N or NR group and wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain of A is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(164) In one embodiment 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain of A are replaced independently with an O, S, N or NR group and wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain of A substituted with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(165) In one embodiment A has the formula:
(166) ##STR00011##
(167) wherein:
(168) each A.sup.1 is independently a saturated or unsaturated (C.sub.5-C.sub.30) hydrocarbon chain;
(169) A.sup.2 is a saturated or unsaturated (C.sub.5-C.sub.25) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain; and
(170) n is 1, 2, 3 or 4.
(171) In one embodiment A.sup.2 is a saturated or unsaturated (C.sub.4-C.sub.20) hydrocarbon chain wherein one or more of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NR group and wherein one or more of the carbon atoms of the hydrocarbon chain is optionally substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(172) In one embodiment A.sup.2 is a saturated (C.sub.10-C.sub.20) hydrocarbon chain wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NR group and wherein 1, 2, 3, 4, 5, 6, 7 or 8 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(173) In one embodiment A.sup.2 is a saturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon is replaced independently with an O, S, N or NR group and wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is substituted with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain.
(174) In one embodiment A.sup.2 is a saturated (C.sub.10-C.sub.16) hydrocarbon chain wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is replaced independently with an O, S, N or NR group and wherein 1, 2, 3, 4, 5 or 6 of the carbon atoms of the hydrocarbon chain is substituted independently with an oxo or thioxo group, and wherein each R is independently an H, saturated (C.sub.1-C.sub.10) hydrocarbon chain or unsaturated (C.sub.2-C.sub.10) hydrocarbon chain and wherein A.sup.2 is connected to B by an ester, amide, thioester or thioamide group.
(175) In one embodiment A is
(176) ##STR00012##
(177) In cases where nucleic acid amphiphiles are sufficiently basic or acidic, a salt of the nucleic acid amphiphiles or nanostructure can be useful as an intermediate for isolating or purifying the amphiphile or nanostructure. Additionally, administration of a nanostructure such as a nanotube comprising a nucleic acid amphiphile as a pharmaceutically acceptable acid or base salt may be appropriate. Examples of pharmaceutically acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartarate, succinate, benzoate, ascorbate, -ketoglutarate, and -glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, sulfate, nitrate, bicarbonate, and carbonate salts.
(178) Pharmaceutically acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium) salts of carboxylic acids can also be made.
(179) The nanostructures (e.g., nanotubes) described herein can be used to deliver therapeutic agents to mammals and/or the nanostructures (e.g., nanotubes) can be made to target specific biological targets in a mammal. Accordingly, it may be desirable to formulate the nanostructures (e.g., nanotubes) as pharmaceutical compositions and administered to a mammalian host, such as a human patient in a variety of forms adapted to the chosen route of administration, i.e., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.
(180) Thus, the nanostructures (e.g., nanotubes) may be systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. If the nanotube is being used to deliver a therapeutic agent (e.g., active agent) the amount of the active agent and nanotube may be varied. The amount of active agent in such therapeutically useful compositions is such that an effective dosage level will be obtained. The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices.
(181) The nanostructures (e.g., nanotubes) may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the nanotube or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
(182) The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
(183) Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.
(184) Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers.
(185) Useful dosages of the nanostructures (e.g., nanotubes) and/or therapeutic agents being delivered by the nanostructures (e.g., nanotubes) can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949.
(186) The amount of the nanostructures (e.g., nanotubes) and/or therapeutic agents being delivered by the nanotube, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.
(187) The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations
(188) The invention will now be illustrated by the following non-limiting Example.
EXAMPLE 1
(189) Materials and methods
(190) Materials
(191) Toluene, chloroform, acetone, methanol, and triethylamine were purchased from Fischer Chemical (Hanover Park, Ill.). ssDNA was purchased from Integrated DNA Technologies (Coralville, Iowa), cetyl trimethylammonium bromide from Acros Organics (Morris Plains, N.J.), and hexafluroisopropanol (HFIP) from Oakwood Products Inc (West Columbia, S.C.). All other chemicals were purchased from Sigma-Aldrich (St Louis, Mo.). Lacey Formvar/carbon, 200 mesh, copper grids were purchased from Ted Pella Inc. (Redding, Calif.) and 1.0 mm path-length quartz capillaries from Charles Supper Company (Natick, Mass.).
(192) ssDNA-amphiphile synthesis
(193) The ssDNA sequences with an amino-C.sub.6 linker attached to their 5 end were conjugated to the N-hydroxysuccinimide (NHS) activated (C.sub.16).sub.2-Glu-C.sub.2 tail (A. Mardilovich et al., Biomacromolecules, 2004, 5, 950-957) (NoSPR), or to the tails via a C.sub.12 spacer using a solution-phase synthesis as described previously (T. R. Pearce, et al., Chem. Commun., 2014, 50, 210-212) to create ssDNA-amphiphiles. Unreacted ssDNA was separated from the ssDNA-amphiphile using reverse-phase high performance liquid chromatography (HPLC). HPLC information: Zorbax C.sub.8 300 SB column, 5-90% B over 25 min, buffer A: H.sub.2O+10% methanol, 100 mM HFIP, 14.4 mM triethylamine (TEA), buffer B: methanol, 100 mM HFIP, 14.4 mM TEA. To confirm the success of the synthesis the molecular weights of the purified amphiphiles were identified by liquid chromatography-mass spectroscopy (LC-MS) (Zorbax C.sub.3 300 SB column, 50-80% B over 15 min, buffer A: H.sub.2O+15 mM ammonium acetate, buffer B: acetonitrile). Mass spectroscopy data were acquired with an Agilent MSD ion trap (
(194) ##STR00013##
Compound number: value for D
(195) TABLE-US-00011 1A:D= (SEQIDNO:4) 5-TTCTATTCTC-3 1B:D= (SEQIDNO:5) 5-CCAATTAATT-3 1C:D= (SEQIDNO:6) 5-TTCTATTCTCACATTTCATCTATTA-3 1D:D= (SEQIDNO:7) 5-TTCTATTCTCACATTTCATCTATTAAACCACCAATTAATT-3 1E:D= (SEQIDNO:3) 5-GGGGGTTCTC-3 1F:D= (SEQIDNO:8) 5-GGGGGTAATT-3 1G:D= (SEQIDNO:9) 5-GGGGGTTCTCACATTTCATCTATTA-3 1H:D= (SEQIDNO:10) 5-GGGGGTTCTCACATTTCATCTATTAAACCACCAATTAATT-3
(196) ##STR00014##
Compound: value for D
(197) TABLE-US-00012 1J:D= (SEQIDNO:4) 5-TTCTATTCTC-3 1K:D= (SEQIDNO:5) 5-CCAATTAATT-3 1L:D= (SEQIDNO:6) 5-TTCTATTCTCACATTTCATCTATTA-3 1M:D= (SEQIDNO:7) 5-TTCTATTCTCACATTTCATCTATTAAACCACCAATTAATT-3 1N:D= (SEQIDNO:3) 5-GGGGGTTCTC-3 1O:D= (SEQIDNO:8) 5-GGGGGTAATT-3 1P:D= (SEQIDNO:9) 5-GGGGGTTCTCACATTTCATCTATTA-3 1Q:D= (SEQIDNO:10) 5-GGGGGTTCTCACATTTCATCTATTAAACCACCAATTAATT-3 1S:D= (SEQIDNO:11) 5-GGGTGGGTGGGTATTTCATCTATTA-3 1T:D= (SEQIDNO:12) 5-GGGTGGGTGGGTATTTCATCTATTAAACCACCAATTAATT-3
Scheme 3A shows the chemical steps used to prepare compounds described herein.
(198) ##STR00015## ##STR00016##
(199) Glutamic acid and p-toluenesulfonate (1.2 molar excess) were first mixed in toluene and refluxed for 1 h at 130 C. Then alcohol (hexadecanol, octadecanol or eicosanol) (2.2 molar excess) was added. The mixture was heated until an equimolar amount of water was recovered in a Dean-Stark trap. The toluene was removed and the product 1 recrystallized from acetone three times. Then 1 was dissolved in CHCl.sub.3/THF (50/50%, v/v) at 50 C. and 15% molar excess of succinic anhydride and 50% molar excess of N,N-diisopropylethylamine (DIEA) were added. After 6 h, the solvents were evaporated and the product 2 was recrystallized from ethyl acetate. Then N-hydroxysuccinimide (NHS, 1.5 molar excess) was added to a solution of 2 in dichloromethane (DCM) at room temperature. After cooling to 0 C., N,N-dicyclohexylcarbodiimide (DCC, 2 molar excess) was added. The solution was stirred for 1 h at 0 C. and then overnight at room temperature. The precipitated dicyclohexyl urea (DCU) was filtered off, and solvent was removed in vacuum. The product 3 was recrystallized from ethyl acetate. The NHS-activated 3 was then reacted with excess spacer, for example C.sub.12, (1.5 molar excess) in methanol for 6 h at 50 C. Then methanol was removed and DCM was added to dissolve the product 4. The excess spacer (didn't dissolve in DCM) was removed by filtration. DCM was then evaporated and the product 4 was recrystallized from ethyl acetate. As a last step, 4 was activated by NHS to obtain the product 5.
(200) To link the activated tails with the ssDNA, 1.5 molar excess cetyl trimethylammonium bromide (CTAB) dissolved in water was added to the ssDNA. The ammonium (NH.sub.4.sup.+) moiety of CTAB is electrostatically attracted to the PO.sub.4.sup. of the ssDNA backbone, which renders the ssDNA soluble in dimethylformamide (DMF). A 10 molar excess of activated tails 5 and trace triethylamine (TEA) were added to the CTAB-ssDNA complexes dissolved in DMF and the reaction was stirred at 50 C. for 24 h. After 24 h, the DMF was removed by evaporation and the ssDNA-amphiphiles and any unreacted ssDNA were purified by ethanol precipitation to remove unreacted tails and CTAB. Finally ssDNA-amphiphile 6 was purified by reverse-phase high performance liquid chromatography (RP-HPLC).
(201) Scheme 3B shows the chemical steps used to prepare compounds described herein.
(202) ##STR00017##
(203) Glutamic acid and p-toluenesulfonate (1.2 molar excess) were first mixed in toluene and refluxed for 1 h at 130 C. Then alcohol (hexadecanol, octadecanol or eicosanol) (2.2 molar excess) was added. The mixture was heated until an equimolar amount of water was recovered in a Dean-Stark trap. The toluene was removed and the product 1 recrystallized from acetone three times. Then 1 was dissolved in CHCl.sub.3/THF (50/50%, v/v) at 50 C. and 15% molar excess of succinic anhydride and 50% molar excess of N,N-diisopropylethylamine (DIEA) were added. After 6 h, the solvents were evaporated and the product 2 was recrystallized from ethyl acetate. Then N-hydroxysuccinimide (NHS, 1.5 molar excess) was added to a solution of 2 in dichloromethane (DCM) at room temperature. After cooling to 0 C., N,N-dicyclohexylcarbodiimide (DCC, 2 molar excess) was added. The solution was stirred for 1 h at 0 C. and then overnight at room temperature. The precipitated dicyclohexyl urea (DCU) was filtered off, and solvent was removed in vacuum. The product 3 was recrystallized from ethyl acetate.
(204) To link the activated tails with the ssDNA, 1.5 molar excess cetyl trimethylammonium bromide (CTAB) dissolved in water was added to the ssDNA. The ammonium (NH.sub.4.sup.+) moiety of CTAB is electrostatically attracted to the PO.sub.4.sup. of the ssDNA backbone, which renders the ssDNA soluble in dimethylformamide (DMF). A 10 molar excess of activated tails 3 and trace triethylamine (TEA) were added to the CTAB-ssDNA complexes dissolved in DMF and the reaction was stirred at 50 C. for 24 h. After 24 h, the DMF was removed by evaporation and the ssDNA-amphiphiles and any unreacted ssDNA were purified by ethanol precipitation to remove unreacted tails and CTAB. Finally ssDNA-amphiphile 4 was purified by reverse-phase high performance liquid chromatography (RP-HPLC).
(205) Cryogenic transmission electron microscopy (cryo-TEM)
(206) 4.5 L of 500 M amphiphile solutions were deposited onto lacey Formvar/carbon copper grids that had been treated with glow discharge for 60 sec and vitrified in liquid ethane by Vitrobot (Vitrobot parameters: 4 sec blot time, 0 offset, 3 sec wait time, 3 sec relax time, ambient humidity). The grids were kept under liquid nitrogen until they were transferred to a Tecnai G2 Spirit TWIN 20-120 kV/LaB6 TEM operated with an acceleration voltage of 120 keV. Images were captured using an Eagle 2 k CCD camera.
(207) Circular dichroism (CD)
(208) 500 M solutions of ssDNA-amphiphiles were diluted to 20 M with Milli-Q water and transferred to a 0.1 cm path length cuvette. CD spectra from 320-200 nm were collected using a Jasco J-815 spectrapolarimeter using a read speed of 50 nm/min in 1 nm steps. 3 accumulations per amphiphile solution were recorded with the background spectrum from the water automatically subtracted. The accumulations were averaged and the raw ellipticity values were converted to molar ellipticity.
(209) Results
(210) ssDNA-amphiphile synthesis
(211) An initial ssDNA headgroup 40 nucleotides in length was created using only adenine (A), cytosine (C), and thymine (T) nucleobases selected at random. This guanine-free (NoG) 40 nucleotide headgroup was then used to create headgroups with 10 and 25 nucleotides that conserved the nucleotide order at the 5 end of the headgroup (
(212) Self-assembly of ssDNA-amphiphiles with NoG headgroups and with or without a C.sub.12 spacer
(213) Amphiphiles with NoG headgroups attached to the hydrophobic tails via C.sub.12 spacers were dissolved in Milli-Q water to form 500 M solutions and were immediately (<30 min) deposited onto cryo-TEM grids, vitrified in liquid ethane, and imaged to visualize the morphology of the self-assembled structures formed by the amphiphiles. A variety of structures were present in each of the amphiphile solutions with either a 10, 25 or 40 nucleotide NoG headgroup: globular micelles, twisted nanotapes, helical nanotapes, and nanotubes (
(214) The cylindrical nanotube structures observed in the samples with headgroups containing 10 nucleotides had an overall average diameter of 304 nm, while samples with the 25 and 40 nucleotide headgroups produced structures with average diameters of 323 nm and 311 nm, respectively. While the overall average diameters of the nanotubes produced by amphiphiles of different headgroup lengths were similar, the diameters of the nanotubes vary between different nanotubes in the same sample, and in some cases there was also variation along the length of a single nanotube. The lengths of the nanotubes formed by amphiphiles containing the 10, 25, and 40 nucleotide headgroups were variable, with each sample producing nanotubes 100s to 1,000s of nm in length and no apparent difference in the typical length between amphiphiles with different headgroups.
(215) Twisted and helical nanotapes were also observed in all the samples, but in lower numbers than the nanotubes. The majority of the twisted nanotapes in each of the different amphiphile samples did not twist in a periodic manner and had widths ranging from 20 to 50 nm. However, in a few instances the twisted nanotapes were observed to twist in a periodic manner with an average pitch length of 1326 nm and an average width of 242 nm. The helical nanotapes observed in each of the different amphiphile samples displayed clear periodicity with an average pitch length of 1297 nm, similar to that observed in the twisted nanotape structures. However, the average width of the helical nanotapes was 384 nm, substantially larger than that of the regularly twisted nanotapes. Also present in all of the samples were globular micelles, some of which were spherical and some were weakly ellipsoidal. Micelles formed by each of the amphiphile samples had diameters (or ellipsoid axes lengths) of 9-20 nm with no measurable difference in average size between the amphiphiles with different length headgroups.
(216) The same NoG headgroups were also conjugated directly to hydrophobic tails without the use of the C.sub.12 spacer and imaged with cryo-TEM. These amphiphiles also formed micelles but were not observed to form any of the larger, more complex, bilayer nanotape and nanotube structures (Table 1). The inability for amphiphiles with NoG headgroups and lacking the C.sub.12 spacer to form more complex bilayer structures was not surprising as it has been previously shown that amphiphiles with headgroups of similar lengths that lack G-quadruplex interactions only assemble into globular micelles T. R. Pearce, et al., Chem. Commun., 2014, 50, 210-212; B. Waybrant, et al., Langmuir, 2014, DOI: 10.1021/la500403v; H. Liu, et al., Chem. Eur. J., 2010, 16, 3791-3797).
(217) Self-assembly of ssDNA-amphiphiles with guanine-modified headgroups and without a C.sub.12 spacer
(218) To test if the presence of guanines positioned immediately adjacent to the site of conjugation to the hydrophobic tail could produce nanotape and nanotube structures in the absence of the C.sub.12 spacer a third set of amphiphiles was created that included the G.sub.5 modification in the 10, 25, and 40 nucleotide ssDNA headgroups, with the headgroups directly linked to the hydrophobic tails (as shown in
(219) TABLE-US-00013 TABLE 1 A summary of the structures observed with cryo-TEM in each of the ssDNA-amphiphile samples shown in FIG. 1. Twisted Helical Nano- Sample nanotape nanotape tube Compound 1A, 1B (10 nt NoG C.sub.12) Yes Yes Yes Compound 1C (25 nt NoG C.sub.12) Yes Yes Yes Compound 1D (40 nt NoG C.sub.12) Yes Yes Yes Compound 1E, 1F (10 nt G.sub.5 C.sub.12) Yes Yes Yes.sup.a Compound 1G (25 nt G.sub.5 C.sub.12) Yes Yes Yes Compound 1H (40 nt G.sub.5 C.sub.12) Yes Yes Yes Compound 1J, 1K (10 nt NoG NoSPR) No No No Compound 1L (25 nt NoG NoSPR) No No No Compound 1M (40 nt NoG NoSPR) No No No Compound 1N, 1O (10 nt G.sub.5 NoSPR) No No No Compound 1P (25 nt G.sub.5 NoSPR) No No No Compound 1Q (40 nt G.sub.5 NoSPR) Yes.sup.b Yes.sup.b Yes.sup.b Compound 1S (25 nt (GGGT).sub.3 Yes.sup.b No No (SEQ ID NO: 1) NoSPR) Compound 1T (40 nt (GGGT).sub.3 Yes.sup.b No No (SEQ ID NO: 1) NoSPR) .sup.aNanotubes were substantially shorter in this sample than in all others. .sup.bStructures were observed infrequently.
(220) CD was performed on the 40 nucleotide G.sub.5 amphiphiles to probe for the presence of G-quadruplex formation within the headgroups of these amphiphiles. Parallel G-quadruplex structures are tertiary DNA structures formed by the stacking of G-quartet structures, with each G-quartet formed by four guanine nucleotides arranged in a planar, square geometry held together by Hoogsteen hydrogen bonding. These unique structures are stabilized by small cations that fit within the G-quartet structure but can also be formed in pure water (E. W. Choi, et al., Nucleic Acids Res., 2010, 38, 1623-1635) and produce a characteristic CD spectrum with a strong positive peak between 258-265 nm (J. Kypr, et al., Nucleic Acids Res., 2009, 37, 1713-1725; D. M. Gray, et al., Chirality, 2008, 20, 431-440). With only five guanines a single headgroup could not form a G-quadruplex with itself but it could form an intermolecular parallel G-quadruplex by interacting with three adjacent headgroups (A. Rajendran, et al., Nucleic Acids Res., 2013, 41, 8738-8747). However, contrary to the hypothesis, the CD spectrum of the 40 nucleotide G.sub.5 amphiphiles had a maximum at 270 nm, suggesting that there were not significant G-quadruplex interactions occurring between the amphiphiles' headgroups (
(221) In order to enhance the probability that the ssDNA headgroups would form parallel G-quadruplexes and to test the effect of G-quadruplex interaction on the self-assembly of ssDNA-amphiphiles, two additional headgroups were created from the random guanine-free 25 and 40 nucleotide headgroups. These headgroups had the first 12 nucleotides of the original sequences replaced with the sequence (GGGT).sub.3(SEQ ID NO: 1), as shown in
(222) Self-assembly of ssDNA-amphiphiles with G.sub.5-modified headgroups and a C.sub.12 spacer
(223) Another test of the influence of the guanine-modification of the headgroups, amphiphiles that contained both the G.sub.5-modified headgroups and the C.sub.12 spacers were created and their assembly was compared to that of the amphiphiles with the C.sub.12 spacer but NoG headgroups. There were no apparent differences in the assembly behaviour of amphiphiles containing the G.sub.5 and the NoG headgroups with 25 and 40 nucleotides, as each formed twisted and helical nanotapes and nanotubes. However, there was a dramatic difference in the nanotubes formed by the amphiphiles with headgroups containing only 10 nucleotides. Both amphiphile samples produced nanotubes with similar average diameters (NoG: 29.03.6 nm; G.sub.5: 32.51.3 nm), but amphiphiles with the NoG headgroup produced nanotubes that were microns in length while amphiphiles formed with the G.sub.5 headgroup produced nanotubes that were nearly two orders of magnitude shorter and varied between 60 and 350 nm (
(224) CD was performed on the amphiphiles with C.sub.12 spacers for each length of headgroup to determine the effect of the G.sub.5 sequence on the secondary structure of the ssDNA headgroup. The CD spectra of the amphiphiles with the C.sub.12 spacer and G.sub.5-modified headgroups with 25 and 40 nucleotides had maxima near 270 nm (
(225) Transitions between twisted nanotapes, helical nanotapes and nanotubes
(226) Cryo-TEM images of the ssDNA-amphiphile nanostructures showed twisted nanotapes, helical nanotapes and nanotubes and also captured the transition from twisted to helical nanotape as well as from helical nanotape to nanotube (
(227) Discussion
(228) Three building blocks were used to create ssDNA-amphiphiles: a hydrophobic tail (hydrophobic group), a hydrophilic ssDNA headgroup, and a spacer molecule that links the tail and the headgroup. The major driving force for the assembly of the ssDNA-amphiphiles is the hydrophobic force provided by the dialkyl tails. Previous studies have found that the inclusion of a hydrophobic spacer is important for the assembly of the ssDNA-amphiphiles into flat or twisted nanotapes (T. R. Pearce, et al., Chem. Commun., 2014, 50, 210-212; B. Waybrant, et al., Langmuir, 2014, DOI: 10.1021/la500403v). Efforts described herein studied the influence of the headgroup length on the self-assembly behaviour of ssDNA-amphiphiles created with the same dialkyl C.sub.16 tails and C.sub.12 spacers. Data provided herein demonstrated that ssDNA-amphiphiles with C.sub.12 spacers and NoG headgroups of 10, 25, or 40 nucleotides not only produced the twisted nanotapes previously seen, but also helical nanotapes and nanotubes. Each of these structures is formed from bilayers of amphiphiles and the hydrophobic tails organized into an interior core with the ssDNA headgroups forming an exterior shell (
(229) Similar nanotape and nanotube structures have been observed in solutions of different amphiphilic molecules including glycolipids, peptide-amphiphiles, and bolaamphiphiles (A. S. Cuvier, et al., Soft Matter, 2014, 10, 3950-3959; E. T. Pashuck et al., J. Am. Chem. Soc., 2010, 132, 8819-8821, H. Shao, et al., Angew. Chem. Int. Ed., 2010, 49, 7688-7691, A. Sorrenti, et al., Chem. Soc. Rev., 2013, 42, 8200-8219). In each case the nanotape and nanotube structures were created from bilayers of amphiphiles, with the hydrophobic moieties sequestered into an inner layer and surrounded with the hydrophilic headgroups to form the exterior of the nanostructure. The chirality of the individual amphiphile requires that the amphiphiles organize with their neighbouring molecules at non-zero angles, generating a preferred orientation of each amphiphile tail and headgroup within the self-assembled bilayer, which induces twisting (A. Sorrenti, et al., Chem. Soc. Rev., 2013, 42, 8200-8219). The ssDNA-amphiphiles described herein are rich in chirality, with chiral centers in the hydrophobic tails as well as the nucleotides of the ssDNA headgroups. As such, it is possible that the chirality of the individual ssDNA-amphiphile is responsible for producing the twisting that was observed in the ssDNA-amphiphile nanotapes.
(230) The ability for self-assembled structures to transition from a twisted nanotape morphology to a helical nanotape morphology has been captured and described in a number of publications (E. T. Pashuck et al., J. Am. Chem. Soc., 2010, 132, 8819-8821; A. Sorrenti, et al., Chem. Soc. Rev., 2013, 42, 8200-8219; L. Ziserman, et al., J. Am. Chem. Soc., 2011, 133, 2511-2517; L. Ziserman, et al., Phys. Rev. Lett, 2011, 106, 238105, Z. Chen, et al., Appl. Phys. Lett., 2011, 98, 011906, A. Perino, et al., Langmuir, 2011, 27, 12149-12155). For example, a peptide-amphiphile that contained three phenylalanine residues that were capable of intermolecular - stacking was observed to form short twisted bilayer nanotapes 30 sec after dissolution in water (E. T. Pashuck et al., J. Am. Chem. Soc., 2010, 132, 8819-8821). These short structures grew into long twisted nanotapes within ten minutes, that coexisted with helical tapes after two weeks and transitioned entirely to helical tapes after four weeks. Similarly, single amino acid amphiphiles dissolved in water were found to form twisted nanotapes after 24 h, a mixture of twisted and helical nanotapes after one week, which were almost entirely helical after four weeks, and finally transitioned into nanotubes between one and four months L. (Ziserman, et al., J. Am. Chem. Soc., 2011, 133, 2511-2517).
(231) These and other reports propose that the transition from a twisted to helical bilayer nanotape morphology requires a change in membrane curvature from Gaussian (saddle-like) to cylindrical, an event that is often attributed to a rearrangement of the individual amphiphiles into a molecular organization that is more ordered or crystalline (E. T. Pashuck et al., J. Am. Chem. Soc., 2010, 132, 8819-8821, H. Shao, et al., Angew. Chem. Int. Ed., 2010, 49, 7688-7691, J. V. Selinger, et al., J. Phys. Chem. B, 2001, 105, 7157-7169, M. S. Spector, et al., Nano Lett., 2001, 1, 375-378)..sup.18,19,25,26 The forces that are often identified as causing the order or crystallinity are hydrogen-bonding and - stacking between individual amphiphiles although electrostatic and hydrophobic forces are also likely important (E. T. Pashuck et al., J. Am. Chem. Soc., 2010, 132, 8819-8821; L. Ziserman, et al., J. Am. Chem. Soc., 2011, 133, 2511-2517). The C.sub.12 spacer has previously been found to play an important role in producing the bilayer nanotapes, possibly by forcing the aptamer headgroups into close proximity of each other, thus reducing their interfacial headgroup area, which allows the nanotapes to form (T. R. Pearce, et al., Chem. Commun., 2014, 50, 210-212; B. Waybrant, et al., Langmuir, 2014, DOI: 10.1021/la500403v). The C.sub.12 spacer may also be helping to ensure that the amphiphiles can organize into crystalline or well-ordered bilayers by extending the large ssDNA headgroups away from the interface and relieving some of the electrostatic or steric constraints that could impede close and ordered packing of the amphiphiles. This may be especially important in the case of the NoG headgroups that do not appear to interact with each other.
(232) Hydrogen bonding can occur between guanine nucleobases and produce the G-quartet structures that can stack into G-quadruplexes. For this reason it was investigated whether guanine-rich headgroups that can form parallel G-quadruplexes could be used in place of the C.sub.12 spacer to produce nanotapes and nanotubes. Amphiphiles with the (GGGT).sub.3 (SEQ ID NO: 1) headgroups 25 and 40 nucleotides in length and without the C.sub.12 spacer were found to assemble into twisted nanotapes but did not appear to progress into helical nanotapes or nanotubes while amphiphiles without either the (GGGT).sub.3 sequence (SEQ ID NO: 1) or the C.sub.12 spacer formed only micelles. This result suggests that the additional force produced by the hydrogen bonding of the parallel G-quadruplex structure was important to the formation of the bilayer nanotape structure but was unable to induce the change in membrane curvature required to transition into helical nanotapes and nanotubes.
(233) The literature offers insight into the transition from twisted to helical nanotapes and from helical nanotapes to nanotubes. Recent theoretical and experimental work shows that the width of the nanotape is a critical parameter in determining the morphology of the nanotape (L. Ziserman, et al., J. Am. Chem. Soc., 2011, 133, 2511-2517; L. Ziserman, et al., Phys. Rev. Lett., 2011, 106, 238105; S. Armon, et al., Soft Matter, 2014, 10, 2733-2740). Specifically, as the bilayer grows in width it becomes energetically favorable for the bilayer to transition from Gaussian to cylindrical curvature, thus producing the transition from a twisted to helical morphology. Theoretical studies also pointed out that shape selection in self-assembled chiral molecules may involve a geometrical frustration, and thus a competition between bending and stretching (S. Armon, et al., Soft Matter, 2014, 10, 2733-2740; R. Ghafouri, et al., Phys. Rev. Lett., 2005, 94, 138101). The transition from twisted to helical ribbons (or nanotapes) to nanotubes has been described by two competing theories: a closing-pitch model and a growing width model (T. Shimizu, et al., Chem. Rev., 2005, 105, 1401-1443). The closing-pitch model assumes that a helical nanotape maintains its width while the pitch shortens until the edges of the nanotape meet to form a nanotube while the growing width model assumes the pitch remains constant and the nanotape widens until a closed nanotube is formed. An alternate possibility is that some of the twisted and helical nanotapes are at equilibrium and never transition into nanotubes as observed previously in other amphiphilic systems..sup.30
(234) Analysis of cryo-TEM images that captured the transition from twisted nanotapes into helical nanotapes, like those shown in
(235) Conclusion
(236) ssDNA-amphiphiles containing a random nucleic acid headgroup can adopt a variety of self-assembled structures including twisted and helical bilayer nanotapes and nanotubes. These structures are substantially more complex than spherical and cylindrical micelles observed by others in the literature. The ability to create DNA nanotubes from ssDNA-amphiphiles is particularly important, as nanotubes have been utilized for targeted drug delivery of small molecules and siRNA, as templates for nanowires and as tracks for molecular motors. For many of these applications there is no need for the complex designs made possible by other DNA nanotechnology approaches that rely entirely on DNA base pairing. ssDNA-amphiphile assembly into nanotubes occurs rapidly via the association of the hydrophobic tails and does not require stringent annealing conditions as demonstrated by the nanotube formation minutes after amphiphile dissolution in water. Furthermore, DNA nanotubes were formed using ssDNA sequences of different lengths and nucleic acid sequences, and the addition of a guanine-rich sequence in the headgroup was found to be capable of modifying the assembly, all of which demonstrate the versatility of the amphiphile-based self-assembly strategy for forming DNA nanostructures.
EXAMPLE 2
(237) Amphiphiles (compounds 2A-2D and 3A) that contain G-enriched and C-enriched ssDNA sequences were prepared in the manner described in Example 1 and are shown in Scheme 4 and Scheme 5. These compounds all formed nanotubes.
(238) ##STR00018##
Compound number: value for D (observed ms)
(239) TABLE-US-00014 Compound1E:D= (SEQIDNO:3) 5-GGGGGTTCTC-3 (4128.3) Compound2A:D= (SEQIDNO:13) 5-GGGTGGGTGGGTGGGTCATCTATTA-3 (8896.0) Compound2B:D= (SEQIDNO:14) 5-GGTGGTGGTGGTATTTCATCTATTA-3 (8803.3) Compound2C:D= (SEQIDNO:15) 5-GGGTGGGTGGGTGGGTCATCTATTAAACCACCAATTAATT-3 (13461.0) Compound2D:D= (SEQIDNO:16) 5-CCCTATTCCCAGATCCCATTACCC-3 (8185.0).
(240) ##STR00019##
Compound number: value for D (observed ms)
(241) TABLE-US-00015 Compound3A:D= (SEQIDNO:16) 5-CCCTATTCCCAGATCCCATTACCC-3 (7987.5)
(242) It has been discovered that amphiphiles that contain G-enriched (which G sequences can from G-quadruplexes) and C-enriched (which C sequences can from i-motifs) ssDNA sequences promote the formation of nanotubes including shorter nanotubes. It has also been discovered that G-enriched and C-enriched ssDNA sequences can form nanotubes and nanotapes in the absence of a spacer (i.e., in the absence of moiety B of the compounds of formula I).
(243) In one embodiment D comprises greater than 5% G nucleotides. In one embodiment D comprises greater than 8% G nucleotides. In one embodiment D comprises greater than 10% G nucleotides. In one embodiment D comprises greater than 30% G nucleotides. In one embodiment D comprises greater than 40% G nucleotides. In one embodiment D comprises greater than 50 G nucleotides. In one embodiment D comprises greater than 60% G nucleotides.
(244) In one embodiment D comprises greater than 5% C nucleotides. In one embodiment D comprises greater than 8% C nucleotides. In one embodiment C comprises greater than 10% G nucleotides. In one embodiment C comprises greater than 30% G nucleotides. In one embodiment D comprises greater than 40% G nucleotides. In one embodiment C comprises greater than 50% G nucleotides. In one embodiment D comprises greater than 60% G nucleotides.
EXAMPLE 3
(245) An amphiphile (compound 4A) that contains a longer hydrophobic (lipophilic) group or tail (e.g., hydrocarbon chain) was prepared in the manner described in Example 1 and is shown in Scheme 6. Nanotubes prepared from compound 4A appear to have a greater diameter than the corresponding compound that has a 16 carbon hydrophobic group as demonstrated by TEMs (room temperature). Thus, varying the hydrophobic group of the amphiphiles may be a viable method to control the diameter of the resultant nanotubes.
(246) ##STR00020##
Compound number: value for D (observed ms)
(247) TABLE-US-00016 Compound4A:D= (SEQIDNO:3) 5-GGGGGTTCTC-3 (4185.3)
EXAMPLE 4
(248) Amphiphiles (compounds 5A-5B; shown in Scheme 8) that contain a different hydrophobic (lipophilic) group or tail (e.g., hydrocarbon chain) were prepared as described in Scheme 7.
(249) ##STR00021##
(250) First dioctadecylamine was dissolved in CHCl.sub.3/THF (50%/50%, v/v) at 50 C. Then 15% molar excess of succinic anhydride and 50% molar excess of N,N-diisopropylethylamine (DIEA) were added. After 6 h, the solvents were evaporated and the product 1 was recrystallized from ethyl acetate. Then N-hydroxysuccinimide (NHS, 1.5 molar excess) was added to a solution of 1 in dichloromethane (DCM) at room temperature. After cooling to 0 C., N,N-dicyclohexylcarbodiimide (DCC, 2 molar excess) was added. The solution was stirred for 1 h at 0 C. and then overnight at room temperature. The precipitated dicyclohexyl urea (DCU) was filtered off and the solvent was removed in vacuum. The product 2 was recrystallized from ethyl acetate. The NHS-activated 3 was then reacted with excess spacer, for example C.sub.12, (1.5 molar excess) in methanol for 6 hr at 50 C. Then methanol was removed and DCM was added to dissolve the product 3. The excess spacer (didn't dissolve in DCM) was removed by filtration. DCM was then evaporated and the product 3 was recrystallized from ethyl acetate. As a last step, 3 was activated by NHS to obtain the product 4 ((C.sub.18).sub.2-C.sub.12-NHS). The conjugation of the ssDNA to 4 is similar to the synthesis of the ssDNA-amphiphiles with glutamic acid. The product 5 was purified by RP-HPLC.
(251) ##STR00022##
Compound number: value for D (observed ms)
(252) TABLE-US-00017 Compound5A:D= (SEQIDNO:3) 5-GGGGGTTCTC-3 (MassSpec:4054.6) Compound5B:D= (SEQIDNO:4) 5-TTCTATTCTC-3 (MassSpec:3925.3)
(253) All publications, patents and patent applications cited herein are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.
(254) The use of the terms a and an and the and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
(255) Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.