Porcine parvovirus

Abstract

The present invention relates to a novel porcine parvovirus, to proteins of the virus and to vaccines based upon the virus and proteins thereof. The invention also relates to DNA fragments comprising a gene of the virus and to DNA vaccines based upon genes of the virus. Further the invention relates to antibodies that are reactive with the novel virus and to diagnostic tests for the detection of the virus or antibodies against the virus.

Claims

1. A DNA fragment comprising a gene encoding a Capsid Protein (CP) wherein the nucleotide sequence of said gene has at least 80% identity to the nucleotide sequence of SEQ ID NO: 1.

2. The CP encoded by the DNA fragment of claim 1.

3. A DNA fragment comprising a gene encoding a non-structural protein 1 (NS1), wherein the nucleotide sequence of said gene has at least 80% identity to the nucleotide sequence of SEQ ID NO: 3.

4. The NS1 encoded by the DNA fragment of claim 3.

5. The DNA fragment of claim 1, wherein the CP gene is under the control of a functional heterologous promoter.

6. An immortalized cell culture comprising an isolated virus which is a member of the sub-family Parvovirinae of the family of the Parvoviridae, said virus being characterized in that: a) the virus has a viral genome comprising a gene encoding a Capsid Protein (CP) and a gene encoding a non-structural protein 1 (NS1), wherein a) the CP is encoded by a nucleic acid sequence of SEQ ID NO: 1, or b) the CP is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 1, which encodes a polypeptide of SEQ ID NO: 2; and wherein: a) the NS1 is encoded by a nucleic acid sequence of SEQ ID NO: 3, or b) the NS1 is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 3, which encodes a polypeptide of SEQ ID NO: 4; and a pharmaceutically acceptable carrier selected from the group consisting of saline or aqueous buffers.

7. A method of generating an immune response in a mammal, comprising administering an immunologically-effective amount of isolated virus which is a member of the sub-family Parvovirinae of the family of the Parvoviridae, said virus being characterized in that: a) the virus has a viral genome comprising a gene encoding a Capsid Protein (CP) and a gene encoding a non-structural protein 1 (NS1), wherein a) the CP is encoded by a nucleic acid sequence of SEQ ID NO: 1, or b) the CP is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 1, which encodes a polypeptide of SEQ ID NO: 2; and wherein: a) the NS1 encoded by a nucleic acid sequence of SEQ ID NO: 3, or b) the NS1 is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 3, which encodes a polypeptide of SEQ ID NO: 4; and a pharmaceutically acceptable carrier selected from the group consisting of saline or aqueous buffers.

8. An immortalized cell culture comprising an isolated virus which is a member of the sub-family Parvovirinae of the family of the Parvoviridae, said virus being characterized in that: a) the virus has a viral genome comprising a gene encoding a Capsid Protein (CP) and a gene encoding a non-structural protein 1 (NS1), wherein a) the CP is encoded by a nucleic acid sequence of SEQ ID NO: 1, or b) the CP is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 1; and wherein: a) the NS1 is encoded by a nucleic acid sequence of SEQ ID NO: 3, or b) the NS1 is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 3; and a pharmaceutically acceptable carrier selected from e group consisting of saline or aqueous buffers.

9. A method of generating an immune response in a mammal, comprising administering an immunologically-effective amount of isolated virus which is a member of the sub-family Parvovirinae of the family of the Parvoviridae, said virus being characterized in that: a) the virus has a viral genome comprising a gene encoding a Capsid Protein (CP) and a gene encoding a non-structural protein 1 (NS1), wherein a) the CP is encoded by a nucleic acid sequence of SEQ ID NO: 1, or b) the CP is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 1; and wherein: a) the NS1 is encoded by a nucleic acid sequence of SEQ ID NO: 3, or b) the NS1 is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 3; and a pharmaceutically acceptable carrier selected from the group consisting of saline or aqueous buffers.

10. A method of generating an immune response in a mammal, comprising administering an immunologically-effective amount of an empty capsid protein of a virus which is a member of the sub-family Parvovirinae of the family of the Parvoviridae, said virus being characterized in that: a) the virus has a viral genome comprising a gene encoding a Capsid Protein (CP) and a gene encoding a non-structural protein 1 (NS1), wherein a) the CP is encoded by a nucleic acid sequence of SEQ ID NO: 1, or b) the CP is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 1; and wherein: a) the NS1 is encoded by a nucleic acid sequence of SEQ ID NO: 3, or b) the NS1 is encoded by a nucleic acid sequence 90% identical to SEQ ID NO: 3; and a pharmaceutically acceptable carrier selected from the group consisting of saline or aqueous buffers.

11. A method of generating an immune response in a mammal according to claim 10, characterized in that the empty capsid protein is baculovirus expressed.

Description

EXAMPLES

Example 1: Analysis of Diseased Animals of Samples Set 1

(1) Description of Sample Set 1

(2) Sample set 1: 17 animals, 16 male/1 female pigs, aged 18-27 weeks. 7 Farms. Received 31 Jul. 2013. Clinical symptoms: Animals suddenly developed abdominal distension, some of them screamed before dying. There were no symptoms noted during the weeks before death. The timing between the observation of first symptoms and death was 2-6 hours. After onset of symptoms, animals were euthanized by electrocution and necropsied.

(3) Organ symptoms: Abnormalities in small intestine. Hemorrhagic symptoms, thin intestinal wall, bloody fluid in intestines. No abnormalities in other organs, except for enlarged, red-appearing, oedemic lymph nodes. See FIG. 3.

(4) Organs were frozen at 70 C. Serum was prepared from clotted blood by centrifugation at 3000g and subsequent storage at 70 C.

(5) PCR Protocols:

(6) Isolated DNA was screened by PCR using primers derived from the viral sequences (table 1). PCRs were performed using standard methods with an annealing temperature of 58 C. for the Bowl_ORF1_774_F/1626R primer set, and 52 C. for the Bowl_Q_ORF2_FW/REV primer set. A probe was designed for Q-PCR (table 1). Q-PCR was done using standard method with an annealing temperature of 50 C. Q-PCR data was analysed using Bio-Rad CFX Manager 2.0.

(7) TABLE-US-00001 TABLE1 PrimersequencesBowl Primer/probe: Sequence(5-3): SEQIDNO: Bowl_ORF1_774_F TGTTGAGTGTGGTGGATTGG SEQIDNO:7 Bowl_ORF1_1626_R AAGGAAGCTGGACCGAGAG SEQIDNO:8 Bowl_Q_ORF2_FW CTACATCTGCGCCTGAC SEQIDNO:5 Bowl_Q_ORF2_REV GTGGTGAGAAGGCAAGAC SEQIDNO:6 Bowl_Q_ORF2_PROBE 6FAM-CACGAGCTAGAGCGTGCTAAACAG- SEQIDNO:9 BHQ1
Results PCR Analysis:

(8) The results of the PCR analysis are depicted in Table 2. In total, 76% of the samples was found positive.

(9) TABLE-US-00002 TABLE 2 Results analysis of samples of set 1. Animal number 1 2 3 4 5 6 7 8 9 10 Sex M M M M M M M M M F Age (weeks) 19 23 23 18 20 19 18 23 26 18 Location 13-3A 13-3A 13-3A 10-3A 10-3A 3-3 3-3 13-3A 5-3 10-3A serum + n/a + rectal swap + blood + + + lymph node + + + n/a n/a + + overall + + + + + + Animal number total per- 11 12 13 14 15 16 17 score centage Sex M M M M M M M Age (weeks) 23 20 23 18 25 22 27 Location 13-3A 10-3A 12-3B 12-3B 12-3B 8-3 11-3B serum n/a n/a + + + 5/14 36 rectal swap 1/17 6 blood + + + + + 8/17 47 lymph node + + + + + + + 12/15 80 overall + + + + + + + 13/17 76 +: positive for new parvovirus. negative for new parvovirus

Example 2: Analysis of Diseased Animals of Samples Set 2

(10) Description of Sample Set 2

(11) 16 animals, 13 male/3 female pigs, aged 12-26 weeks. 7 Farms, 4 additional farms compared to sample set 1 (total of 11 farm in sample set 1+2). Received 22 Aug. 2013.

(12) Clinical symptoms: Animals suddenly developed abdominal distension, some of them screamed before dying. There were no symptoms noted during the weeks before death. The timing between the observation of first symptoms and death was 2-6 hours. After onset of symptoms, animals were euthanized by electrocution prior and necropsied.

(13) Organ symptoms: Abnormalities in small intestine. Hemorrhagic symptoms, thin intestinal wall, bloody fluid in intestines. No abnormalities in other organs, except for enlarged, red-appearing, oedemic lymph nodes. See FIG. 3. Not all lymph nodes and blood samples were tested.

(14) Organs were frozen at 70 C. Serum was prepared from clotted blood by centrifugation at 3000g and subsequent storage at 70 C.

(15) PCR Protocols:

(16) Isolated DNA was screened by PCR using primers derived from the viral sequences (table 1). PCRs were performed using standard methods with an annealing temperature of 58 C. for the Bowl_ORF1_774_F/1626R primer set, and 52 C. for the Bowl_Q_ORF2_FW/REV primer set. A probe was designed for Q-PCR (table 1). Q-PCR was done using standard method with an annealing temperature of 50 C. Q-PCR data was analysed using Bio-Rad CFX Manager 2.0.

(17) Results PCR Analysis:

(18) The results of the PCR analysis are depicted in Table 3. In total, 25% of the samples was found positive. Blood was not analysed. Only two lymph nodes were analysed.

(19) TABLE-US-00003 TABLE 3 Results analysis of samples of set 2. Animal number 1 2 3 4 5 6 7 8 9 10 Sex M F F F M M M M M M Age (weeks) 19 12 23 22 26 26 24 18 18 22 Location 17-3E 9-3B 9-3B 9-3B 12-3B 12-3B 12-3B 13-3B 13-3B 13-3A serum + + + rectal swap + blood n/a n/a n/a n/a n/a n/a n/a n/a n/a n/a lymph node n/a n/a n/a n/a n/a n/a n/a n/a + overall + + + Animal number total per- 11 12 13 14 15 16 score centage Sex M M M M M M Age (weeks) 22 20 20 24 21 22 Location 13-3A 3-3 3-3 1-3B 1-3B 1-3B serum + 4/16 25 rectal swap 1/16 6 blood n/a n/a n/a n/a n/a n/a 0/0 0 lymph node n/a n/a n/a n/a n/a n/a 1/2 50 overall + 4/16 25 +: positive for new parvovirus. negative for new parvovirus

Example 3: Replication of New Parvovirus in Pigs

(20) Preparation of Animal Material:

(21) Frozen organ material and feces of sample sets 1 and 2 were stored at 70 C. prior to analysis. All procedures were carried out on ice. Organs were defrosted and subsequently homogenized (10% w/v) in tissue culture medium. The homogenate was freeze-thawed once (70 C.). Subsequently, the homogenate was centrifuged and filtered on 5 m, 0.45 m and 0.22 m filters to remove remaining tissue material.

(22) The filtered homogenate was stored at 70 C. until inoculation.

(23) Inoculums (A or B) were given as a 42 mL IM dose (4 different organs, left neck, right neck, left leg, right leg) and an oral dose of 20 mL (10 feces homogenate +42.5 ml homogenate of different organs). Inoculums were administered at room temperature.

(24) Inoculum A: Animal 10 Sample Set 2 (See Example 2)

(25) Feces, Lymph nodes, Lung, Spleen, Intestine

(26) Inoculum B: Animal 2 Sample Set 1 (See Example 1)

(27) Feces, Lymph nodes, Lung, Kidney, Liver

(28) Animals

(29) Thirteen pigs (5 Boars/8 gilts/Landrace/high health status/SPF/12-14 weeks of age at time of inoculation) were bred and raised at the MSD farm in Stevensbeek, the Netherlands and housed according to institutional guidelines. The animals were screened for presence of the new parvovirus in serum, feces, nasal swabs and eye swabs prior to inoculation as described in Example 1. One male animal was sacrificed as control animal (not infected). The other twelve pigs were housed in 3 separate groups.

(30) Treatment

(31) Group 1: Five Animals

(32) Three animals received inoculum A, two served as contact sentinels

(33) Group 2: Four Animals

(34) Three animals received inoculum B, two served as contact sentinel

(35) Group 3: Three Animals

(36) Three animals received inoculum B

(37) Sampling and Necropsy

(38) Group 1, 2:

(39) Blood samples, rectal/nasal/eye swabs on day 3, 0, 7, 14, 21, 28 after inoculation (if not sacrificed)

(40) Rectal/nasal/eye swabs on day 3, 10, 17, 24 after inoculation (if not sacrificed)

(41) Group 3:

(42) Blood samples, rectal/nasal/eye swabs on day 4, 0, 3, 6 after inoculation (if not sacrificed)

(43) Based on the PCR results, the animals were scheduled for necropsy:

(44) Group 1:

(45) Inoculated: day 10 p.i.; day 25 p.i.; day 31 p.i.

(46) Sentinel: day 18 p.i.; day 31 p.i

(47) Group 2:

(48) Inoculated: day 14 p.i.; day 29 p.i (2 animals)

(49) Sentinel: day 22 p.i.

(50) Group 3:

(51) Inoculated: day 4 p.i. (1 animal); day 7 p.i. (2 animals).

(52) Results

(53) PCR

(54) Animal 10 sample set 2 used for inoculum:

(55) All organs tested positive for new parvovirus: Feces, Lymph nodes, Lung, Spleen, Intestine, Kidney, Liver

(56) Animal 2 sample set 1 used for inoculum:

(57) All organs tested positive for new parvovirus: Feces, Lymph nodes, Lung, Kidney, Liver

(58) Animal Experiment

(59) Result of PCR on swabs/sera: Table 4A-B-C

(60) Organ samples were taken for histology, for PCR analysis and for virus isolation. Organs for virus isolation were stored at 70 C. Hepatic lymph nodes (10% homogenates) were analysed using PCR.

(61) Group 1: all inoculated animals serum + (positive) on day 7

(62) Sentinel serum (negative) on day 7

(63) Swabs: see Table 4A

(64) Group 2: all inoculated animals serum + on day 7

(65) Sentinel serum on day 7

(66) Swabs: see Table 4B

(67) Group 3: all inoculated animals serum + on day 4

(68) Swabs: see Table 4C

(69) PCR Results

(70) TABLE-US-00004 d. 10 p.i. d. 14 p.i. Necropsied organ (inoculum A, group 1) (inoculum B, group 2) Serum positive positive Spleen positive positive Mesenteric Lymph Node positive positive Hepatic Lymph Node positive positive Inguinal Lymph Node positive positive Lung positive positive Tonsil positive positive Kidney positive positive Nasal mucosa positive positive Large Intestine positive positive Liver positive positive Small Intestine positive positive Stomach positive positive Brain positive positive Bile weakly positive weakly positive 50% Small Intestine not detected not detected Content 25% Large Intestine not detected not detected Content Urine not detected not detected
Results Lymph Nodes

(71) Hepatic lymph nodes of all 13 animals collected at time of necropsy were homogenized 10% (w/v) in culture medium. DNA was isolated from the homogenate and presence of virus was analysed by PCR. The control lymph node was negative for new parvovirus, all 12 inoculated or sentinel pigs were positive for virus.

(72) Conclusion:

(73) On the basis of the data presented above, it can be concluded that the new parvovirus replicates in pigs.

(74) The route of transmission most likely oral/nasal via direct contact, but oral/fecal transmission and transmission through the air cannot be excluded. Fecal excretion is however limited.

(75) The virus is found in multiple organs.

(76) Based on the combined results in Example 1-3 it is expected that in a subset of animals; in about 1-2% of total infected animals, infection with the new parvovirus causes disease around the time of appearance of the virus in the blood (viremia). Shedding in the feces is minimal, but virus remains present in the blood >30 days after infection. Also nasal and eye swabs remain PCR positive >30 days after infection. In the infected pigs as described in Example 3, no hemorrhagic bowel syndrome was observed, but this was to be expected, based on both a low incidence of the disease; 1-2% in general population and the fact that the animals used in Example 3 were relatively young and in excellent condition. They had, other than pigs in a commercial farm setting, no predisposing risk factors.

(77) TABLE-US-00005 TABLE 4A Results group 1: 3 infected animals and 2 sentinels, Inoculum A day post inoculation Animal Sample 3 0 3 7 10 14 17 21 24 28 BOWL 1 R + + BOWL 1 N + + + + + BOWL 1 E + + + + BOWL 1 S n/a n/a + n/a + n/a + n/a + BOWL 2 R + BOWL 2 N + + BOWL 2 E + BOWL 2 S n/a n/a + + BOWL 3 R + BOWL 3 N + + + + + BOWL 3 E + + + + BOWL 3 S n/a n/a + n/a + n/a + n/a sentinel 1 R sentinel 1 N + + sentinel 1 E + + sentinel 1 S n/a n/a n/a + n/a sentinel 2 R + sentinel 2 N + + + + + sentinel 2 E + + + + sentinel 2 S n/a n/a n/a + n/a + n/a + The novel porcine parvovirus according to the invention is referred to as BOWL. R: rectal swab N: nasal swab E: eye swab S: serum n/a: not analysed (not sampled)

(78) TABLE-US-00006 TABLE 4B Results group 2: 3 infected animals and 1 sentinel, Inoculum B day post inoculation Animal Sample 3 0 3 7 10 14 17 21 24 28 BOWL 1 R + BOWL 1 N + + + BOWL 1 E + + + BOWL 1 S n/a n/a + n/a + BOWL 2 R + BOWL 2 N + + + + BOWL 2 E + + + + + BOWL 2 S n/a n/a + n/a + n/a + n/a + BOWL 3 R BOWL 3 N + + + + + + + BOWL 3 E + + + + BOWL 3 S n/a n/a + n/a + n/a + n/a + sentinel 1 R + sentinel 1 N + + + + sentinel 1 E + + + sentinel 1 S n/a n/a n/a + n/a + The novel porcine parvovirus according to the invention is referred to as BOWL. R: rectal swab N: nasal swab E: eye swab S: serum n/a: not analysed (not sampled)

(79) TABLE-US-00007 TABLE 4C Results group 3: 3 infected animals, Inoculum B day post inoculation Animal Sample 4 0 3 6 BOWL 1 R BOWL 1 N + BOWL 1 E + BOWL 1 S + + BOWL 2 R BOWL 2 N BOWL 2 E BOWL 2 S + BOWL 3 R BOWL 3 N + BOWL 3 E BOWL 3 S + + The novel porcine parvovirus according to the invention is referred to as BOWL. R: rectal swab N: nasal swab E: eye swab S: serum n/a: not analysed (not sampled)

LEGEND TO THE FIGURES

(80) FIG. 1: phylogenetic tree indicating the relatedness of the NS1 of the novel porcine parvovirus according to the invention, to the NS1 of other parvoviruses. The novel porcine parvovirus according to the invention is referred to as BOWL.

(81) FIG. 2: phylogenetic tree indicating the relatedness of the Capsid Protein of the novel porcine parvovirus according to the invention, to the Capsid Protein of other parvoviruses. The novel porcine parvovirus according to the invention is referred to as BOWL.

(82) FIG. 3: example of hemorrhagic bowel syndrome as seen in Sample set 1 and 2

LITERATURE REFERENCES

(83) 1) Harris, Hank. Hemorrhagic Bowel Syndrome in PigsDigestive System. Merck Veterinary Manual, 2018, merckvetmanual.com/digestive-system/intestinal-diseases-in-pigs/hemorrhagic-bowel-syndrome-in-pigs. 2) Hni et al. (1993) Schweiz Arch Tierheilkd. 135:117-124 3) People. Pigs. Planet. Pork Checkoff, pork.org. 4) Streck et al., Journal of General Virology 92: 2628-2636 (2011) 5) Ren et al., Virus research 178: 392-397 (2013) 6) Xiao et al., Veterinary Microbiology 161: 325-330 (2013) 7) Opriessnig et al., Veterinary Microbiology 163: 177-183 (2013) 8) Chenbin Li et al., Archives of Virology 158: 1987-1991 (2013) 9) Xiao et al., Veterinary Microbiology 160: 290-296 (2012) 10) Cadar et al., Archives of Virology 156: 2233-2239 (2011) 11) Lau et al., Journal of General Virology 89: 1840-1848 (2008) 12) Cheung et al., Archives of Virology 155: 801-806 (2010) 13) Huang et al., Virology Journal 7: 333-336 (2010) 14) Cheung et al., Archives of Virology 156: 2071-2078 (2011) 15) Xiao et al., PLoS One 8: e65312. (2013) 16) Xiao et al., Genome Announcements 1:e00021-12. (2013) 17) Cheng et al., PLoS One 5: e13583. (2010) 18) Martinez et al., Vaccine 10: 684-690 (1992) 19) Casal et al., Biotechnology and Applied Biochemistry 29: 141-150 (1999) 20) Zhou et al, Virology Journal 7: 366 (2010) 21) Hao Feng, PlosOne; Jan. 17, 2014, DOI: 10.1371/journal.pone.007957 22) Saliki et al., Journ. Gen. Virol. 73: 369-74 (1992) 23) Brown et al., Journ. of Virol. 65: 2702 (1991) 24) Baculovirus Expression Vectors, A Laboratory Manual. By David R. O'Reilly, Lois K. Miller, and Verne A. Luckow. Publisher: Oxford University Press, USA ISBN-10: 0195091310 (Sep. 23, 1993), ISBN-13: 978-0195091311 (May 1994). 25) Baculovirus and Insect Cell Expression Protocols. In: Methods in Molecular Biology, Volume 388 (2007). Editors: David W. Murhammer. ISBN: 978-1-58829-537-8 (Print) 978-1-59745-457-5 (Online) 26) Fujisaki, Y., and Murikami, Y (1982). Immunity to infection with porcine parvovirus in pigs inoculated with attenuated HT-strain. Natl Inst Anim Health (Tokyo) 22: 36-37 27) Chen et al., Virology Journal 8:307 (2011) 28) Mayer et al., Vaccine 22: 317-328 (2004) 29) Production of recombinant proteins: novel microbial and eukaryotic expression systems by Gerd Gellissen, ISBN: 3-527-31036-3 30) Gerdts et al, Journal of General Virology 78: 2139-2146 (1997) 31) Gorres et al., Clinical Vaccine Immunology 18: 1987-1995 (2011) 32) Paul & Mengeling, Am. J. Vet. Res.: 41: 2007-2011 (1980) 33) Paul & Mengeling, Am. J. Vet. Res.: 45: 2481-2485 (1984) 34) Fujisaki e& Murakami, Nat. Inst. of Animal Health quarterly (Tokyo) 22: 36-37 (1982) 35) Mayer and Walter, eds Immunochemical Methods in Cell and Molecular Biology, Academic Press, London, 1987) 36) Kohler and Milstein, Nature, 256: 495-497 (1975) 37) Qiu et al., J. Virol. 79: 11035-11044 (2005) 38) Wang et al., J. Virol. Meth. 200: 41-46 (2014) 39) Guan et al., J. Virol. 83: 9541-9553 (2009)