USE OF (BENZENESULFONAMIDO)BENZAMIDE COMPOUNDS FOR INHIBITING LIVER FIBROSIS
20190274979 ยท 2019-09-12
Assignee
- Hebei Medfaith Pharmaceutical Technology Co., Ltd. (Shijiazhuang, CN)
- Institute of Medicinal Biotechnology Chinese Academy of Medical Sciences (Beijing, CN)
Inventors
- Hongwei Tian (Shenyang, CN)
- Xingang Wang (Shenyang, CN)
- Rongguang Shao (Beijing, CN)
- Yucheng WANG (Beijing, CN)
- Naren Li (Beijing, CN)
- Shi-Ying Cai (Cheshire, CT, US)
- Hongwei He (Beijing, CN)
- Juxian Wang (Beijing, CN)
- Shuangshuang Zhao (Beijing, CN)
- Maoxu Ge (Beijing, CN)
- Jinfeng Ren (Beijing, CN)
Cpc classification
A61K31/63
HUMAN NECESSITIES
A61K31/235
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
A61P1/16
HUMAN NECESSITIES
A61K31/63
HUMAN NECESSITIES
Abstract
The invention belongs to the technical field of medicines. In particular, the invention relates to use of (benzenesulfonamido) benzamide compounds for inhibiting liver fibrosis, or preventing and/or treating a liver injury, or improving a liver function, or preventing and/or treating a liver disease associated with liver fibrosis, for modulating (e.g. reducing) the content of collagen (e.g. type I collagen) in liver tissue, for modulating (e.g. inhibiting) the activity of COL1A1 promoter in a cell, and for modulating (e.g. inhibiting) expression level of a gene associated with liver fibrosis in a cell.
Claims
1. Use of a compound of Formula (I) for inhibiting liver fibrosis, or preventing and/or treating a liver injury, or improving a liver function, or preventing and/or treating a liver disease associated with liver fibrosis, or for manufacture of a medicament for inhibiting liver fibrosis, or preventing and/or treating a liver injury, or improving a liver function, or preventing and/or treating a liver disease associated with liver fibrosis; ##STR00062## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00063## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(haloC.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously.
2. The use according to claim 1, wherein in Ring A, R.sub.1 is at the ortho-, meta- or para-position of SO.sub.2; preferably, R.sub.1 is at the meta- or para-position of SO.sub.2; more preferably, R.sub.1 is at the meta-position of SO.sub.2.
3. The use according to claim 1 or 2, wherein R.sub.1 is selected from the group consisting of OCH.sub.3, OCH.sub.2CH.sub.3, halogen (e.g. F, Cl, Br or I), NHCOCH.sub.3, NHCOCH.sub.2CH.sub.3, CONHCH.sub.3, CONHCH.sub.2CH.sub.3, OCF.sub.3 and NO.sub.2; preferably, R.sub.1 is selected from the group consisting of OCH.sub.3, F, Cl, NHCOCH.sub.3, CONHCH.sub.3, OCF.sub.3 and NO.sub.2; preferably, R.sub.1 is selected from the group consisting of OCH.sub.3, F, NHCOCH.sub.3, OCF.sub.3 and NO.sub.2; preferably, R.sub.1 is OCF.sub.3 or NO.sub.2.
4. The use according to any one of claims 1-3, wherein in Ring B, Z is at the ortho-, meta- or para-position of NH; preferably, Z is at the ortho- or meta-position of NH; more preferably, Z is at the ortho-position of NH.
5. the use according to any one of claims 1-4, wherein Z is ##STR00064## R.sub.2, R.sub.3, and R.sub.4 are each independently selected from the group consisting of H, OCH.sub.3, OCH.sub.2CH.sub.3, halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.2alkyl, O-(halo-C.sub.1-C.sub.2alkyl), CH.sub.3, CH.sub.2CH.sub.3and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, OCH.sub.3, OCH.sub.2CH.sub.3, halogen (e.g. F, Cl, Br and I), fluoro-C.sub.1-C.sub.2alkyl, O-(fluoro-C.sub.1-C.sub.2alkyl), CH.sub.3; CH.sub.2CH.sub.3 and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, OCH.sub.3, F, Cl, CF.sub.3, OCF.sub.2H and CH.sub.3; preferably, R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, F, Cl, CF.sub.3, OCF.sub.3, OCF.sub.2H and CH.sub.3; preferably, R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, F, Cl and OCF.sub.2H; preferably, R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H and Cl.
6. The use according to any one of claims 1-5, wherein the compound has the structure of Formula (II): ##STR00065## wherein R.sub.1 is at the meta- or para-position of SO.sub.2; R.sub.1 is OCH.sub.3, F, NHCOCH.sub.3, OCF.sub.3 or NO.sub.2; R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, F, Cl and OCF.sub.2H, and, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously.
7. The use according to claim 6, wherein R.sub.1 is at the meta-position of SO.sub.2; preferably, R.sub.1 is OCF.sub.3 or NO.sub.2; preferably, R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H and Cl.
8. The use according to any one of claims 1-4, wherein Z is COOCH.sub.3; preferably, in Ring A, R.sub.1 is at the meta- or para-position of SO.sub.2; preferably, R.sub.1 is NO.sub.2; preferably, in Ring B, Z is at the ortho-position of NH.
9. the use according to any one of claims 1-8, wherein the compound is selected from: ##STR00066## ##STR00067## ##STR00068## ##STR00069## ##STR00070##
10. the use according to any one of claims 1-9, wherein the liver fibrosis is caused by a liver injury.
11. The use according to any one of claims 1-10, wherein the liver injury is an acute liver injury or a chronic liver injury; and/or the liver injury is selected from the group consisting of a violence-caused liver injury (e.g. an open liver injury, a closed liver injury), a drug-induced liver injury, a toxic liver injury and a pathological liver injury (e.g. a liver injury caused by viral hepatitis, liver cancer or an autoimmune disease).
12. The use according to any one of claims 1-11, wherein the liver disease associated with liver fibrosis is selected from the group consisting of : viral hepatitis (e.g. Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis E, fatty liver, an autoimmune liver disease, a drug-induced liver disease, toxic hepatopathy and liver cancer.
13. Use of a compound of Formula (I) for modulating (e.g. reducing) the content of collagen (e.g. type I collagen) in liver tissue, or for manufacture of a medicament for modulating (e.g. reducing) the content of collagen (e.g. type I collagen) in liver tissue; ##STR00071## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00072## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(haloC.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously; preferably, the compound is as defined in any one of claims 2-9.
14. Use of a compound of Formula (I) for modulating (e.g. inhibiting) the activity of COL1A1 promoter in a cell, or for manufacture of an agent for modulating (e.g. inhibiting) the activity of COL1A1 promotor in a cell; ##STR00073## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00074## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously; preferably, the COL1A1 promoter has a sequence set forth in SEQ ID NO: 1; preferably, the cell is a collagen-producing cell, such as a hepatic stellate cell, a hepatic sinusoidal endothelial cell, a biliary epithelial cell, a fibroblast or an osteoblast; preferably, the compound is as defined in any one of claims 2-9.
15. Use of a compound of Formula ( I) for modulating (e.g. inhibiting) expression level of a gene associated with liver fibrosis, or for manufacture of an agent for modulating (e.g. inhibiting) expression level of a gene associated with liver fibrosis in a cell; ##STR00075## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00076## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously; preferably, the gene associated with liver fibrosis is selected from the group consisting of COL1A1 gene, TGF-1 gene, MMP2 gene, -SMA gene, TIMP1 gene, TIMP2 gene, SPP1 gene and any combination thereof; preferably, the compound is as defined in any one of claims 2-9.
16. A method for inhibiting liver fibrosis, or preventing and/or treating a liver injury, or improving a liver function, or preventing and/or treating a liver disease associated with liver fibrosis in a subject, comprising administering an effective amount of a compound of Formula (I) to a subject in need thereof; ##STR00077## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00078## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously; preferably, the liver fibrosis is caused by a liver injury; preferably, the liver injury is an acute liver injury or a chronic liver injury; preferably, the liver injury is selected from the group consisting of a violence-caused liver injury (e.g. an open liver injury, a closed liver injury), a drug-induced liver injury, a toxic liver injury and a pathological liver injury (e.g. a liver injury caused by viral hepatitis, liver cancer or an autoimmune disease); preferably, the liver disease associated with liver fibrosis is selected from the group consisting of: viral hepatitis (e.g. Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis E), fatty liver, an autoimmune liver disease, drug-induced liver disease, toxic hepatopathy and liver cancer; preferably, the subject is a mammal, such as a bovine, an equine, a caprid, a suidae, a canine, a feline, a rodent or a primate; preferably, the subject is a human; preferably, the compound is as defined in any one of claims 2-9.
17. A method for modulating (e.g. reducing) the content of collagen (e.g. type I collagen) in liver tissue of a subject, comprising administering an effective amount of a compound of Formula (I) to a subject in need thereof; ##STR00079## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halogen-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00080## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously; preferably, the compound is as defined in any of claims 2-9.
18. A method for modulating (e.g. inhibiting) the activity of COL1A1 promoter in a cell, comprising administering an effective amount of a compound of Formula (I) to a cell in need thereof; ##STR00081## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and No.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00082## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously; preferably, the COL1A1 promoter has a sequence set forth in SEQ ID No: 1; preferably, the cell is a collagen-producing cell, such as a hepatic stellate cell, a hepatic sinusoidal endothelial cell, a biliary epithelial cell, a fibroblast or an osteoblast; preferably, the compound is as defined in any one of claims 2-9.
19. A method for modulating (e.g. inhibiting) expression level of a gene associated with liver fibrosis in a cell, comprising administering an effective amount of a compound of Formula (I) to a cell in need thereof; ##STR00083## wherein R.sub.1 is selected from the group consisting of O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), NHCO(C.sub.1-C.sub.4alkyl), CONH(C.sub.1-C.sub.4alkyl), O-(halo-C.sub.1-C.sub.4alkyl) and NO.sub.2; Z is COO(C.sub.1-C.sub.4alkyl) or ##STR00084## wherein R.sub.2, R.sub.3 and R.sub.4 are each independently selected from the group consisting of H, O(C.sub.1-C.sub.4alkyl), halogen (e.g. F, Cl, Br or I), halo-C.sub.1-C.sub.4alkyl, O-(halo-C.sub.1-C.sub.4alkyl), C.sub.1-C.sub.4alkyl and OH; preferably, R.sub.2, R.sub.3 and R.sub.4 are not H simultaneously; preferably, the gene associated with liver fibrosis is selected from the group consisting of COL1A1 gene, TGF-1 gene, MMP2 gene, -SMA gene, TIMP1 gene, TIMP2 gene, SPP1 gene and any combination thereof; preferably, the cell is a collagen-producing cell, such as a hepatic stellate cell, a hapatic sinusoidal endothelial cell, a biliary epithelial cell, a fibroblast or an osteoblast; preferably, the compound is as defined in any one of claims 2-9.
Description
DESCRIPTION OF THE DRAWINGS
[0372]
[0373]
[0374]
[0375]
[0376]
[0377]
[0378]
[0379]
[0380]
[0381]
[0382]
[0383] Information on the Sequence Involved in the Invention is as Follows:
TABLE-US-00002 SEQ ID NO: Description 1 COL1A1 promoter
[0384] Sequence Information
TABLE-US-00003 SEQIDNO:1:2436bp gtgggaaagcctggatgggaaacatatggggaggggcggggagctgcagg caggagcccttcttactacgaaaacccaagaagcaaggaagtggacaggt cactaaccctcatactaccaagccctgcggcaccctgccctagaccacca ctctaaatgtctgttccctccaaaaacaggacccctgtcgcctattaggg aggggttctcttggaactgacccacagtagggggcaggactttggtgggt tcaagaactgccatctcagcacctcagccccctagtcctgccctgcagtc gctggcactaggcgggggcagaccctgggccacaagttgctgccacatgg tcgggataattgatgaaggtccatccctccattgctgtctccagccctgc ctctctggaaactctatattttccctttaattatagcccctgcagtctcc ctctgctgccccacccgcaccgctcatcctggctgcccacggccagccgg ccagccgacgtggctccctccccttctgttccttttttttcccctttgcc ttcgttgcacaaaaccagctgggggagggcgtggagaggggcggggggag gcaatggaatcttggatggtttgggggaggcgggactccccgcttccacg tttgcagctctggagcacccggggtggggagctgcacaggagggagagaa atgaacagggcactgcaaggagacccccaggccttctctcagccctacag agtttctcaggacgaggtagattggggttgaggcagagccttgttggggg aatgggacatggaggaagaaaggacgtggagttctagagccatcttcctt agatatagcctgctgtccttcgggtccccagaccctttcagagtgtacag atgattctctctggttcctaaggcatagagcaatgaccgggattttcaag aaagagatgaggcagtgggaagtagcccctaaaacaaagtcaatcatcct ctgcagcccatcccacacccccaaaggaaagtttcacccagacacccaaa atatcccatacatccccaacactgagtccaggtacaactggagaaggggc tttatgcagctcccagaaagacacccctttagctaagtgccctccctcca cccaggttctctctggtttgactgtgctgggaaggagggtctctaagcag cccctggccacagccatggcaaacaaaactcttctctaagtcaccaatga tcacaggcctcccactaaaaatacttcccaactctggggtggaagagttt gggggatgaatttttaggggattgcaagccccaatccccacctctgtgtc cctagaatcccccacccctaccttggctgctccatcacccaaccaccaaa gctttcttctgcagaggccacctagtcatgtttctcaccctgcacctcag cctccccactccatctctcaatcatgcctagggtttggaggaaggcattt gattctgttctggagcacagcagaagaattgacatcctcaaaattaaaac tcccttgcctgcacccctccctcagatatctgattcttaatgtctagaaa ggaatctgtaaattgttccccaaatattcctaagctccatcccctagcca caccagaagacacccccaaacaggcacatctttttaattcccagcttcct ctgattggagaggtcctcagcatgcctctttatgcccctcccttagctct tgccaggatatcagagggtgactggggcacagccaggaggaccccctccc caacacccccaacccttccacctttggaagtctccccacccagctcccca gttccccagttccacttcttctagattggaggtcccaggaagagagcaga ggggcacccctacccactggttagcccacgccattctgaggacccagctg cacccctaccacagcacctctggcccaggctgggctggggggctggggag gcagagctgcgaagaggggagatgtggggtggactcccttccctcctcct ccccctctccattccaactcccaaattgggggccgggccaggcagctctg attggctggggcacgggcggccggctccccctctccgaggggcagggttc ctccctgctctccatcaggacagtataaaaggggcccgggccagtcgtcg gagcagacgggagtttctcctcggggtcggagcaggaggcacgcggagtg tgaggccacgcatgagcggacgctaaccccctccccagccacaaagagtc tacatgtctagggtctagacatgttcagctttgtggacctccggctcctg ctcctcttagcggccaccgccctcctgacgcacggccaagaggaaggcca agtcgagggccaagacgaagacagtaagtcccaaa
SPECIFIC MODES FOR CARRYING OUT THE INVENTION
[0385] The embodiments of the invention are illustrated in detail by reference to the following examples. However, it is understood by those skilled in the art that the examples are used only for the purpose of illustrating the invention, rather than limiting the protection scope of the invention. In the case where the concrete conditions are not indicated in the examples, the examples are carried out according to conventional conditions or the conditions recommended by the manufacturer. The agents or instruments of which the manufacturer are not indicated are regular products that can be purchased on the market.
EXAMPLE 1
[0386] In the example, the compounds listed in Table 1 were studied for their inhibitory effects on COL1A1 promoter by a cell screening model using COL1A1 promoter as target. The test compounds were prepared by the method as disclosed in CN patent application CN103183623A.
[0387] Experimental Procedure:
[0388] By reference to the method in CN patent application CN104232588A, a cell screening model using COL1A1 promoter as target was established, and LX2COL monoclonal cell line was obtained. After serum-free culture of LX2COL monoclonal cell line, cytokine TGF-1 was added for induction, and meanwhile a test compound (10 M) was added. Epigallocatechin gallate (EGCG) and all-trans-retinoic acid (atRA) were used as positive control drugs. The assay was carried out by using Luciferase Assay Kit, and the results were shown in
[0389] The results showed that the test compounds inhibited COL1A1 promoter to different extents. At the same dose, the test compounds showed better inhibitory effects than the positive control compounds EGCG and atRA. It has been reported definitely that EGCG is a compound capable of inhibiting liver fibrosis; and it has also be demonstrated definitely that all-trans-retinoic acid (atRA) has an improved effect on liver fibrosis and liver cirrhosis, and has been subjected to clinical trial. The results above showed that (benzenesulfonamido) benzamide compounds could inhibit the activity of COL1A1 promoter.
EXAMPLE 2
[0390] In the example, the compounds 16-4, 16-5 and 17-15 were tested for their inhibitory effects on activity of COL1A1 promoter by a dual-luciferase reporter assay system.
[0391] Experimental Procedure:
[0392] At 37 C., 5% CO.sub.2, human hepatic stellate cells LX2 were cultured in DMEM medium containing 10% fetal bovine serum (Gibco). After the cells reached a confluence of about 95%, the cells were spread onto a 96-well plate at 210.sup.4 cells per well. After the cells reached a confluence of about 90%, the cells were subjected to serum-free culture in DMEM medium (Gibco) containing no fetal bovine serum for 24 h. LX2 cells were co-transfected with pGL4.17COL1A1 plasmid (constructed by reference to the method in CN patent application CN104232588A) and Renailla plasmid by using Lipo2000, and were induced by TGF-1 (2 ng/ml) 6 h after transfection; meanwhile, the compounds 16-4, 16-5 and 17-15 were added at a concentration of 1 mol/L, 5 mol/L and 10 mol/L, respectively, wherein at least 3 replicate wells were set for each experiment. The cells were further cultured for 24 h. In accordance with the operations described in the instruction of Dual-Glo Luciferase Assay System, the medium was discarded, and the cells were washed with PBS once. Cells were lysed by the addition of 1 PLB (20 L/well) (within 15 min), luciferase substrate (50 L/well) was added for assay, and a stop solution (50 L/well) was added for assay.
[0393]
EXAMPLE 3
[0394] In the example, the compounds 16-4, 16-5, and 17-15 were tested for in vitro activity against liver fibrosis.
[0395] 1. TGF-1-induced LX2 Cells
[0396] In DMEM (Gibco) medium containing 10% fetal bovine serum, LX2 cells were cultured at 37 C., 5% CO.sub.2. The cells were spread on a 6-well plate at 110.sup.5 cells per well. After culture for 24 h, the original medium was discarded, the cells were washed with PBS once, and DMEM (Gibco) medium without 10% fetal bovine serum was added. After starvation culture for 24 h, TGF-1 (2 ng/ml), and the compounds 16-4, 16-5 and 17-15 (at a concentration of 1 mmol/L, 5 mmol/L and 10 mmol/L, respectively) were added, and control group (not induced by TGF-1) and TGF-1-induced group (with the addition of TGF-1 alone) were set. After further culture for 24 h, the samples were taken.
[0397] 2. Real-time PCR Assay
[0398] In accordance with the TRizol method, the total RNA in LX2 cells were extracted, and in accordance with the operations described in the instruction of Roche Transcriptor First Strand cDNA Synthesis Kit, the total RNA of LX2 was reverse transcribed into cDNA. The cDNA obtained, sterile water, Roche FastStart Universal Probe Master (Rox) and ABI TaqMan probes (COL1A1, TGF-1, MMP2) were used to prepare a 20 L reaction system, which was analyzed by ABI 7500 Fast Real-Time PCR System.
[0399]
[0400] 3. Western Blot Assay
[0401] Proteins in LX2 cells were extracted with RAPI lysis solution (containing 1% PMSF), and the protein concentration was determined by BCA method. The sample was loaded at 20 g/20 L, subjected to polyacrylamide gel electrophoresis, transferred to a membrane, blocked with 5% skim milk, incubated with a primary antibody, washed with PBST, incubated with a secondary antibody, and imaged with ChemiImager 5500 imaging system.
EXAMPLE 4
[0402] In the example, the compounds 16-4 and 17-15 were tested for their safety in Kunming mice.
[0403] Kunming mice (with a body weight of 18-22 g) were randomly divided into control group, 16-4 administration group, and 17-15 administration group, with 4 mice for each group, administered at a dose of 0 mg/kg, 50 mg/kg, 500 mg/kg, 1000 mg/kg and 2000 mg/kg. At the first day of experiment, drugs were intragastrically administered to 16-4 administration group and 17-15 administration group, and normal saline was administered to control group. The body weight and physical conditions of mice (for example, being short of breath or not, having bleeding spots in skin or not, etc.) and whether mice died or not were recorded every day. After observation for 14 days, the mice were sacrificed.
[0404]
EXAMPLE 5
[0405] In the example, the compounds 16-4 and 16-5 were tested for their protection against liver injury by using an alpha-naphthylisothiocyanate (ANIT)-induced liver injury model.
[0406] Kunming female mice (with a body weight of 22-25 g) were randomly divided into control group, ANIT-induced group, 16-4 (400 mg/kg) administration group, and 16-5 (400 mg/kg) administration group, with 10 mice for each group. Drugs were intragastrically administered to 16-4 administration group and 16-5 administration group for 5 days, and normal saline was administered to control group and ANIT-induced group; after starvation treatment for 12 h, ANIT-induced group, 16-4 administration group and 16-5 administration group were induced with ANIT (75 mg/kg by intragastrical administration), and meanwhile corn oil was intragastrically administered to control group. After further administration for 2 days (i.e. after induction with ANIT for 48 h), liver tissues were harvested, and subjected to pathological section and HE staining.
[0407]
EXAMPLE 6
[0408] In the example, SD rat bile duct ligation (BDL) model was prepared, to which drugs were administered.
[0409] SD male rats (with a body weight of 180-200 g) were randomly divided into sham operation group, BDL model group and 16-4 administration group, wherein sham operation group included 6 rats, BDL model group included 8 rats, and 16-4 administration group included 6 rats. Animals were fasted for 12 hours before surgery. After anesthetization with isoflurane, the abdomen of rat was opened under aseptic conditions, the liver was lifted, the duodenum was pulled aside, and 2-3 cm common bile duct was separate. Ligations were performed twice with silk thread No. 000 at the place proximal to duodenum and the place proximal to porta hepatis, respectively. The common bile duct was cut off at the middle of the two ligation places. After the liver was put back, the cut was sutured. In sham operation group, the abdomen was just opened, and then sutured. After recovery from anesthesia, the animals were subjected to normal diet, with free access to water. 2 days after surgery, the compound 16-4 (100 mg/kg) was intraperitoneally injected to 16-4 administration group, and normal saline was intraperitoneally injected to sham operation group and BDL model group, once a day. After administration for 14 days, samples such as urine, blood, bile, liver, kidney and ileum were collected from the animals after being fasted for 12 hours.
EXAMPLE 7
[0410] In the example, the compound 16-4 was studied for its effect on the liver function of BDL rat.
[0411] Blood samples were taken from rats of each group in Example 6, and the rats were fasted for 12 h before taking samples. The rats were anesthetized with 10% chloral hydrate, and blood was collected via aorta ventralis, on standing at room temperature for 1 h, and centrifuged at 3000 rpm for 5 min. The serum was tested for serum biochemical indexes. The results were shown in Table 2. The results showed that the compound 16-4 could reduce the activity of aspartate aminotransferase (AST), alkaline phosphatase (ALP), and -glutamyltransferase (-GGT), indicating that the compound 16-4 could improve the liver function of BDL rats.
TABLE-US-00004 TABLE 2 Effect of the compound 16-4 on serum liver function in BDL model rat 16-4 group Serum control group BDL model (100 mg/kg) biochemical indexes (n = 6) group (n = 8) (n = 6) alanine aminotransferase 33.33 3.78 94.70 68.20 11.86.sup.# ALT (U/L) 24.12** alkaline phosphatase 241.17 476.30 383.60 ALP(U/L) 66.41 77.19** 56.45.sup.# -glutamyltransferase 0.17 0.41 44.90 8.16** 27.40 10.26.sup.# -GGT (U/L) **p < 0.01, compared to control group; .sup.#p < 0.05, compared to BDL model group.
EXAMPLE 8
[0412] In the example, the compound 16-4 was studied for its effect on pathological structure of BDL rat liver.
[0413] The liver tissue samples were taken from rats of each group in Example 6, and the rats were fasted for 12 hours before taking samples. The rats were anesthetized with 10% chloral hydrate and the liver tissue was taken. The hepatic lobar tissue blocks were cut off and fixed in 4% neutral formaldehyde solution. By carrying out the steps such as dehydration, paraffin embedding, slicing and baking, paraffin slices were made. Hematoxylin-eosin (HE) staining solution was used for staining, and changes in pathological structure of rat liver tissue were observed.
[0414]
[0415] The results showed that in the liver tissues of rats in sham operation group, the hepatocytes were arranged regularly, and the hepatic lobules were intact, without inflammatory cell infiltration and bile duct proliferation; the rats in BDL group had the pathological structure of liver tissues changed greatly, with significant bile duct proliferation and significantly increased tissue necrosis; the rats in 16-4 administration group had the structure of liver tissues improved significantly, with significantly inhibited bile duct proliferation and significantly reduced tissue necrosis. The results showed that the compound 16-4 could significantly improve the pathological structure of the liver tissues in BDL rats.
EXAMPLE 9
[0416] In the example, the compound 16-4 was studied for its inhibitory effect on liver fibrosis of BDL model rats.
[0417] (1) Masson staining is a collagen fibril-specific staining and can reflect the extent of liver fibrosis in liver tissue. The liver tissue samples were collected from rats of each group in Example 6, and paraffin slices were made. The paraffin slices were stained with Masson's staining solution, and the fibrosis in rat liver tissue was observed.
[0418]
[0419] (2) Hydroxyproline is specific to collagen fibrils, and the content of hydroxyproline can reflect the extent of liver fibrosis. Liver tissue samples (80-100 mg) were taken from the rats of each group in Example 6, and in accordance with the instruction of Hydroxyproline Assay Kit (purchased from Nanjing Jiancheng Bioengineering Institute), the content of hydroxyproline in the liver tissues was determined.
[0420]
EXAMPLE 10
[0421] In the example, the compound 16-4 was studied for its inhibitory effect on markers associated with liver fibrosis in liver tissues of BDL rats.
[0422] (1) Assay on Expression of Genes Associated with Liver Fibrosis in Liver Tissues by PCR Method.
[0423] Liver tissues (80-100 mg) were taken from the rats of each group in Example 6, and 1 mL TRizol was added. The tissues were homogenized in the condition of an ice bath, and centrifuged at 12000 rpm, 4 C. for 10 min. The supernatant was taken, and the total RNA was extracted. According to the operations described in the instruction of Roche Transcriptor First Strand cDNA Synthesis Kit, the total RNA of LX2 was reverse transcribed into cDNA. The cDNA obtained, sterile water, Roche FastStart Universal Probe Master (Rox) and ABI TaqMan probes were used to prepare a 20 L reaction system, which was analyzed by ABI 7500 Fast Real-Time PCR System.
[0424]
[0425] (2) Assay on Expression of Proteins Associated with Liver Fibrosis in Liver Tissue by Western Blot
[0426] Liver tissues (80-100 mg) were taken from the rats of each group in Example 6, and 1 mL RAPI lysis solution (containing 1% PMSF) was added. The tissues were homogenized in the condition of an ice bath, and centrifuged at 12000 rpm, 4 C. for 10 min. The supernatant was taken, and the protein concentration was determined by BCA method. The sample was loaded at a concentration of 50 g/20 L, subjected to polyacrylamide gel electrophoresis, transferred to a membrane, blocked with 5% skim milk, incubated with a primary antibody, washed with PBST, incubated with a secondary antibody, and imaged with ChemiImager 5500 imaging system.
[0427]
[0428] The experimental results showed that the compound 16-4 could improve the liver function and the pathological structure of liver in rats in BDL model group, reduce the liver fibrosis, and delay the occurrence and development of liver fibrosis.
[0429] Although the embodiments of the invention have been described in detail, a person skilled in the art would understand that according to all the disclosed teachings, details can be amended and modified, and these alterations all fall into the protection scope of the invention. The scope of the invention is defined by the attached claims and any equivalent thereof.