HYBRID SUGAR TRANSPORTERS WITH ALTERED SUGAR TRANSPORT ACTIVITY AND USES THEREOF

Abstract

The present invention provides for a hybrid sugar transporter having an altered sugar transporter activity and comprising at least a first transmembrane domain (TMD) from a first sugar transporter and a second TMD from a second sugar transporter, wherein the first sugar transporter and the second sugar transporter are heterologous to each other.

Claims

1. A hybrid sugar transporter having an altered sugar transporter activity and comprising at least a first transmembrane domain (TMD) from a first sugar transporter and a second TMD from a second sugar transporter, wherein the first sugar transporter and the second sugar transporter are heterologous to each other.

2. The hybrid sugar transporter of claim 1, wherein the hybrid sugar transporter comprises at least seven TMDs.

3. The hybrid sugar transporter of claim 1, wherein the altered sugar transporter activity is the increased or enhanced activity for transporting a sugar.

4. The hybrid sugar transporter of claim 3, wherein the sugar is xylose.

5. An isolated, purified or purified sugar transporter having an amino acid sequence comprising at least 70%, 80%, 90%, 95%, or 99% identity with the amino acid sequence of Neocallimastix californiae SWEET1 (SEQ ID NO:1).

6. A nucleic acid comprises an open reading frame (ORF) encoding the hybrid sugar transporter of claim 1.

7. A vector comprising the nucleic acid of claim 6.

8. A host cell comprising the vector of claim 7.

9. A method for constructing a vector of claim 7, the method comprising: introducing the ORF of the hybrid sugar transporter of the present invention into a vector to produce the hybrid sugar transporter.

10. A method for producing the hybrid sugar transporter, the method comprising: (a) optionally providing a vector of claim 7, (b) introducing the vector into a host cell, and (c) optionally culturing or growing the host cell in a culture medium such that the host cell expresses the sugar transporter and the host cell has an altered capability for transporting sugar into the host cell

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The foregoing aspects and others will be readily appreciated by the skilled artisan from the following description of illustrative embodiments when read in conjunction with the accompanying drawings.

[0022] FIG. 1. Phylogenetic analysis of putative fungal SWEETs. The bootstrapped maximum likelihood tree was constructed using RAxML-HPC v.8 with an Arabidopsis thaliana SWEET (AtSWEET1, AtSWEET7) outgroup. Coding sequence exon (green line) & intron (black line) organization, derived from corresponding gene models, is shown to scale for each SWEET candidate. (*) The Piromyces sp. E2 SWEET (PspSWEET1) contains a predicted 9.9 kb intron which indicated by the break.

[0023] FIG. 2. AGF SWEET strain eGFP fluorescence localization. First row from left to right: NcSWEET1-3; second row from left to right: NcSWEET4, ArSWEET1-2; third row from left to right: ArSWEET3, PfSWEET1-2. Laser intensities were kept identical across samples

[0024] FIG. 3. Spot growth assay of AGF SWEET candidates. Growth on SD (-ura) plates with respective carbon sources was captured after incubation at 30 C for 4 d. Spotting was organized in ten-fold serial dilutions from left to right.

[0025] FIG. 4. SWEET chimera construction and spot growth assay. (a) Single cross-over chimeras were formed by swapping the second domain with that of other candidates; (b) Spot assay evaluation of SWEET chimera activity after a 4d incubation at 30° C.

[0026] FIG. 5. Evaluation of NcSWEET1/PfSWEET2 chimera growth on hexose sugars.

[0027] FIG. 6. Evaluation of glucose and xylose co-consumption by SR8D8 expressing AGF SWEETs.

[0028] FIG. 7. Phylogenetic analysis of all SWEETs. The bootstrapped maximum likelihood tree was constructed using RAxML-HPC v.8 from an alignment of 72 fungal SWEETs identified in this work and 2,392 SWEETs in the kingdoms Plantae and Animalia retrieved from (30). Nodes are colored based on the kingdom of origin.

[0029] FIG. 8. Multiple sequence alignment of AGF SWEETs from respective transcriptomes. Coloration denotes AGF group sequence identity above 80%. AtSWEET1 and OsSWEET2b are included as a reference. The amino acid sequences of NcSWEET1, PfSWEET2, AtSWEET1, OsSWEET2b, NcSWEET2, NcSWEET5, ArSWEET1, PfSWEET1, ArSWEET3, NcSWEET4, ArSWEET2, and NcSWEET3 are SEQ ID NO:1, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, respectively.

[0030] FIG. 9. Multiple sequence alignment of AGF SWEETs from respective genomes. Coloration denotes AGF group sequence identity above 80%. AtSWEET1 and OsSWEET2b are included as a reference. The sequence identifiers of the twelve AGF SWEETs are described above.

[0031] FIG. 10. Spot growth assay of AGF SWEET candidates on galactose. Growth on SD (-ura) plates with respective carbon sources was captured after incubation at 30 C for 4 d. Spotting was organized in tenfold serial dilutions from left to right.

[0032] FIG. 11. Localization of NcSWEET1 point mutants. Confocal micrographs organized from left to right: (Top) NcSWEET1, P52A, P154A; (Bottom) W185G, N201A. Laser intensities were kept identical across samples.

[0033] FIG. 12. Spot growth assay of NcSWEET1 point mutants. Growth on SD (-ura) plates with respective carbon sources was captured after incubation at 30 C for 4 d. Spotting was organized in ten-fold serial dilutions from left to right.

[0034] FIG. 13. NcSWEET1 point mutant and wild-type co-expression growth phenotypes. Growth of strains expressing NcSWEET1 point mutants. Cultures were grown in triplicate on SD(-ura) and SD(-ura,-trp) respectively, supplemented with 2% glucose.

[0035] FIG. 14. Localization of NcSWEET1 chimeras. Confocal micrographs organized from left to right: NcSWEET1/NcSWEET5, NcSWEET1/ArSWEET3, NcSWEET1/PfSWEET2. Laser intensities were kept identical across samples.

[0036] FIG. 15. Growth of NcSWEET1 C-terminal mutants.

[0037] FIG. 16A. Schema of NcSWEET1 and PfSWEET2 chimera constructs. Chimeras formed between NcSWEET1 and PfSWEET2 with varied cross-over junction positions.

[0038] FIG. 16B. Alignment schema of NcSWEET1 and PfSWEET2 chimera sequences. Positions denoted in dark blue are identical in both sequences. Transmembrane domains were annotated according to a consensus TOPCONS prediction. The amino acid sequence of NcSWEET1 is SEQ ID NO:1. The amino acid sequence of PfSWEET2 is SEQ ID NO:18.

[0039] FIG. 17. Spot assay growth of NcSWEET1/PfSWEET2 chimeras. Growth captured after a 4d incubation at 30° C. on SD (-trp) plates supplemented with respective hexose carbon sources.

[0040] FIG. 18. Xylose inhibition assay of mannose uptake by AGF SWEETs. (a) Evaluation of strain growth mediated by endogenous MAL2/MAL3 (maltose) and AGF SWEETs (mannose) when supplemented with xylose sugar; (b) Growth with increasing xylose dosing.

[0041] FIG. 19. Growth phenotype of SR8D8 strains on xylose.

DETAILED DESCRIPTION OF THE INVENTION

[0042] Before the invention is described in detail, it is to be understood that, unless otherwise indicated, this invention is not limited to particular sequences, expression vectors, enzymes, host microorganisms, or processes, as such may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting.

[0043] In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:

[0044] The terms “optional” or “optionally” as used herein mean that the subsequently described feature or structure may or may not be present, or that the subsequently described event or circumstance may or may not occur, and that the description includes instances where a particular feature or structure is present and instances where the feature or structure is absent, or instances where the event or circumstance occurs and instances where it does not.

[0045] The term “about” when applied to a value, describes a value that includes up to 10% more than the value described, and up to 10% less than the value described.

[0046] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0047] The term “heterologous” means a composition that in nature is not connected or is foreign to another composition. For example, a composition is heterologous to another composition as both are not found in nature in the same cell. For example, an ORF and a promoter can be found in the same cell but are heterologous to each other because one is not operatively linked to the other.

[0048] The terms “expression vector” or “vector” refer to a compound and/or composition that transforms, or infects a microbe, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell. An “expression vector” contains a sequence of nucleic acids (ordinarily RNA or DNA) to be expressed by the microbe. Optionally, the expression vector also comprises materials to aid in achieving entry of the nucleic acid into the microbe, such as a virus, liposome, protein coating, or the like. The expression vectors contemplated for use in the present invention include those into which a nucleic acid sequence can be inserted, along with any preferred or required operational elements. Further, the expression vector must be one that can be transferred into a microbe and replicated therein. In some embodiments, the expression vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the operational elements preferred or required for transcription of the nucleic acid sequence. Such plasmids, as well as other expression vectors, are well known to those of ordinary skill in the art.

[0049] The terms “isolated”, “purified”, or “biologically pure” refer to material that is substantially or essentially free of components that normally accompany it in its native state or free of components from a yeast cell or culture medium from which the material is obtained.

[0050] The term “operably linked” refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence, such as an ORF.

[0051] The term “yeast” refers to any yeast species including: ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts and yeast belonging to the Fungi imperfecti (Blastomycetes). The ascosporogenous yeasts are divided into two families, Spermophthoraceae and Saccharomycetaceae. The latter is comprised of four subfamilies, Schizosaccharomycoideae (e.g., genus Schizosaccharomyces), Nadsonioideae, Lipomycoideae and Saccharomycoideae (e.g., genera Pichia, Kluyveromyces and Saccharomyces). The basidiosporogenous yeasts include the genera Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium and Filobasidiella. Yeast belonging to the Fungi Imperfecti are divided into two families, Sporobolomycetaceae (e.g., genera Sporobolomyces, Bullera) and Cryptococcaceae (e.g., genus Candida). Of particular interest to the present invention are species within the genera Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces and Candida. Of particular interest are the Saccharomyces species S. cerevisiae, S. carlsbergensis, S. diastaticus, S. douglasii, S. kluyveri, S. norbensis and S. oviformis. Species of particular interest in the genus Kluyveromyces include K. lactis. Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (F. A. Skinner, S. M. Passmore & R. R. Davenport eds. 1980) (Soc. App. Bacteriol. Symp. Series No. 9). In addition to the foregoing, those of ordinary skill in the art are presumably familiar with the biology of yeast and the manipulation of yeast genetics. See, e.g., Biochemistry and Genetics of Yeast (M. Bacila, B. L. Horecker & A. O. M. Stoppani eds. 1978); The Yeasts (A. H. Rose & J. S. Harrison eds., 2nd ed., 1987); The Molecular Biology of the Yeast Saccharomyces (Strathern et al. eds.

Microbe

[0052] In some embodiments, the microbe is any prokaryotic or eukaryotic cell, with any genetic modifications, taught in U.S. Pat. Nos. 7,985,567; 8,420,833; 8,852,902; 9,109,175; 9,200,298; 9,334,514; 9,376,691; 9,382,553; 9,631,210; 9,951,345; and 10,167,488; and PCT International Patent Application Nos. PCT/US14/48293, PCT/US2018/049609, PCT/US2017/036168, PCT/US2018/029668, PCT/US2008/068833, PCT/US2008/068756, PCT/US2008/068831, PCT/US2009/042132, PCT/US2010/033299, PCT/US2011/053787, PCT/US2011/058660, PCT/US2011/059784, PCT/US2011/061900, PCT/US2012/031025, and PCT/US2013/074214 (all of which are incorporated in their entireties by reference).

[0053] In some embodiments, the microbe or host cell is a cell that naturally cannot or is impaired for transporting a pentose, such as a xylose, into the microbe or host cell.

[0054] Generally, although not necessarily, the microbe is a yeast or a bacterium. In some embodiments, the microbe is Rhodosporidium toruloides or Pseudomonas putida. In some embodiments, the microbe is a Gram negative bacterium. In some embodiments, the microbe is of the phylum Proteobactera. In some embodiments, the microbe is of the class Gammaproteobacteria. In some embodiments, the microbe is of the order Enterobacteriales. In some embodiments, the microbe is of the family Enterobacteriaceae. Examples of suitable bacteria include, without limitation, those species assigned to the Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsielia, Proteus, Salmonella, Serratia, Shigella, Rhizobia, Vitreoscilla, and Paracoccus taxonomical classes. Suitable eukaryotic microbes include, but are not limited to, fungal cells. Suitable fungal cells are yeast cells, such as yeast cells of the Saccharomyces genus.

[0055] Yeasts suitable for the invention include, but are not limited to, Yarrowia, Candida, Bebaromyces, Saccharomyces, Schizosaccharomyces and Pichia cells. In some embodiments, the yeast is Saccharomyces cerevisae. In some embodiments, the yeast is a species of Candida, including but not limited to C. tropicalis, C. maltosa, C. apicola, C. paratropicalis, C. albicans, C. cloacae, C. guillermondii, C. intermedia, C. lipolytica, C. panapsilosis and C. zeylenoides. In some embodiments, the yeast is Candida tropicalis. In some embodiments, the yeast is a non-oleaginous yeast. In some embodiments, the non-oleaginous yeast is a Saccharomyces species. In some embodiments, the Saccharomyces species is Saccharomyces cerevisiae. In some embodiments, the yeast is an oleaginous yeast. In some embodiments, the oleaginous yeast is a Rhodosporidium species. In some embodiments, the Rhodosporidium species is Rhodosporidium toruloides.

[0056] In some embodiments the microbe is a bacterium. Bacterial host cells suitable for the invention include, but are not limited to, Escherichia, Corynebacterium, Pseudomonas, Streptomyces, and Bacillus. In some embodiments, the Escherichia cell is an E. coli, E. albertii, E. fergusonii, E. hermanii, E. marmotae, or E. vulneris. In some embodiments, the Corynebacterium cell is Corynebacterium glutamicum, Corynebacterium kroppenstedtii, Corynebacterium alimapuense, Corynebacterium amycolatum, Corynebacterium diphtherias, Corynebacterium efficiens, Corynebacterium jeikeium, Corynebacterium macginleyi, Corynebacterium matruchotii, Corynebacterium minutissimum, Corynebacterium renale, Corynebacterium striatum, Corynebacterium ulcerans, Corynebacterium urealyticum, or Corynebacterium uropygiale. In some embodiments, the Pseudomonas cell is a P. putida, P. aeruginosa, P. chlororaphis, P. fluorescens, P. pertucinogena, P. stutzeri, P. syringae, P. cremoricolorata, P. entomophila, P. fulva, P. monteilii, P. mosselii, P. oryzihabitans, P. parafluva, or P. plecoglossicida. In some embodiments, the Streptomyces cell is a S. coelicolor, S. lividans, S. venezuelae, S. ambofaciens, S. avermitilis, S. albus, or S. scabies. In some embodiments, the Bacillus cell is a B. subtilis, B. megaterium, B. licheniformis, B. anthracis, B. amyloliquefaciens, or B. pumilus.

Example 1

A SWEET Surprise: Anaerobic Fungal Sugar Transporters and Chimeras Enhance Sugar Uptake in Yeast

[0057] In the yeast Saccharomyces cerevisiae, microbial fuels and chemicals production on lignocellulosic hydrolysates is constrained by poor sugar transport. For biotechnological applications, it is valuable to source transporters with novel or enhanced function from nonconventional organisms in complement to engineering known transporters. Here, we identified and functionally screened genes from three strains of early-branching anaerobic fungi (Neocallimastigomycota) that encode sugar transporters from the recently discovered Sugars Will Eventually be Exported Transporter (SWEET) superfamily into Saccharomyces cerevisiae. A novel fungal SWEET, NcSWEET1, was identified that localized to the plasma membrane and complemented growth in a hexose transporter deficient yeast strain. Single cross-over chimeras were constructed from a leading NcSWEET1 chassis paired with all other candidate SWEETs to broadly scan the sequence and functional space for enhanced variants. This led to the identification of a chimera, NcSW1/PfSW2:TM5-7, that enhanced the growth rate significantly on glucose, fructose, and mannose. Additional chimeras with varied cross-over junctions identified novel residues in TM1 that affect substrate selectivity. Furthermore, we demonstrate that NcSWEET1 and the enhanced NcSW1/PfSW2:TM5-7 variant facilitated novel co-consumption of glucose and xylose in S. cerevisiae. NcSWEET1 utilized 40.1% of both sugars, exceeding the 17.3% utilization demonstrated by the control HXT7(F79S) strain. Our results suggest that SWEETs from anaerobic fungi are beneficial tools for enhancing glucose and xylose co-utilization and offers a promising step towards biotechnological application of SWEETs in S. cerevisiae.

[0058] Here, we demonstrate that anaerobic gut fungal (AGF) SWEETs act on sugars that are abundant in lignocellulosic hydrolysates, using growth complementation in transporter-deficient S. cerevisiae strains. We identified a novel fungal SWEET, NcSWEET1, that demonstrates broad activity on all assayed sugars, including xylose. NcSWEET1 was used as a foundational chassis to recover the functional production of other AGF SWEETs by constructing single cross-over chimeras. This approach broadly scanned the NcSWEET1 protein sequence space, yielding chimeras that significantly enhanced the growth rate on xylose and hexose sugars. Additional protein chimeras, with varied cross-over locations, were used to identify a narrow set of residues that likely modulate substrate selectivity. Further, we evaluated the co-consumption of glucose and xylose by NcSWEET1 and the NcSW1/PfSW2 chimera variants to determine the degree of glucose-mediated inhibition on xylose transport during co-fermentation. This study is the first to demonstrate that SWEETs can transport xylose, and the utility of NcSWEET1 variants as metabolic engineering tools to enhance and overcome sugar transport limitations in S. cerevisiae.

[0059] 2. Materials and Methods

[0060] 2.1 Identification and Phylogenetic Analysis of Genes Encoding Fungal SWEETs

[0061] An exhaustive set of coding sequences were previously derived from the transcriptomes of the anaerobic gut fungi Neocallimastix californiae (Nc), Anaeromyces robustus (Ar), and Piromyces finnis (N) (19). The protein domains of these coding sequences were annotated using Pfam libraries (20) with the HMMER web server (21). Annotated sequences were queried for the ubiquitous MtN3/slv motif (pfam03083) (22) to identify putative SWEETs. For the phylogenetic analysis of all Fungal SWEETs, sequences were mined using this method from the Joint Genome Institute (JGI) MycoCosm database (23). Full-length sequences were identified by requiring completeness and a predicted consensus topology of exactly seven transmembrane helix domains using TOPCONS (24). AGF sequences were manually curated using corresponding transcriptomes. Complete fungal SWEETs were clustered using CD-HIT (25) at >95% sequence identity to denote gene duplicates. Exon/intron structures were derived from gene models in MycoCosm. Full-length fungal SWEETs were aligned using ClustalOmega v. 1.2.4 with default parameters (26). RAxML-HPC v.8 (27) was used to construct a maximum likelihood bootstrap phylogenic tree from the alignment after 500 replicates (raxmlHPC-f a-m PROTGAMMAAUTO-p 12345-x 12345-N 500) on the CIPRES Science Gateway (28). The resulting tree, with bootstrap partition values, was visualized using MEGA? (29). The same workflow was used to construct a maximum likelihood tree of an alignment that includes the fungal SWEETs and an exhaustive list of sequences detailed by Jia, B. et al (30).

[0062] 2.2 Strains, Media, and Plasmid Construction

[0063] The hexose transporter knock-out Saccharomyces cerevisiae strain EBY.VW4000 (CEN.PK2-1C Δhxt1-17 Δstl1 Δagt1 Δydl247w Δyjr160c Δgal2) was a gift from Dr. Eckhard Boles of the Institute of Molecular Biosciences, Goethe-Universität, Germany (31). An HXT-null, xylose screening S. cerevisiae strain, SR8D8 (SR8 Δhxt1-7 Δgal2) was constructed by deleting HXT1-7 and GAL2 coding for major hexose transporters via Cas9-based genome editing in the background of S. cerevisiae SR8 (32, 33), EBY.VW4000 was routinely grown in SD medium (6.7 g/L Difco yeast nitrogen base (Becton, Dickinson & Co., Sparks, Md., USA), 5 g/L casamino acids (Becton, Dickinson & Co., Sparks, Md., USA), 16.75 g/L sodium citrate dihydrate, 4.2 g/L citric acid monohydrate) supplemented with 2% maltose and required auxotrophic supplements (40 mg/L Tryptophan, 40 mg/L Uracil). SR8D8 was routinely grown in YP-ethanol medium (20 g/L peptone (Becton, Dickinson & Co., Sparks, Md., USA), 10 g/L yeast extract (Becton, Dickinson & Co., Sparks, Md., USA), 2% ethanol). Escherichia coli strain DH5α, used for cloning and plasmid propagation, was cultured in lysogeny broth (10 g/L tryptone (Becton, Dickinson & Co., Sparks, Md., USA), 5 g/L yeast extract (Becton, Dickinson & Co., Sparks, Md., USA), 10 g/L NaCl) supplemented with 100 m/mL ampicillin. Anaerobic fungal SWEET genes were codon-optimized for expression in S. cerevisiae and synthesized by Genewiz (South Plainfield, N.J., USA). The S. cerevisiae HXT7 gene was amplified from a pRS416.HXT7(F79S) plasmid (34) using Phusion DNA polymerase (New England Biolabs, Ipswich, Mass., USA). Genes were cloned into pRS316, pRS314, or pRS410 centromeric vectors using EagI and SacII/SpeI restriction enzymes and T4 DNA ligase (New England Biolabs, Ipswich, Mass., USA). In the pRS314 and pRS410 vectors, the cloned gene is flanked by an upstream constitutive TEF1 promoter, and a downstream mating factor alpha 1 (MFα1) terminator sequence. In the pRS316 vector, the cloned gene is additionally fused at the 3′ end to a gene encoding enhanced green fluorescent protein (eGFP) and a decahistidine tag. Tables 1 and 2 detail the strains and plasmids used in this study. Plasmids were verified by Sanger sequencing (Genewiz, South Plainfield, N.J., USA) and transformed into S. cerevisiae strains using the lithium-acetate/PEG method (35). Strain EBY.VW4000 transformants were selected on SD plates (20 g/L Agar) supplemented with 2% maltose and corresponding auxotrophic supplements. Strain SR8D8 transformants were selected on YP-Glycerol (3%), Ethanol (2%) plates (15 g/L Agar) supplemented with 500 μg/mL G-418 antibiotic and subsequently maintained with 200 μg/mL G-418.

TABLE-US-00002 TABLE 1 Strains used in this study. Source or Strain.sup.a Description Reference Anaeromyces robustus Wild type (1) Neocallinastix californiae Wild type (1) Piromyces fruntis Wild type (1) Escherichia coli DH5α Sequenced E. coli ATCC strain (ATCC 68233) Saccharomyces cerevisiae Wild type ATCC BJ546 (ATCC 208288) S. cerevisiae CEN.PK2-1Chxt1-17Δ (2) EBY.VW4000 gal2Δ::loxP st 11Δ::loxP agt1Δ::loxP mph2Δ::loxP mph3Δ::loxP S. cerevisiae SR8D8 SR8 hxt1-7Δ gal2Δ (3) .sup.aThis includes anaerobic fungal strains whose transcriptomes were used as a reference for gene synthesis. 1. Haitjema CH. Gilmore SP. Henske JK. Solomon K V.. de Groot R, et al. 2017. A parts list for fungal cellulosomes revealed by comparstive genomics. Nat. Microbiol. 2(8):17087 2. Wieezorke R, Krampe S. Weierstall T. Freidel K Hollenber CP, Boles E. 1995. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS Lett. 464/3): 123-28 3. Xu H. 2015. ENGINEERING SACCHAROMYCES CEREVISIAE FOR CELLULOSIC ETHANOL PRODUCTION. University of Illinois at Urbana-Champaign. 1-87 pp.

TABLE-US-00003 TABLE 2 Plasmids used in this study. Plasmid Description Source or Reference pRS316 URA3, CEN6_ARS4 origin (1) PRS314 TRP1, CEN6_ARS4 origin (1) pRS410 kanMX. CEN6_ARS4 origin ATCC (ATCC 11258) pRS316-N1 pRS316-TEF1-NcSWEET1-GFP-His.sub.10 This study PRS316-N2 pRS316-TEF1-NeS WEE T2-eGFP-His.sub.10 This study PRS316-33 pRS316-TEF1-NcSWEET3-GFP-His.sub.10 This study pRS316-N4 pRS316-TEF1-NcSWEET4-GFP-His.sub.10 This study pRS316-A1 pRS316-TEF1-ArSWEETI-GFP-His.sub.10 This study pRS316-A2 pRS316-TEF1-AISWEET2-GFP-His.sub.10 This study pRS316-A3 pRS316-TEF1-ArS W EET3-eGP P-His.sub.10 This study pRS316-P1 pRS316-TEF1-PfSWEET i-eGFP-His.sub.10 This study pRS316-P2 pRS316-TEF1-RfSWEETZ-eGPP-His.sub.10 This study pRS316-H7 pRS316-TEF1-ScHXT7 This study PRS314-N1 pRS314-TEF1-NcSWEET1 This study pRS314-N2 pRS314-TEF1-NcSWEET2 This study pRS314-N3 pRS314-TEF1-NcSWEET3 This study pRS314-N4 pRS314-TEF i-NcSWEET4 This study pRS3 14-Al pRS314-TEF1-ArSWEET1 This study pRS314-A2 pRS314-TEF1-ArSWEET2 This study pRS314-A3 pRS314-TEF1-ATSWEET3 This study pRS314-P1 pRS314-TEF1-PfSWEET1 This study pRS314-P2 pRS314-TEF1-PSWEET2 This study pRS314-H7 pRS314-TEF1-ScHXT7 This study N1/N2:TM5-7 pRS314-TEF1-NcSWEETI/NcSWEET2 (TM5-7) This study N1/N3:TM5-7 pRS314-TEFI-NcSWEETL/NSWEET3 (TM5-7) This study N1/N4:TM5-7 pRS314-TEF1-NcSWEETI/NESWEET4 (TM5-7) This study N1/AL:TM5-7 pRS314-TEF1-NcSWEETV/ArSWEET1 (TM5-7) This study NI/AL:TM5-7 pRS314-TEF1-NcSWEET L/ArSWEET2 (TM5-7) This study NV/A1:TM5-7 pRS314-TEF1-NcSWEET1/PfSWEETl (TM5-7) This study N1/PLTM5-7 pRS314-TEF1-NcSWEET1/PfSWEET1 (TM 5-7) This study NI/P2:TM5-7 pRS314-TEF1-NcSWEET1/PfS WEET2 (TM5-7) This study PRS316-N1/N3 pRS316-TEF1-NcSWEET1/NcSWEET3-eGFP-Hist This study pRS316-N1/A3 pRS316-TEF1-NcSWEETV/ArSWEET3-GFP-Hist This study pRS316-N1/P2 pRS316-TEF1-NcSWEET1/PfSWEET2-eGFP-Hisi This study NI/P2:Ct pRS314-TEF1-NcSWEETI/PfSWEET2 (C-terminal tail} This study NcSWlTr pRS314-TEF1-NcSWEET1:Tr This study N1/P2:TM4-7 pRS314-TEF1-NcSWEET1/PfSWEET2 (TM4-7) This study N1/P2:TM3-7 pRS314-TEF1-NcSWEET1/PfSWEET2 (TM3-7) This study N1/P2TM2-7 pRS314-TEF1-NcSWEET1/PfSWEET2 (TM2-7) This study N1/F2TM1-7 pRS314-TEF1-NcSWEET1/PfSWEET2 (TM1-7) This study p416-HXT7(F79S) p416-pHXT7-ScHXT7(F79S) (2) PRS410-HXT7 pRS410-TEFI-HXT7(F79S) This study pRS410-NcSW1 pRS410-TEF1-NcSWEET1 This study pRS410-1/2(57) pRS410-TEF1-NcSWEET1/PfSWEET2 (TM5-7) This study pRS410-NkP2(47) pRS410-TEF1-NcSWEET1/PfSWEET2 (TM4-7) This study pRS410-NI/P2(37) pRS410-TEF1-NcSWEET1/PfSWEET2 (TM3-7) This study pRS410-N1/P2(27) pRS410-TEF1-NcSWEET1/PfSWEET2 (TM2-7) This study pRS410-NI/P2(17) pRS410-TEF1-NcSWEET1/PfSWEET2 (TM1-7) This study 1. Sikorski. R.S., Hieter, P., 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27. 2. Rader Apel A, Ouellet M, Szmidt-Middleton H Keating JD. Mukhopadhyay A 2016. Evolved hexose transporter enhances xylose uptake and alucose/xylose co-utilization in Saccharomyces cerevisise. Sei. Rep. 5(1)19512

[0064] 2.3 SWEET Chimera Construction

[0065] Single cross-over chimeric transporters were assembled from a pairing between NcSWEET1 and other anaerobic gut fungal SWEETs using USER cloning with the PfuX7 polymerase (36, 37). PfuX7 was a gift from Dr. Morten Nørholm of the Novo Nordisk Foundation Center for Biosustainability, Technical University of Denmark, Denmark. Alignment of AGF SWEET sequences using Clustal Omega (26) guided in silico assembly and the design of USER primers targeting a cross-over location that immediately follows the fourth predicted transmembrane-segment. Additional single cross-over chimeras were constructed between NcSWEET1 and PfSWEET2 that varied the cross-over position. All primers are detailed in Table 3. The nucleotide sequences of primers P1 to P48 are SEQ ID NO:29 to SEQ ID NO:74, and SEQ ID NOs:11 and 15, respectively.

TABLE-US-00004 TABLE 3 Primers used in this study ID Description 5′.fwdarw.3′ Sequence P1 MFα1t, SacI, Rev CATAGAGCTCAATTCTCTTAGGATTCGATTCACATTCATCT P2 TEF1p, EcoRI Fwd CATAGAATTCAGATCTGTTTAGCTTGCCTCGTCCC P3 MFα1t, SpeI, Fwd CATAACTAGTGAAAATGTTTCAGTTGATACAGCTATGACTTTACAA P4 NcSW1, SpeI, Rev CATAACTAGTGAAAATGTTTCAGTTGATACAGCTATGACTTTACAA P5 NcSW2, SpeI, Rev CATAACTAGTTAATAATAACTTAAGAGTTGAAGACATGGGTATCTATTAC TG P6 NcSW3, SpeI, Rev CATAACTAGTATTTTTCATATGAAATGGTGTCATTTGAATAGTATTTTGTG P7 ArSW1, SpeI, Rev CATAACTAGTATTTTTCAAATGAAATGGAGTCATTTGAATTGTATT P8 ArSW2, SpeI, Rev CATAACTAGTCCATGGAGAATACAACATAGTTGAGTTACCTT P9 ArSW3, SpeI, Rev CATAACTAGTAATATTAATAACCTTTTCATTAATATTTTCTTCAATTTTCTT ATCTGC P10 PfSW1, SpeI,, Rev CATAACTAGTATTTTTTAAATGAAATGGAGTCATTTGAATAGTATTATGT GG P11 PfSW2, SpeI, Rev CATAACTAGTACCATACAAAGTAGTAGAATTAGCGTTCAATGG P12 HXT7, EagI, Fwd CATACGGCCGATGTCACAAGACGCTGCTATTGCAG P13 HXT7, SpeI, Rev CATAACTAGTTTTGGTGCTUAACATTCTCTTGTACAATGG P14 pRS, USER, Fwd ACACAGACAAGA[U]GAAACAATTCGGCA P15 pRS, USER, Rev ATCTTGTCTGTG[U]AGAAGACCACACACG P16 N1/N2, USER, Rev ACCTCTATTGAACAAAA[U]AAAAGACAAAGCACCACCACA P17 N1/N3, USER, Rev ATCTTTGAACAAAA[U]AAAAGACAAAGCACCACCACA P18 N1/N4, USER, Rev ATTGTCATCGAACAAAA[U]AAAAGACAAAGCACCACCAC P19 NI/A1, USER, Rev AGAACCATTGTTC[U]TGAAUAAAATAAAAGACAAAGCAC P20 N1/A2, USER, Rev ATCTTTGAACAAAA[U]AAAAGACAAaGCACCACCACA P21 NN A3, USER, Rev ATCATGGAACAAAA[U]AAAAGACAAAGCACCACCACA P22 N1/P1, USER, Rev ACCTUTATTGAACAAAA[U]AAAAGACAAAGCACCACCA€ P23 N1/P2, USER, Rev ATCTTTGAACAAAA[U]AAAAGACAAAGCACCACCACA P24 N1/N2, USER, Fwd ATTTTGTTCAATAGAGG[U]TTGAAATCTTATACTATTTTAGGTTTTATTTC TTC P25 N1/N3, USER, Fwd ATTTTGTTCAAAGA[U]AACTATGAAGCTGCAAAAAACTGTATGG P26 N1/N4, USER, Fwd ATITTGTTCGATGACAA[U]TATGAAGCTGCTAAAAACTCTATGG P27 N1/A1, USER, Fwd AGAACAATGGTTC[U]ACTTCTTATACTGTTTTGGGTTTTATTAC P28 N1/A2, USER, Fwd ATTTTGTTCAAAGA[U]AATTATACAGCTGCTAAAAATTGTATGGGT P29 N1/A3, USER, Fwd ATTTTGTTCCATGA[U]GACTACCCAAAAGCTAAAAACACTATTG P30 N1/P1, USER, Fwd ATTTGTTCAATAGAGG[U]ATTACTTCTTATAATGTTTTGGGTTTTATTTG P31 N1/P2, USER, Fwd ATTTTGTTCAAAGA[U]AATTATGATGCTGCTAAAAACTGTATGGGT P32 NcSW3, SacII, Rev CATACCGCGGTITTTCATATGAAATGGTGTCATTTGAATAGTATTTTGTG P33 ArSws, SacII, Rev CATACCGCGGAATATTAATAACCTTTTCATTAATATTTTCTTCAATTTTCT TATCTGC P34 PfSW2, SacII, Rev CATACCGCGGACCATACAAAGTAGTAGAATTAGCGTTCAATGG P35 N1/P2:Ct, USER, Fwd ATTTTTATGGAAAA[U]AAAAAACAACAAGAATTGCAACAAAGCAG P36 N1/P2:Ct, USER, Rev ATTTTCCATAAAAA[U]TCTGGTAAGAATTCTCAAGAATTG P37 NcSW1:tr, USER, Fwd AAGAAACTAGTTAA[U]AATAACTTAAGAGTTGAAGACATGGG P38 NcSW1,Tr, USER, Rev ATTAACTAGTTTCT[U]TTTTAGGATAAATAAAAAACAACAAGAATTG P39 N1/P2:TM4-7, USER, ATTTTGTTTTCTTC[U]AACATGAAGCCAAAAGATTTTAAATOGACT Fwd P40 N1/P2:TM3-7, USER, ACAATCATTGGAC[U]TTCTGGCCAAACTTGG Fwd P41 N1/P2:TM2-7, USER, ACCATTTAAGGAA[U]TACAAAATTTGAAAAAATCTAATGGTCAATG Fwd P42 N1/P2:TM1-7, USER, AATTATTACTGAAAC[U]GTTTTTCCATTGTGTGGT Fwd P43 N1/P2:TM1-7, USER, AGAAGAAAACAAAA[U]CATAATATAATATTGACCCAAAATAATACCAC Rev P44 N1/P2-TM3-7, USER,  AGTCCAATGATTG[U]GAATAACAAAAGAATACAAGTCTTGGGAC Rev P45 N1/P2:TM2-7, USER, ATTCCTTAAATGG[U]GATAAAAAGATAAAATAAGCTGTAAAACAACC Rev F46 N1/P2:TM1-7, USER, AGTTTAGTAATAAT(U]TCACAAGCTTGAGAAGTGC Rev P47 MFαt, SalI, Rev CATAGTCGACAATTCTCTTAGGATTCGATTCACATTCATCT P48 TEF1p, BamHI Fwd CATAGGATCCAGATCTGTTTAGCTTGCCTCGTCCC

[0066] 2.4 GFP fluorescence Imaging

[0067] EBY.VW4000 cultures expressing SWEET-eGFP genes were grown in SD (-Ura) supplemented with 2% maltose to an optical density at 600 nm (OD.sub.600) of ˜2.0. Yeast cells were washed twice using 1×PBS buffer and diluted to OD.sub.600 0.1. Samples were transferred to chamber slide wells (Thermo Fisher Scientific, Waltham, Mass., USA) coated with 0.1% (w/v) poly-1-lysine (Sigma-Aldrich, St. Louis, Mo., USA) and allowed to settle for 15 minutes. Fluorescence imaging of yeast cells was performed on an Olympus Fluoview FV1000 confocal laser scanning microscope using a PLAPON 60XOSC2/1.40NA objective. eGFP fluorescence was visualized by excitation at 488 nm and emission detection at 510 nm.

[0068] 2.5 Growth Complementation Assay

[0069] Strain EBY.VW4000 was used to screen for hexose transport activity. HXT7(F79S) and the empty vector were used as controls. Yeast colonies were picked from agar plates and grown in liquid medium to OD.sub.600˜2.0. Cells were washed twice in deionized water and diluted to OD.sub.600 0.1. Serial dilutions were plated onto SD (-Ura) or (-Ura, -Trp) plates supplemented with 2% maltose (control) or 2% glucose; 2% fructose; or 2% mannose. Plates were incubated at 30° C. for 4 days and photographed using the Bio-Rad ChemiDoc MP imaging system (Bio-Rad, Hercules, Calif., USA). Xylose growth complementation was evaluated in strain SR8D8 by monitoring the OD.sub.600 of triplicate 4 mL cultures. Cultures were inoculated at a starting OD.sub.600 0.1 as previously described and sampled daily over five days.

[0070] 2.6 Sugar Consumption Assay

[0071] SR8D8 strains were grown on YP-ethanol with 200 μg/mL G-418 to an OD.sub.600˜2-3, washed twice with deionized water, and inoculated in triplicate into 5 mL YP-GX (2.5% D-glucose, 2.5% D-xylose) supplemented with 200 μg/mL G-418. The depletion of D-glucose and D-xylose in solution was monitored using a YSI 2950D biochemistry analyzer (YSI Incorporated, Yellow Springs, Ohio, USA). Sugar concentrations and the OD.sub.600 of each culture were measured daily over five days.

[0072] 3. Results

[0073] 3.1 Identification and Phylogenetic Analysis of Fungal SWEETs

[0074] The characteristics of fungal SWEETs are poorly described and based on only nine complete sequences from three species (30). To deepen the understanding of fungal SWEET diversity, all fungal genomes in the MycoCosm portal were queried for predicted genes with the MtN3/slv motif (pfam03083). The resulting 83 entries were deduplicated and further filtered after membrane topology prediction for the canonical seven transmembrane helices of eukaryotic SWEETs. Sequences from the anaerobic gut fungi Neocallimastix californiae (Nc), Anaeromyces robustus (Ar), Piromyces finnis (N), and Caecomyces churrovis (Cc) were manually verified using corresponding transcriptomes (38, 39). This search identified 71 full-length fungal SWEET sequences from 30 fungal species belonging to five phyla: Basidiomycota, Blastocladiomycota, Chytridiomycota, Cryptomycota, and Zoopagomycota (Table 4). This set includes all previously described, complete fungal SWEETs (30, 40). Apart from two SWEET homologs found in the higher-order phylum Basidiomycota, fungal SWEETs belong to early-diverging fungal lineages. Seven gene duplicates were identified after clustering, including four duplicates of the AGF NcSWEET1. Most of these fungi are symbionts of host organisms and saprotrophic.

TABLE-US-00005 TABLE 4 SWEET sequences identified from assembled genomes available in the Mycocosm database. Protein ID numbers correspond to unique identifiers within a given assembly. SWEET Organism ID Clade & Genome Assembly Phylum ID# Ref. AmSWEET1 I Allomyces macrogynus Blastociadiomycota 7200 — ATCC 38327 AmSWEET2 I Allomyces macrogynus Blastociadiomycota 13064 — ATCC 38327 AmSWEET3 II Allomyces macrogynus Blastociadiomycota 1507 — ATCC 38327 AmSWEET4 II Allomyces macrogynus Blastociadiomycota 18075 — ATCC 38327 AmSWEET5 II Allomyces macrogynus Blastociadiomycota 16614 — ATCC 38327 AmSWEET6 II Allomyces macrogynus Blastociadiomycota 6030 — ATCC 38327 ArSWEET1 I Anaeromyces robustus Chytridiomycota 290897 (1) v1.0 AISWEET2 II Anaeromyces robustus Chytridiomycota 236039 (1) v1.0 AISWEET3 II Anaeromyces robustus Chytridiomycota 291099 (1) v1.0 BbSWEET1 I Blastociadiella britannica Blastociadiomycota 372883 — v1.0 BBSWEET2 II Blastociadiella britannica Blastociadiomycota 378665 — v1.0 BdSWEET1 II Batrachochytrium dendrobatidis Chytridiomycota 16153 — JAMS v1.0 BASWEET2 II Batrachochytrium dendrobatidis Chytridiomycota 36766 — JAM81 v1.0 CaSWEET1 I Catenaria anguillalae Blastociadiomycota 1084816 (2) PL171 v2.0 CaSWEET2 II Catenaria anguillalae Blastociadiomycota 51343 (2) PL171 v2.0 CaSWEET3 II Catenaria anguillalae Blastociadiomycota 121314 (2) PL171 v2.0 CeSWEETI II Caecomyces churrovis Chytridiomycota 421479 (3) A v1.0 CeSWEET2 I Caecomyces churrovis Chytridiomycota 452194 (3) A v1.0 ChSWEET1 II Chytriomyces hyalinus Chytridiomycota 608356 — JEL632 v1.0 ChSWEET2 II Chytriomyces hyalinus Chytridiomycota 608348 — JEL632 v1.0 ChSWEET3 II Chytriomyces hyalinus Chytridiomycota 639362 — JEL632 v1.0 CISWEET1 II Chytridium lagenaria Chytridiomycota 212214 — Arg66 v1.0 CmSWEET1 I Coemansia mojavensis Zoopagomycota 522374 — RSA 71 v1.0 CPSWEET1 II Cladochytrium polystomum Chytridiomycota 858157 — WB228 v1.0 CspSWEET1 II Chytriomyces sp. Chytridiomycota 1093906 — MP 71 v1.0 CsSWEET1 I Coemansia spiralis Zoopagomycota 228313 — RSA 1278 v1.0 DeSWEET1 I Dimargaris cristalligena Zoopagomycota 29179 (4) RSA 468 single-cell v1.0 EhSWEET1 I Entophlyetis helioforms Chytridiomycota 455491 — JEL805 v1.0 EhSWEET2 II Entophlyctis helioformis Chytridiomycota 507073 — JEL805 v1.0 EhSWEET3 II Entophlyctis helioformis Chytridomycota 515811 — JEL805 v1.0 EhSWEET4 II Entophlyctis helioformis Chytridiomycota 515810 — JEL805 v1.0 GhSWEET1 I Gorgonomyces haynaldii Chytridiomycota 212799 — MP57 v1.0 GhSWEET2 Ii Gorgonomyces haynaldii Chytridiomycota 229800 — MP57 v1.0 GhSWEET3 Ii Gorgonomyces haynaldii Chytridiomycota 10744 — MP57 v1.0 GppSWEET1 I Globomyces pollinis-pini Chytridiomycota 619450 — Arg68 v1.0 GppSWEET2 Ii Globomyces pollinis-pini Chytridiomycota 572227 — Arg68 v1.0 GppSWEET3 Ii Globomyces pollinis-pini Chytridiomycota 616459 — Arg68 v1.0 GprSWEET1 I Gonapodya prolifera Chytridiomycota 75834 (5) v1.0 GprSWEET2 I Gonapodya prolifera Chytridiomycota 201379 (5) v1.0 GprSWEET3 II Gonapodya prolifera Chytridiomycota 54321 (5) v1.0 HcSWEET1 I Hyaloraphidium curvatum Chytridiomycota 669219 — SAG235-1 v1.0 HcSWEET2 II Hyaloraphidium curvatum Chytridiomycota 692297 — SAG235-1 v1.0 HcSWEET3 II Hyaloraphidium curvatum Chytridiomycota 709908 — SAG235-1 v1.0 HcSWEET4 II Hyaloraphidium curvatum Chytridiomycota 472801 — SAG235-1 v1.0 HcSWEET5 II Hyaloraphidium curvatum Chytridiomycota 663276 — SAG235-1 v1.0 HpSWEET1 I Homolaphlyctis polyrhiza Chytridiomycota 5300 (6) JEL142 v1.0 HpSWEET2 II Homolaphlyctis polyrhiza Chytridiomycota 1185 (6) JEL142 v1.0 JspSWEET1 II Jaminaea sp. Basidiomycot 227740 (7) MCA 5214 v1.0 KaSWEET1 I Kickxella alabastrina Zoopagomycota 180536 — RSA 675 v1.0 NcSWEET1 II Neocallimastix californiae Chytridiomycota 450485 (1) G1 v1.0 NeSWEET1A II Neocallimastix californiae Chytridiomycota 672410 (1) G1 v1.0 NcSWEET1B II Neocallimastix californiae Chytridiomycota 672411 (1) G1 v1.0 NcSWEET1C II Neocallimastix californiae Chytridiomycota 672409 (1) G1 v1.0 NcSWEET1D II Neocallimastix californiae Chytridiomycota 672412 (1) G1 v1.0 NcSWEET2 I Neocallimastix californiae Chytridiomycota 207465 (1) G1 v1.0 NcSWEET3 II Neocallimastix californiae Chytridiomycota 79940 (1) G1 v1.0 NcSWEET4 I Neocallimastix californiae Chytridiomycota 460436 (1) G1 v1.0 NcSWEET5 I Neocallimastix californiae Chytridiomycota 667320 (1) G1 v1.0 OmSWEET1 II Obelidium mucronatum Chytridiomycota 852033 — JEL8G2 v1.0 OmSWEET2 II Obelidium mucronatum Chytridiomycota 920091 — JEL802 v1.0 PfSWEET1 I Piromyces finnis Chytridiomycota 583192 (1) v3.0 PfSWEET2 II Piromyces finnis Chytridiomycota 331754 (1) v3.0 PgSWEET1 II Pseudomicrostronia glucosiphilum Basidiomycota 284347 (7) MCA 4718 v1.0 PspSWEET1 II Piromyces sp. E2 Chytridiomycota 41852 (1) v1.0 PsSWEETI1 I Paraphysoderma sedebokerense Blastocladiomycota 1170225 — JEL821 v1.0 PsSWEET2 II Paraphysoderma sedebokerense Blastocladiomycota 73074 — JEL821 v1.0 RaSWEET1 II Rozella allomycis CSP55 Cryptomycota 31310 (4) single-cell v1.0 RbSWEETI1 I Ramicandelaber brevisporus Zoopagomycota 160626 — CBS 109374 v1.0 RgSWEET1 II Rhizoclosmatium globosum JEL800 v1.0 Chytridiomycota 724887 (2) RgSWEET2 II Rhizoclosmatium globosum Chytridiomycota 703951 (2) JEL800 v 1.0 RgSWEET3 II Rhizoclosmatium globosum JEL800 v1.0 Chytridiomycota 722081 (2) 1. Haitijema CH, Gilmore SP, Henske JK, Solomon K V., de Groot R. et al. 2017. A parts list for fungal cellulosomes revealed by comparative genomics. Nat. Microbiol. 2(8):170877 2. Mondo SJ Dannebaum RO, Kuo RC, Louie KB, Bewick AJ, et al. 2017. Widespread adenine N6-methylation of active genes in fungi Nat Genet. 49(5):964-68 3. Henske JK. Gilmore SP, Knop D, Cunningham FJ. Sexton JA, et al. 2017. Transcriptemic characterization of Caecomyces churrovis: A novel, non-rhizoid-forming lignocellulolytic anaerobic fungus. Biotechnol. Biofuels. 10(1):1-2 4. Ahrendt SR. Quandt CA. Clobanu D, Chum A. Salamov A, et al 2018. Leveraging single-cell genomics to expand the fungal tree of life. Nat Microbiol. 3(12)1417-28 5. Chang Y. Wang S, Sekimoto S. Aerts AL, Choi C. et al. 2015. Phylogenomic analyses indicate that early fungi evolved digesting cell walls of algal ancestors of land plants. Genome Biol. Evol 7(6):1590-1601 6. Toseson S, Stanich JE. Shiu SH, Resenblum EB 2011. Genomie transition to pathogenicity in chytrid fungi. PLoS Pathog. 7(11) 7. Kijpomnyongpan T. Mondo SJ, Barry K. Sandor L, Lee J. et al. 2018. Broad genomic sampling reveals a smut pathogenic ancestry of the fungal clade ustilaginomycotina. Mol. Biol Evol 35(8):1840-54

[0075] Structural resolution of eukaryotic plant SWEETs, OsSWEET2b (41) and AtSWEET13 (42), has identified residues that form the substrate-binding pocket and both extracellular and intracellular gates. These residues show conservation across eukaryotic lineages (30), and point mutagenesis at these positions in AtSWEET1 predominantly yielded loss-of-function mutants (30, 41, 43). Fungal SWEETs show significant conservation of residues at positions that correspond to the extracellular gate and substrate-binding pocket (Table 4). Residue conservation may also correspond with functional conservation across the SWEET superfamily.

[0076] A maximum-likelihood phylogenic tree with bootstrap bipartition statistics was constructed using RAxML-HPC after amino acid sequence alignment using ClustalOmega (FIG. 1). Further, corresponding gene annotations in Mycocosm were used to map exon/intron structures for each sequence. Fungal SWEETs form two distinct clades supported by high bipartition values. Of the fungal species that encode more than one SWEET, >70% possess members of both clades. Exon/intron structure was highly variable in both clades, but subgroups composed of single fungal families demonstrated conservation, e.g., AGF SWEETs. Of most interest is the exon/intron organization of AGF SWEETs in clade I that are predicted to all encode 11 introns. This level of fragmentation is typically only observed in Plantae SWEETs (40), possibly denoting functional conservation (44). A tree was also constructed from an alignment of Fungal SWEETs with 2300 Plant and Animalia SWEETs detailed in (30) (FIG. 7). Interestingly, the two clades are recovered and separately nest within Plant and Animalia node abundant branches.

[0077] 3.2 Heterologous Expression of Anaerobic Gut Fungal SWEETs

[0078] AGF SWEETs were selected for synthesis before any genomic sequencing, and thereby limited to nine sequences previously annotated in the transcriptomic data collected from the anaerobic gut fungi N. californiae (Nc), A. robustus (Ar), and P. finnis (N) (12): NcSWEET1-4, ArSWEET1-3, and PfSWEET1-2, respectively. Transmembrane (TM) topology prediction using the TOPCONS web server (24) revealed that NcSWEET4 and ArSWEET2 sequences were likely truncated at the amino (N)-terminus, encoding only six and five TMs, respectively (FIG. 8). Nevertheless, as the transcriptomic coding sequence appeared otherwise complete, NcSWEET4 and ArSWEET2 were included in this study. Full length sequences for NcSWEET4 and ArSWEET2 were subsequently resolved using corresponding genomes (45) (FIG. 9). All AGF SWEET sequences were codon optimized for expression in S. cerevisiae and subsequently synthesized. After cloning into a pRS316 vector encoding a C-terminal eGFP-His.sub.10 fusion tag, the genes were expressed in the S. cerevisiae strain EBY.VW4000. Confocal micrographs were taken of cultures in mid-log growth to evaluate the capacity for heterologous production and intracellular trafficking to the plasma membrane (FIG. 2).

[0079] Fluorescent protein production is evident in all recombinant strains, but individual SWEETs display wide-ranging sub-cellular localization patterns. As seen in FIG. 2, only NcSWEET1, ArSWEET1, ArSWEET3, and PfSWEET1 demonstrate fluorescent signals at the cell periphery. Punctuation of this signal is similar to observations made by Seppälä et al. during heterologous expression of AGF fluoride transporters (13), attributed to possible retention of a pool of transporters within the cortical endoplasmic reticulum (ER). Accumulation in other intracellular compartments of ArSWEET1 and ArSWEET3 strains may reflect the burden on native translational and secretory pathway machinery exacerbated by strong constitutive expression. NcSWEET4 and ArSWEET2 appear to lack ER localization, a phenotype consistent with the predicted truncation of N-terminal features recognized by secretory pathway chaperone proteins during membrane protein biogenesis. Conversely, NcSWEET3 fails to localize to the ER despite high (˜75%) shared sequence identity with NcSWEET1. Poor functional conservation of the AGF SWEET leader peptides in S. cerevisiae may contribute to inconsistencies in secretory pathway trafficking and thereby the capacity for heterologous production.

[0080] 3.3 N. Californiae SWEET1 Transports Hexose Sugars

[0081] The activity of AGF SWEETs on hexose sugars was assayed by growth complementation in the hexose transporter knock-out strain EBY.VW4000. Of the nine candidate AGF SWEETs, only NcSWEET1 recovered growth on media supplemented with 2% glucose, 2% fructose, or 2% mannose as sole carbon sources (FIG. 3). The NcSWEET1 strain also demonstrated growth above the control on 2% galactose (FIG. 10), suggestive of a broad native role as a general hexose transporter in N. californiae. Poor functional production of the remaining AGF SWEETs was consistent with observed plasma membrane trafficking incompatibilities in S. cerevisiae.

[0082] Functional conservation of key SWEET residues in NcSWEET1 was probed by targeted mutagenesis. Four positions that correspond to substrate-binding pocket and intracellular gate features in the resolved crystal structure of the Oryza sativa SWEET2b (OsSWEET2b) were selected for mutagenesis (41): P52A, P154A, W185G, and N201A. While confocal micrographs revealed an increase in intracellular accumulation of the N201A variant, other mutations negligibly influenced trafficking (Supplementary FIG. 5). Loss-of-function was replicated for P52A and N201A mutants, while P154A and W185G demonstrated a reduction in activity (FIGS. 12 and 13). Plant SWEETs leverage a tetrad of proline residues as a key hinge during conformation changes (41), consistent with complete loss-of-function after mutagenesis in the homolog Arabidopsis thaliana SWEET1 (AtSWEET1). While these residues demonstrate high conservation in fungal SWEETs, our results suggest that the hinge may function differently in fungal SWEETs. Similarly, retention of activity by the W185G mutant is of interest given the conserved role of this aromatic residue in binding sugar substrates (16) and its high degree of conservation across all known SWEETs (30). The flexibility of the glycine substitution may enable residue F184 to act as a novel substitute for binding glucose. Further characterization of non-plant SWEETs is necessary to fully understand SWEET functional diversity.

[0083] 3.4 Sampling AGF SWEET Diversity Using Protein Chimeras

[0084] Poor functional production of AGF SWEETs in S. cerevisiae motivated the development of alternative approaches to sample and alter functional diversity. Our approach was driven by a previous study conducted by Tao et al. which described a beneficial, single cross-over chimera formed between OsSWEET2b and a close homolog, OsSWEET1a (41). The cross-over position was placed between TM4 and TM5, consistent with observed functional benefit in retaining an association of the N-terminal domain (TM1-3) and TM4 (43). Residues both before and after the cross-over position contribute to the structure of the substrate-binding pocket and intra-, extracellular gates (30, 41), suggesting that such protein chimeras can broadly sample NcSWEET1 sequence space. Further, a leading NcSWEET1 chassis should contribute N-terminal sequence features that support robust trafficking to the ER.

[0085] Growth complementation in EBY.VW4000 was used to assay the activity of single cross-over chimeras between NcSWEET1 and other AGF SWEETs on glucose, fructose, and mannose sugars (FIG. 4). NcSW1/ArSW3 and NcSW1/PfSW2 chimeras demonstrated enhanced activity on all substrates; NcSW1/NcSW3 strains had lower growth rates than the wild-type NcSWEET1; all other pairings generated a loss of function. Confocal micrographs of strains expressing functional chimera tagged with eGFP showed negligible signal at the cell periphery, seemingly inconsistent with improved growth rates on hexose sugars (FIG. 14). Significant sequence identity to NcSWEET1 appeared to benefit the retention of transport function, however the fusion to the closest homolog, NcSWEET4, yielded a non-functional chimera. We speculate that the poorly conserved C-terminal tail may be consequential for heterologous expression, yielding observed degrees of production compatibility. Accordingly, a truncated NcSWEET1 variant (NcSW1:Tr) and an additional PfSWEET2 chimera, formed by replacing the tail of NcSWEET1 with the tail of PfSWEET2 (NcSW1/PfSW2:Ct), were assayed (FIG. 15). The Ct chimera demonstrated reduce growth on all substrates, whereas the truncation of the NcSWEET1 C-terminus was beneficial to growth. The poor growth of the Ct variant suggests that residues of the PfSWEET2 tail are unlikely to contribute to the robust phenotype demonstrated by the initial NcSW1/PfSW2 chimera, comprising the four N-terminal transmembrane segments of NcSW1 and the three C-terminal transmembrane segments of PfSW2.

[0086] An additional set of four NcSWEET1:PfSWEET2 chimeras, with cross-over positions increasingly closer to the N-terminus of NcSWEET1, were assembled to further sample PfSWEET2 sequence diversity and to identify key residues that govern function. Of particular interest are positions in the primary protein sequence that allow modulation of substrate preference. The corresponding fusions were named TM4-7, TM3-7, TM2-7, and TM1-7, and contain 95, 71, 33, and 12 amino-terminal NcSWEET1 residues, respectively (FIGS. 16A and 16B). Remarkably, all PfSWEET2 chimeras were functionally expressed in EBY.VW4000 and demonstrated differential changes to activity on assayed hexose sugars (FIGS. 5 and 17). Surprisingly, the changes in activity were not continuous across the chimera; construct TM2-7 exhibited a robust phenotype closest to the TM5-7 chimera, whereas TM1-7 only facilitated glucose uptake. Also notable is chimera TM4-7, which demonstrates significant improvement to growth on fructose and mannose relative to glucose. It follows that the residues that differ between NcSWEET1 and PfSWEET2, in the span between the TM5-7 junction and the TM4-7 junction, likely modulate sugar affinities. Yet, these positions are predominantly within the poorly conserved linker TM domain, which is distal to the transport pathway in resolved crystal structures [OsSWEET2b, AtSWEET13] (41, 42). Similarly, the role of the three residues that differ between TM2-7 and TM1-7 that generate significant phenotypic differences, including differential sugar affinities, is poorly understood.

[0087] The TM1-7 chimera also revealed the sensitivity of AGF SWEET expression in S. cerevisiae, as the wild-type PfSWEET2 that fails to functionally express differs from the TM1-7 chimera by only six amino-terminal residues. A possible culprit is the lysine residue at position 6, as it adds a positive charge to the amino-terminus of PfSWEET2 and also reduces the transmembrane charge differential of TM1, which may influence the relative transmembrane orientation of the protein (46, 47).

[0088] 3.5 Anaerobic Fungal SWEETs Facilitate Xylose Transport

[0089] The functional characterization of SWEETs has revealed diverse substrate preferences for mono-, di-, tri-saccharides, and even plant hormones (18). However, studies have yet to assay the activity of any SWEET towards pentose sugar substrates, i.e., xylose. SWEETs may support low-affinity uptake akin to hexose transport systems in S. cerevisiae (48), even though xylose is not a native substrate. In fact, xylose appeared to inhibit AGF SWEET mediated mannose uptake in a dose-dependent manner indicative of competitive inhibition or transport (FIG. 18).

[0090] Genes encoding AGF SWEETs were expressed in a xylose-utilizing strain deficient in all native hexose and xylose transporters to validate preliminary evidence of xylose transport through growth complementation. Preliminary evaluation in strain SR8D8 revealed that both NcSWEET1 and the NcSW1/PfSW2:TM5-7 chimera supported growth on 2.5% xylose as the sole carbon source, indicative of xylose transport (FIG. 19).

[0091] Observed SWEET activity on xylose motivated the evaluation of glucose/xylose co-utilization by NcSWEET1 and robust PfSWEET2 chimeras. SR8D8 expressing various SWEETs were sub-cultured after growth on glycerol & ethanol into cultures supplemented with both 2.5% w/v glucose and 2.5% w/v xylose. In addition to monitoring culture growth, the consumption of both sugars was simultaneously measured using a YSI bioanalyzer (FIG. 7). SR8D8 expressing wild-type NcSWEET1 demonstrated a robust capacity for xylose utilization and co-consumption with glucose. Remarkably, NcSWEET1 significantly outperformed by the HXT7(F79S) variant. Co-utilization of glucose and xylose was also evident in SR8DR expressing TM5-7 or TM2-7 chimera. SR8D8 expressing TM3-7 chimera exhibited negligible xylose and moderate glucose utilization. SR8D8 expressing TM2-7 chimera demonstrated xylose utilization, unlike the TM3-7 variant, signifying that the three novel positions on TM2 can modulate the affinity for xylose. Diminished xylose utilization by SR8D8 expressing PfSWEET2 chimeras is consistent with the strong preference in PfSWEET2 for solely glucose sugar.

CONCLUSIONS

[0092] In this work, we produce functional anerobic gut fungal SWEET transporters in S. cerevisiae for characterization. To our knowledge, this is the first study to evaluate the utility of SWEETs in engineering S. cerevisiae sugar transport. Further, this is the first evaluation of the capacity of SWEETs to facilitate xylose transport. The transporter NcSWEET1 demonstrated broad activity on hexose sugars and xylose, which was improved by forming chimeras with other anaerobic fungal SWEETs. The wild-type NcSWEET1 and the best performing chimera derived from it, NcSW1/PfSW2:TM5-7, supported the co-utilization of glucose and xylose sugars. Additional chimeras have identified narrow sets of residues that appear to control substrate specificity. This work demonstrates that as few as three substitutions can toggle between activity solely on glucose or both on hexose sugars and xylose. These results show that anaerobic fungal SWEETs are useful for not only improving xylose uptake but also co-utilization of glucose and xylose in S. cerevisiae. We foresee that protein engineering methods can improve the activity of the best performing candidate, wild-type NcSWEET1, on xylose.

TABLE-US-00006 TABLE 5 Conservation of residues in fungal SWEETs at the 19 most conserved positions across eukaryotic SWEETs. Alignment to OsSWEET2 putatively assigned positions forming (or proximal to) the substrate-binding pocket and intra-, extra-facial gates. Residue Conservation Mutated Position in Amino Mutant Position in Eukaryotic Fungal AtSWEET1 Acids Activity Reference NcSWEET1 SWEETs.sup.a SWEETs Extracellular Gate.sup.b Y57 A Abolished (1) Y66 96% (Y) 98% (Y) G58 D Abolished (2) S67 60% (G) 57% (G) G131 D Abolished (3) G140 98% (G) 95% (G) Y179 A Reduced (2) Y188 94% (Y) 74% (D) D185 A Wild-Type (1) D194 93% (D) 66% (F) Substrate Binding Pocket.sup.b S54 A or C Wild-Type (1) Q63 68% (W) 81% (W) N73 A Abolished (1) N79 96% (N) 100% (N) W176 A Abolished (1) W185 90% (W) 100% (W) P191 T Abolished (3) P200 89% (P) 100% (P) N192 A Abolished (1) N201 96% (N) 98% (N) Intracellular Gate.sup.b P23 A Abolished (1) P18 77% (G) 73% (P) P43 A Abolished (1) P52 97% (P) 88% (P) Y83 A Reduced (3) Y89 90% (Y) 61% (Y) F87 A Abolished (3) M91 Not Conserved Not Conserved Y90 A Wild-Type (3) F94 41% (L) Not Conserved P145 A Abolished (1) P154 97% (P) 100% (P) K156 R Wild-Type (3) K165 78% (K) 50% (K) M161 A Abolished (3) I170 83% (M) Not Conserved P162 A Abolished (1) N171 94% (P) Not Conserved Q202 D Abolished (3) Q211 96% (Q) 95% (Q) .sup.aDetermined from Clustal Omega sequence alignment using protein sequences detailed in (3). .sup.bFrom alignment to OsSWEET2b (1) and AtSWEET13 (4) sequences with resolved crystal structures (1) Tao Y, Cheung L S, Li S, Eom J-S, Chen L-Q, et al. 2015. Structure of a eukaryotic SWEET transporter in a homotrimeric complex. Nature. 527(7577): 259-63 (2) Xuan Y H, Hu Y B, Chen L-Q, Sosso D, Ducat D C, et al. 2013. Functional role of oligomerization for bacterial and plant SWEET sugar transporter family. Proc. Natl. Acad. Sci. U.S.A. 110(39): E3685-94 (3) Jia B, Zhu X F, Pu Z J, Duan Y X, Hao L J, et al. 2017. Integrative View of the Diversity and Evolution of SWEET and SemiSWEET Sugar Transporters. Front. Plant Sci. 8: 2178 (4) Han L, Zhu Y, Liu M, Zhou Y, Lu G, et al. 2017. Molecular mechanism of substrate recognition and transport by the AtSWEET13 sugar transporter. Proc. Natl. Acad. Sci. U.S.A. 114(38): 10089-94

[0093] References cited herein: [0094] 1. Sharma N K, Behera S, Arora R, Kumar S, Sani R K. 2018. Xylose transport in yeast for lignocellulosic ethanol production: Current status. J. Biosci. Bioeng. 125(3):259-67 [0095] 2. Lian J, Li Y, HamediRad M, Zhao H. 2014. Directed evolution of a cellodextrin transporter for improved biofuel production under anaerobic conditions in Saccharomyces cerevisiae. Biotechnol. Bioeng. 111(8): 1521-31 [0096] 3. Gárdonyi M, Jeppsson M, Lidén G, Gorwa-Grauslund M F, Hahn-Hagerdal B. 2003. Control of xylose consumption by xylose transport in recombinant Saccharomyces cerevisiae. Biotechnol. Bioeng. 82(7):818-24 [0097] 4. Kim S R, Ha S-J, Wei N, Oh E J, Jin Y-S. 2012. Simultaneous co-fermentation of mixed sugars: a promising strategy for producing cellulosic ethanol. Trends Biotechnol. 30(5):274-82 [0098] 5. Jeffries T W. 1983. Utilization of xylose by bacteria, yeasts, and fungi. In Pentoses and Lignin, pp. 1-32. Berlin/Heidelberg: Springer-Verlag [0099] 6. Eliasson A, Christensson C, Wahlbom C F, Hahn-Hagerdal B. 2000. Anaerobic xylose fermentation by recombinant Saccharomyces cerevisiae carrying XYL1, XYL2, and XKS1 in mineral medium chemostat cultures. Appl. Environ. Microbiol. 66(8):3381-86 [0100] 7. Kim B, Du J, Eriksen D T, Zhao H. 2013. Combinatorial design of a highly efficient xylose-utilizing pathway in Saccharomyces cerevisiae for the production of cellulosic biofuels. Appl. Environ. Microbiol. 79(3):931-41 [0101] 8. Shen Y, Chen X, Peng B, Chen L, Hou J, Bao X. 2012. An efficient xylose-fermenting recombinant Saccharomyces cerevisiae strain obtained through adaptive evolution and its global transcription profile. Appl. Microbiol. Biotechnol. 96(4): 1079-91 [0102] 9. Young E, Poucher A, corner A, Bailey A, Alper H. 2011. Functional survey for heterologous sugar transport proteins, using Saccharomyces cerevisiae as a host. Appl. Environ. Microbiol. 77(10):3311-19 [0103] 10. Moysés D N, Reis VCB, de Almeida JRM, de Moraes LMP, Torres FAG. 2016. Xylose Fermentation by Saccharomyces cerevisiae: Challenges and Prospects. Int. J. Mol. Sci. 17(3):207 [0104] 11. Hou J, Qiu C, Shen Y, Li H, Bao X. 2017. Engineering of Saccharomyces cerevisiae for the efficient co-utilization of glucose and xylose. FEMS Yeast Res. 17(4): [0105] 12. Seppälä S, Solomon K V., Gilmore S P, Henske J K, O'Malley M A. 2016. Mapping the membrane proteome of anaerobic gut fungi identifies a wealth of carbohydrate binding proteins and transporters. Microb. Cell Fact. 15(1):212 [0106] 13. Seppala S, Yoo J I, Yur D, O'Malley M A. 2019. Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae. Metab. Eng. Commun. 9:e00091 [0107] 14. Yoo J I, Seppälä S, O'Malley M A. 2020. Engineered fluoride sensitivity enables biocontainment and selection of genetically-modified yeasts. Nat. Commun. [0108] 15. Flint H J. 1997. The rumen microbial ecosystem—some recent developments. Trends Microbiol. 5(12):483-88 [0109] 16. Theodorou M K, Mennim G, Davies D R, Zhu W-Y, Trinci A P J, Brookman J L. 1996. Anaerobic fungi in the digestive tract of mammalian herbivores and their potential for exploitation. Proc. Nutr. Soc. 55(03):913-26 [0110] 17. Henske J K, Gilmore S P, Haitjema C H, Solomon K V., O'Malley M A. 2018. Biomass-degrading Enzymes are Catabolite Repressed in Anaerobic Gut Fungi. AIChE J. 00(0):1-8 [0111] 18. Jeena G S, Kumar S, Shukla R K. 2019. Structure, evolution and diverse physiological roles of SWEET sugar transporters in plants. Plant Mol. Biol. 100(4-5):351-65 [0112] 19. Solomon K V., Haitjema C H, Henske J K, Gilmore S P, Borges-Rivera D, et al. 2016. Early-branching gut fungi possess a large, comprehensive array of biomass-degrading enzymes. Science (80-.). 351(6278):1192-96 [0113] 20. El-Gebali S, Mistry J, Bateman A, Eddy S R, Luciani A, et al. 2018. The Pfam protein families database in 2019. Nucleic Acids Res. 47:427-32 [0114] 21. Finn R D, Clements J, Eddy S R. HMMER web server: interactive sequence similarity searching [0115] 22. Chen L-Q, Hou B-H, Lalonde S, Takanaga H, Hartung M L, et al. 2010. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature. 468(7323):527-32 [0116] 23. Grigoriev I V, Nikitin R, Haridas S, Kuo A, Ohm R, et al. 2014. MycoCosm portal: gearing up for 1000 fungal genomes. Nucleic Acids Res. 42 (Database issue):D699-704 [0117] 24. Tsirigos K D, Peters C, Shu N, Kall L, Elofsson A. 2015. The TOPCONS web server for consensus prediction of membrane protein topology and signal peptides. Nucleic Acids Res. 43(W1):W401-7 [0118] 25. Fu L, Niu B, Zhu Z, Wu S, Li W. 2012. CD-HIT: Accelerated for clustering the next-generation sequencing data. Bioinformatics. 28(23):3150-52 [0119] 26. Sievers F, Wilm A, Dineen D, Gibson T J, Karplus K, et al. 2014. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7(1):539-539 [0120] 27. Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 30(9): 1312-13 [0121] 28. Miller M A, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees [0122] 29. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33(7):1870-74 [0123] 30. Jia B, Zhu X F, Pu Z J, Duan Y X, Hao L J, et al. 2017. Integrative View of the Diversity and Evolution of SWEET and SemiSWEET Sugar Transporters. Front. Plant Sci. 8:2178 [0124] 31. Wieczorke R, Krampe S, Weierstall T, Freidel K, Hollenberg C P, Boles E. 1999. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS Lett. 464(3):123-28 [0125] 32. Kim S R, Skerker J M, Kang W, Lesmana A, Wei N, et al. 2013. Rational and Evolutionary Engineering Approaches Uncover a Small Set of Genetic Changes Efficient for Rapid Xylose Fermentation in Saccharomyces cerevisiae. PLoS One. 8(2):e57048 [0126] 33. Xu H. 2015. ENGINEERING SACCHAROMYCES CEREVISIAE FOR CELLULOSIC ETHANOL PRODUCTION. University of Illinois at Urbana-Champaign. 1-87 pp. [0127] 34. Reider Apel A, Ouellet M, Szmidt-Middleton H, Keasling J D, Mukhopadhyay A. 2016. Evolved hexose transporter enhances xylose uptake and glucose/xylose co-utilization in Saccharomyces cerevisiae. Sci. Rep. 6(1):19512 [0128] 35. Gietz R D, Woods R A. 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350:87-96 [0129] 36. Nørholm MEM. 2010. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering. BMC Biotechnol. 10(1):21 [0130] 37. Cavaleiro A M, Kim S H, Seppala S, Nielsen M T, Norholm M H H. 2015. Accurate DNA Assembly and Genome Engineering with Optimized Uracil Excision Cloning. ACS Synth. Biol. 4(9): 1042-46 [0131] 38. Solomon K V, Haitjema C H, Henske J K, Gilmore S P, Borges-Rivera D, et al. 2016. Early-branching gut fungi possess a large, comprehensive array of biomass-degrading enzymes. Science (80-.). 351(6278): 1192-95 [0132] 39. Henske J K, Gilmore S P, Knop D, Cunningham F J, Sexton J A, et al. 2017. Transcriptomic characterization of Caecomyces churrovis: A novel, non-rhizoid-forming lignocellulolytic anaerobic fungus. Biotechnol. Biofuels. 10(1):1-12 [0133] 40. Hu Y-B, Sosso D, Qu X-Q, Chen L-Q, Ma L, et al. 2016. Phylogenetic evidence for a fusion of archaeal and bacterial SemiSWEETs to form eukaryotic SWEETs and identification of SWEET hexose transporters in the amphibian chytrid pathogen Batrachochytrium dendrobatidis. FASEB J. [0134] 41. Tao Y, Cheung L S, Li S, Eom J-S, Chen L-Q, et al. 2015. Structure of a eukaryotic SWEET transporter in a homotrimeric complex. Nature. 527(7577):259-63 [0135] 42. Han L, Zhu Y, Liu M, Zhou Y, Lu G, et al. 2017. Molecular mechanism of substrate recognition and transport by the AtSWEET13 sugar transporter. Proc. Natl. Acad. Sci. U.S.A 114(38): 10089-94 [0136] 43. Xuan Y H, Hu Y B, Chen L-Q, Sosso D, Ducat D C, et al. 2013. Functional role of oligomerization for bacterial and plant SWEET sugar transporter family. Proc. Natl. Acad. Sci. U.S.A 110(39):E3685-94 [0137] 44. Chorev M, Carmel L. 2012. The Function of Introns. Front. Genet. 3:55 [0138] 45. Haitjema C H, Gilmore S P, Henske J K, Solomon K V., de Groot R, et al. 2017. A parts list for fungal cellulosomes revealed by comparative genomics. Nat. Microbiol. 2(8):17087 [0139] 46. Wallin E, von Heijne G. 1998. Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms. Protein Sci. 7(4):1029-38 [0140] 47. Harley C A, Holt J A, Turner R, Tipper D J. 1998. Transmembrane protein insertion orientation in yeast depends on the charge difference across transmembrane segments, their total hydrophobicity, and its distribution. J. Biol. Chem. 273(38):24963-71 [0141] 48. Hamacher T, Boles E, Gardonyi M, Hahn-Hagerdal B, Becker J. 2002. Characterization of the xylose-transporting properties of yeast hexose transporters and their influence on xylose utilization. Microbiology. 148(9):2783-88

[0142] It is to be understood that, while the invention has been described in conjunction with the preferred specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages, and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.

[0143] All patents, patent applications, and publications mentioned herein are hereby incorporated by reference in their entireties.

[0144] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.