Neuropilin-1 specific binding peptide, fusion protein fused with same, and use thereof
10400022 ยท 2019-09-03
Assignee
Inventors
Cpc classification
C07K14/705
CHEMISTRY; METALLURGY
A61K47/64
HUMAN NECESSITIES
G01N33/6845
PHYSICS
C07K2319/30
CHEMISTRY; METALLURGY
G01N2333/70596
PHYSICS
C07K19/00
CHEMISTRY; METALLURGY
G01N33/57492
PHYSICS
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
G01N33/6872
PHYSICS
A61K9/127
HUMAN NECESSITIES
A61K47/68
HUMAN NECESSITIES
C40B30/04
CHEMISTRY; METALLURGY
A61K31/704
HUMAN NECESSITIES
A61K47/50
HUMAN NECESSITIES
G01N33/53
PHYSICS
A61K31/704
HUMAN NECESSITIES
International classification
C07K14/705
CHEMISTRY; METALLURGY
A61K9/127
HUMAN NECESSITIES
G01N33/53
PHYSICS
A61K47/50
HUMAN NECESSITIES
Abstract
A peptide that binds specifically to neuropilin-1 (NRP1) without binding to neuropilin-2 (NRP2) is provided. A fusion protein, a fusion antibody, small-molecule drug, a nanoparticle, or a liposome, which comprises the peptide, and a pharmaceutical composition for treating or preventing cancer or angiogenesis-related diseases, and a composition for diagnosing cancer or angiogenesis-related diseases are provided. A polynucleotide encoding the peptide that binds specifically to NRP1 and a method for screening the peptide that binds specifically to NRP1 are provided. An antibody heavy-chain constant region Fc-fused peptide binding specifically to NRP1 has the property of binding specifically to NRP1, and thus when it is administered in vivo, it accumulates selectively in tumor tissue, and widens the intercellular space between tumor-associated endothelial cells to promote its extravasation and increases its tumor tissue penetration.
Claims
1. A peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3.
2. The peptide of claim 1, wherein the peptide has tumor tissue-penetrating activity and/or anti-angiogenesis activity.
3. The peptide of claim 1, wherein the peptide further comprises a linker peptide.
4. The peptide of claim 3, wherein the linker peptide consists of 1 to 50 amino acids.
5. The peptide of claim 3, wherein the linker peptide comprises the amino acid sequence of (GGGGS)n (SEQ ID NO:10), wherein n is each independently an integer between 1 and 20.
6. The peptide of claim 5, wherein the peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 6.
7. A fusion protein comprising the peptide of claim 1 and a biologically active agent which is fused to the peptide of claim 1.
8. The fusion protein of claim 7, wherein the biologically active agent is selected from the group consisting of an antibody, antibody fragment, immunoglobulin, peptide, enzyme, growth factor, cytokine, transcription factor, toxin, antigen peptide, hormone, carrier protein, motor function protein, receptor, signaling protein, storage protein, membrane protein, transmembrane protein, internal protein, external protein, secretory protein, viral protein, glycoprotein, cleaved protein, protein complex, and chemically modified protein.
9. The fusion protein of claim 7, wherein the fusion protein binds to neuropilin-1 bivalently or multivalently.
10. The fusion protein of claim 7, wherein the fusion protein further comprises a linker peptide.
11. The fusion protein of claim 8, wherein the antibody fragment is a heavy-chain constant region fragment (Fc), a heavy-chain constant region domain fragment CHI, CH2, or CH3, an antigen binding fragment (Fab), a single-chain variable fragment (scFv), a heavy-chain variable region fragment (VH), a light- chain constant region fragment (CL), or a light-chain variable region fragment (VL).
12. The fusion protein of claim 8, wherein the biologically active agent is a full-length antibody, and the peptide according to claim 1 is fused to the C-terminus of the heavy-chain constant region (Fc) of the full-length antibody.
13. The fusion protein of claim 12, wherein the fusion protein further comprises a linker peptide.
14. The fusion protein of claim 12, wherein the antibody is any one selected from the group consisting of IgG, IgM, IgA, IgD, and IgE.
15. A nanoparticle comprising the peptide of claim 1.
16. A complex comprising a liposome and the peptide of claim 1, which is fused to the liposome.
17. A complex comprising a small-molecule drug and the peptide of claim 1, which is fused to the small-molecule drug.
18. A polynucleotide that encodes the peptide of claim 1.
19. A composition comprising at least one of the following (a)-(e): (a) the peptide of claim 1, (b) a fusion protein comprising the peptide of claim 1 and a biologically active agent which is fused to the peptide, (c) a nanoparticlepeptide complex, said peptide comprising the peptide of claim 1, (d) a liposomepeptide complex, said peptide comprising the peptide of claim 1, or (e) a small-molecule drugpeptide complex, said peptide comprising the peptide of claim 1.
20. The composition according to claim 19, which is a pharmaceutical composition and comprises a pharmaceutically acceptable carrier.
21. A method for treating a head and neck cancer in a subject in need thereof, comprising administering the composition of claim 19, wherein the cancer is pharyngeal cancer and wherein the biologically active agent and the small-molecule drug are anti- cancer agents.
22. A method for inhibiting angiogenesis in tumor cells that express neuropilin-1 (NRP1) in a subject in need thereof, comprising administering the composition of claim 19, wherein the and the biologically active agent and the small-molecule drug are anti-cancer agents.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3) In
(4)
(5)
(6)
(7)
(8)
(9)
(10) In
(11)
(12)
(13)
(14) In
(15) In
(16)
(17) In
(18) In
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
BEST MODE FOR CARRYING OUT THE INVENTION
Examples
(47) Hereinafter, the present disclosure will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are for illustrative purposes only and are not to be construed to limit the scope of the present disclosure.
Example 1: Construction of Peptide Library that Binds Specifically to Arginine-Binding Pocket of NRP1-b1
(48) As shown in
(49) It is known that, among natural ligands that increase tumor tissue penetration by interaction with neuropilin, VEGF165A or Sema3A binds more preferentially to NRP1 than to NRP2. Accordingly, the present inventors anticipated that NRP1 would have a closer connection with tumor tissue penetration than NRP2, and anticipated that NRP1 would be a more preferable target. Thus, as shown in
(50) To this end, as shown in
(51) TABLE-US-00004 TABLE1 Oligonucleotidesequencesusedforconstruction ofFc-fusionpeptidelibrary Nameofprimer Oligonucleotidesequence SEQIDNOs: Forwardprimer 5-CATCGAGAAAACCATCTC SEQIDNO:7 CAAAGCCA-3 Reverseprimer 5-AAAGTCGATTTTGTTACAT SEQIDNO:8 CTACACTGTTGTTATCAGATC TCGAGAAGCTTATCAVDNVDN VDNVDNVDNVDNVDNVDNVDN VDNVDNVDNVDNVDNVDNVDN VDNVDNTCCAGGAGTATGTGA TCC-3
(52) Library DNA was prepared by performing PCR. Using a Fc-A22p yeast surface display vector (pCTCON, Colby et al. 2004) as a template and the above-described forward and reverse primers, DNA was amplified. The amplified DNA (a total of 300 g; 10 g/transformation) was electroporated 30 times into yeast together with a vector DNA (1 g/transformation) prepared by treating the Fc yeast surface display vector with BsrGI and Xhol restriction enzymes, thereby constructing a library. Thereafter, as shown in
Example 2: Selection of Single Clones Binding Specifically to Only NRP1 from Constructed Fc-Peptide Library Obtained by Fusion to Antibody Heavy-Chain Constant Region (Fc)
(53) The target protein NRP1-b1b2 (273-586) and the competitive protein NRP2-b1b2 (275-595) were prepared with a purity of 90% or higher according to conventional methods (BA Appleton et al., 2007). The target protein NRP1-b1b2 was biotinylated as shown in
(54)
(55)
(56) 1 M biotinylated NRP1-b1b2 was bound to the antibody heavy-chain constant region (Fc)-fused peptide library, displayed on the yeast cell surface, at 37 C. for 1 hour. The antibody heavy-chain constant region (Fc)-fused peptide library, bound to the biotinylated NRP1-b1b2 and displayed on the yeast cell surface, was bound to streptavidin microbeads (Miltenyi Biotec Inc., Germany) at 4 C. for 10 minutes, and then clones bound to the biotinylated NRP1-b1b2 were selected using MACS (magnetic activated cell sorting). Next, 1 M NRP1-b1b2 was bound to the antibody heavy-chain constant region (Fc)-fused peptide library, displayed on the yeast cell surface, at 37 C. for 1 hour, and then PE-conjugated streptavidin (Streptavidin-R-phycoerythrin conjugate (SA-PE), Invitrogen) and FITC-conjugated anti-Fc antibody (anti-Fc antibody FITC conjugated, goat, (SIGMA-ALDRICH co., USA)) were bound to the library at 4 C. for 20 minutes, after which clones, which express a high level of Fc and have binding affinity for the biotinylated NRP1-b1b2, were selected using FACS (fluorescence activated cell sorting). The second FACS round was performed in the same manner as described above, except that biotinylated NRP1-b1b2 was used at a concentration of 0.5 M. In addition, in the MACS and FACS processes, non-biotinylated NRP2-b1b2 was used as a competitive protein for biotinylated NRP1-b1b2 at a 10-fold higher concentration, and individual clones that bind to NRP1-b1b2 were selected.
(57) In addition, as shown in
(58) The selected individual clones were recovered from the yeast cells, and the DNA sequences and amino acid sequences thereof were analyzed.
(59) Table 2 below shows the sequences of the selected peptides that bind specifically to NRP1 without binding to NRP2.
(60) TABLE-US-00005 TABLE2 AminoacidsequencesandpIofindividual clonesselectedfrompeptidelibraryfusedto antibodyheavy-chainconstantregion(Fc) NRP1-targeting peptidesequence (N-to-Cterminus NameofTPP direction) SEQIDNOs: TPP1 HTPGNSNQFVLTSTRPPR SEQIDNO:1 TPP8 HTPGIATRTPR SEQIDNO:2 TPP11 HTPGNSKPTRTPRR SEQIDNO:3
(61) Table 3 shows sequences comprising a linker used when fusing the selected peptide to the antibody heavy-chain constant region.
(62) TABLE-US-00006 TABLE3 Linker-connected,NRP1-targetingpeptidesequences Linker-connected,NRP1-targeting peptidesequence(N-to-Cterminus direction) NRP1-targeting NameofTPP Linkersequence peptidesequence SEQIDNOs: TPP1 GGGGSGGGGSGGGGS HTPGNSNQFVLTSTRPPR SEQIDNO:4 TPP8 GGGGSGGGGSGGGGS HTPGIATRTPR SEQIDNO:5 TPP11 GGGGSGGGGSGGGGS HTPGNSKPTRTPRR SEQIDNO:6
Example 3: Construction and Expression/Purification of Antibody Heavy-Chain Constant Region Fused with Peptide that Binds Specifically to NRP1
(63) To express the individual clones, selected in Example 2, in mammalian cells, the DNA recovered from the yeast cells was treated with BsrGI and HindII restriction enzymes to obtain the CH3 of the antibody heavy-chain constant region and the peptide portion that binds specifically to NRP1. The obtained DNA fragments were cloned into a pcDNA3.4 vector as shown in
(64) Using a HEK293-F system (Invitrogen), a plasmid encoding a fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1 was transiently transfected to express the protein. In a shaking flask, HEK293-F cells (Invitrogen) suspended in serum-free FreeStyle 293 expression medium (Invitrogen) were transfected with a mixture of a plasmid and polyethylenimine (PEI) (Polyscience). For 200 mL transfection in a shaking flask (Corning), HEK293-F cells were seeded in 100 ml of medium at a density of 2.010.sup.6 cells/ml, and incubated at 120 rpm in 8% CO.sub.2. Next, a plasmid encoding a fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 was diluted in 10 ml of FreeStyle 293 expression medium (Invitrogen) to 250 g (2.5 g/ml) and mixed with 10 ml of medium in which 750 g (7.5 g/ml) of PEI was diluted. The medium mixture was incubated at room temperature for 10 minutes. Next, the incubated medium mixture was added to 100 ml of the medium containing the seeded cells, and incubated for 4 hours at 120 rpm in 8% CO.sub.2, after which the remaining 100 ml of FreeStyle 293 expression medium was added thereto and incubated for 7 days. The supernatant was collected after 7 days.
(65) With reference to standard protocols, protein was purified from the collected cell culture supernatant. Antibody was applied to Protein A Sepharose column (GE healthcare) and washed with PBS (pH 7.4). The antibody was eluted using 0.1 M glycine buffer at pH 3.0, and then the sample was immediately neutralized using 1 M Tris buffer. The eluted antibody fraction was replaced with PBS (pH7.4) using Pierce Dextran Desalting Column (5K MWCO), and then concentrated using MILLIPORE Amicon Ultra (10 MWCO) centrifugal concentrator. The purified fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 was quantified based on the absorbance at 280 nm and the extinction coefficient. The purified fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 was analyzed on SDS-PAGE under reducing and non-reducing conditions.
(66)
(67)
(68) Table 4 shows the yield of purified Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein that is produced per L of culture. The results obtained in triplicate were statistically processed, and indicates standard deviation value. The yield of protein produced did not significantly differ from those of wild-type Fc protein and the control Fc-A22p fusion protein.
(69) TABLE-US-00007 TABLE 4 Production yields of Fc-TPP1, Fc-TPP8 and Fc- TPP11 fusion proteins in HEK293 cells Name of Clone Yield (mg/L) Fc 34.2 4.8 Fc-A22p 36.1 5.6 Fc-TPP1 34.2 3.6 Fc-TPP8 32.5 3.2 Fc-TPP11 37.6 2.2
Example 4: Evaluation of Binding Affinities of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins for b1b2 Domains of NRP1 and NRP2
(70) The binding affinities of purified Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins for the b1b2 domains of NRP1 and NRP2 were analyzed by ELISA (Enzyme Linked Immunosorbent Assay).
(71)
(72) To examine specificity for NRP1, the control VEGF165A and Fc, A22p, and each of the fusion proteins wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant Fc region, was biotinylated using a NHS-biotin kit (SIGMA-ALDRICH co., USA).
(73) 1 g of each of NRP1-b1b2 (273-586) protein, NRP2-b1b2 (275-595) protein and the control group VEGFR2 (46-753) was immobilized in each well of a 96-well EIA/RIA plate (COSTAR Corning In., USA) at room temperature for 1 hour, and then washed three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. After binding with 5% skim milk (5% Skim milk, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 1 hour, each well was washed three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. Each of biotinylated VEGF165A and Fc as controls, A22p, and the TPP11 peptide and Fc-TPP11, which bind specifically neuropilin-1 as test groups, are bound at a concentration of 10 nM (or 100 nM for the peptide), and then washed three times with 0.1% PBST for 10 minutes. Each well was bound with AP-conjugated anti-biotin antibody (alkaline phosphatase-conjugated anti-biotin mAb, Sigma, USA), and then reacted with pNPP (pnitrophenyl palmitate, SIGMA-ALDRICH co., USA), and the absorbance at 405 nm was measured. Based on the ELISA results obtained by reaction with AP-pNPP for 30 minutes, the binding affinities of the expressed and purified Fc-TPP for the b1b2 domains of NRP1 and NRP2 were evaluated.
(74) As can be seen in
(75) In addition, in order to further quantitatively analyze the binding affinities of Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins for NRP1 and NRP2 b1b2 proteins, SPR (surface plasmon resonance) was performed using a Biacore2000 instrument (GE healthcare).
(76) Specifically, each of NRP1 and NRP2 b1b2 proteins was diluted in 10 mM Na-acetate buffer (pH 4.0), and immobilized on a CM5 sensor chip (GE healthcare, USA) at about 1000 response units (RU). For analysis, HBS-EP buffer [10 mM Hepes, 3 mM ethylenediaminetetraacetic acid, and 0.005% surfactant P20 (pH 7.4), GE Healthcare] was used at a flow rate of 30 l/min, and each of Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins was used at a concentration of 100 nM to 0.4 nM. As a control, Fc-A22p was used. After binding and dissociation analysis, regeneration of the CM5 chip was performed by flushing buffer (20 mM NaOH, 1M NaCl, pH10.0) at a flow rate of 30 l/min for 1 minute. Each sensorgram obtained by 3 minutes of binding and 3 minutes of dissociation was normalized and subtracted compared to a blank cell, thereby determining the affinity.
(77) Table 5 below shows the results of analyzing the affinities of the Fc-TPP protein for NRP1-b1b2 and NRP2-b1b2 proteins by SPR (surface plasmon resonance, BIACORE 2000, GE healthcare, USA).
(78) TABLE-US-00008 TABLE 5 Analysis of the NRP1-b1b2 and NRP2-b1b2 affinities and specificities of fusion proteins wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant Fc region Binding Affinity NRP1-b1b2 NRP2-b1b2 Ratio[(K.sub.D for Binding Binding NRP2)/K.sub.D for Affinity (nM) Affinity (nM) NRP1)] Fc-A22p 63.0 2.1 62.0 1.4 0.98 Fc-TPP1 1.81 0.19 1126 51 624.8 Fc-TPP8 3.85 0.52 253.5 33 65.8 Fc- 1.65 0.18 1555 205 945.3 TPP11
(79) As shown in Table 5 above, when Fc-TPP1, Fc-TPP8 and Fc-TPP11 that bind specifically to neuropilin-1 was compared with Fc-A22p that binds to the NRP1 and NRP2 b1b2 proteins, there was an about 60-fold difference in the affinity for NRP1, and the affinity for NRP1 was about 60-fold to 1000-fold higher than the affinity for NRP2. In analysis, at least five sensor grams were analyzed, and the results obtained in triplicate were statistically processed. indicates the standard deviation value of independent experiment results.
Example 5: Evaluation of Specific Binding of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins to NRP1 Displayed on Cell Surface and NRP1-Mediated Endocytosis
(80) In an experiment for biological identification of the peptides that binds specifically to NRP1, human umbilical vein endothelial cells (HUVECs) overexpressing NRP1 were used.
(81)
(82) Specifically, 510.sup.4 HUVEC cells were added to each well of a 24-well plate and incubated in 0.5 ml of EGM2 (Endothelial growth medium, Promocell) medium for 24 hours under the conditions of 5% CO.sub.2 and 37 C. When the cells were stabilized, each well was washed with 0.5 ml of PBS, and then incubated in EBM2 (Endothelial basal medium, Promocell) medium for 4 hours, after which each of Fc, Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 was diluted in 0.5 ml of EBM2 medium at 1 M and incubated for 30 minutes at 4 C. Next, the medium was removed, and each well was washed with cold PBS. Then, the fusion protein wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant region was stained with FITC (green fluorescence)-labeled antibody (Sigma) that specifically recognizes Fc, and NRP1 was stained with primary antibody (Abcam) that recognizes NRP1 and with TRITC (red fluorescence)-labeled secondary antibody. The nucleus was stained (blue fluorescence) with DAPI and analyzed by confocal microscopy.
(83) As shown in
(84) In addition, in order to examine whether the fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 can be endocytosed by NRP1, like other neuropilin ligands, endocytosis of the fusion protein and co-localization of the fusion protein with NRP1 were observed by confocal microscopy. Each of Fc, Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 was diluted to 1 M and incubated for 10 minutes under the conditions of 37 C. and 5% CO.sub.2. Then, as described above, Fc and the fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 were stained and analyzed by confocal microscopy.
(85)
Example 6: Evaluation of Enhanced Cell Penetration Ability of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins
(86) (1) Western Blot Analysis to Examine the Biological Mechanisms of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins in HUVECs
(87) It is known that semaphorin 3A or VEGF165A enhances vascular permeability using NRP1 as a co-receptor. In this procedure, changes occur, such as a decrease in vascular endothelial (VD) cadherin, phosphorylation, or the like. Namely, VE-cadherin or epithelial (E)-cadherin is an adhesion factor forming the intercellular space between endothelial cells or between epithelial cells, and a decrease in such molecules densifies the intercellular space to interfere with material movement.
(88) In an experimental method that can indirectly demonstrate an increase in vascular permeability, a change in VE-cadherin was analyzed by Western blot analysis. Specifically, 510.sup.5 HUVEC cells were seeded into each well of a 6-well plate and incubated for 24 hours, and then treated with 0.1 M of the fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1, for 10 minutes, followed by Western blot analysis. After SDS-PAGE, the gel was transferred to a PVDF membrane, and detection was performed using primary antibodies (SantaCruz) that recognize VE-cadherin and -actin and using HRP-conjugated secondary antibody (SantaCruz), and analysis was performed using ImageQuant LAS4000 mini (GE Healthcare).
(89)
(90) (2) Transwell Assay to Examine the Abilities of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins to Penetrate Vascular Endothelial Cells
(91) Based on the experimental results as described above, in order to examine whether the fusion proteins have an improved ability to penetrate vascular endothelial cells, the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins were subjected to a transwell assay.
(92) Specifically, 510.sup.4 human umbilical vein endothelial cells (HUVECs) were seeded into the upper chamber of a transwell plate (Corning) and incubated in EGM2 for 3 days under the conditions of 37 C. and 5% CO.sub.2. Next, the medium was replaced with EBM medium, and the cells were treated with each of about 1.3 nM of the control VEGF165A and 1 M of each of Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 for 30 minutes. Then, 50 l of dextran-FITC (Sigma) was added to the upper chamber. After 30 minutes, based on the principle according to which the fluorescent substance would be observed when penetration into the vascular endothelial cells was increased, the medium was sampled from the lower chamber and the fluorescence thereof was measured.
(93)
(94) (3) Immunohistochemistry (IHC) Experiment for Examining Enhanced Penetration of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins in Mouse Models
(95) In Examples 6(1) and 6(2) above, it was found in vitro that the fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1 had an enhanced ability to penetrate vascular endothelial cells. Thus, in order to confirm enhanced penetration of the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins in mouse models, an immunohistochemistry (IHC) experiment was performed.
(96) In order to confirm that the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins have an enhanced ability to penetrate tumor tissue, 510.sup.6 A431 cells expressing neuropilin-1 were injected subcutaneously into Balb/c nude mice, and after about 9 days, when the tumor volume reaches about 300 to 400 mm.sup.3, each of PBS, Fc, Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 was injected intravenously into the mice in an amount of 10 mg/kg. At 15 hours after injection, the tumor was extracted from the mice and subjected to immunohistochemistry. The extracted tumor tissue was sectioned to a thickness of 20 m by a frozen-section method, and the blood vessels were stained with the primary antibody CD31 antibody (BD Pharmingen) and TRITC (red fluorescence)-labeled secondary antibody that recognizes the same. In addition, to observe the distribution of the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins in the tissue, an FITC (green fluorescence)-labeled antibody that recognizes Fc was used.
(97)
(98) (4) Examination of the Enhanced Ability of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins to Penetrate Cancer Cells
(99) In order to examine whether the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins also have an enhanced ability to penetrate cancer cells, a change in E-cadherin in human head and neck cancer FaDu cells expressing NRP1 was analyzed by Western blot analysis under the same conditions as described above.
(100)
(101) (5) Ex Vivo Tumor Penetration Assay to Examine Tumor Penetration in Cancer Cells
(102) Additionally, in order to examine whether Fc-TPP alleviates the intracellular space between epithelial cells to penetrate tumor tissue even in the absence of blood vessels, an ex vivo tumor penetration assay was performed. In an experimental method, 510.sup.6 FaDu cells were injected subcutaneously into Balb/c nude mice (Nara Biotec, 4-week old, female), and after about 10 days, when the tumor volume reached about 300 to 400 mm.sup.3, the tumor tissue was extracted. The extracted tumor tissue was washed with MEM medium containing 1% BSA (Welgene), and then incubated with 3 M of each of the control PBS and Fc and the test sample Fc-TPP11 for 2 hours and 30 minutes under the conditions of 37 C. and 5% CO.sub.2. The incubated tissue was washed twice with 1% BSA-containing MEM medium for 10 minutes each time, fixed with 4% para-formaldehyde, and then subjected to immunohistochemistry. The tumor tissue was sectioned to a thickness of 20 m by a frozen-section method, and stained with FITC (green fluorescence)-labeled antibody recognizing Fc in order to observe Fc and Fc-TPP11.
(103)
Example 7: Evaluation of Competitive Binding of TPP11 Peptide and VEGF165A to NRP1-b1b2
(104) In order to evaluate competitive binding of the TPP11 peptide, which binds specifically to NRP1 without binding to NRP2, and VEGF165A and a RPARPAR peptide, known to bind to the arginine-binding pocket of the NRP1-b1 domain, competitive ELISA was performed.
(105) Specifically, binding NRP1-b1b2 (273-586) protein to each well of a 96-well EIA/RIA plate or a 96-well EIA/RIA black plate (COSTAR Corning In., USA) at room temperature for hour, is followed by washing three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. After binding with 5% skim milk (5% Skim milk, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 1 hour, each well was washed three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. A mixture of Fc-A22p (50 nM) and Fc-TPP1, and a mixture of Fc-TPP11 (3 nM) and VEGF165A (25 nM to 0.02 nM), were prepared, and each mixture was allowed to bind to the NRP1-b1b2 protein. Then, each mixture was incubated with AP-conjugated anti-human antibody (alkaline phosphatase-conjugated anti-human mAb, Sigma, USA), and then reacted with pNPP (p-nitrophenyl palmitate, SIGMA-ALDRICH co., USA), and the absorbance at 405 nm was measured. The ELISA results indicated that Fc-TPP1 and Fc-TPP11 did bind to NRP1-b1b2 competitively with VEGF165A.
(106)
(107)
Example 8: Evaluation of Anti-Angiogenesis Activity of Fc-TPP11
(108) (1) Tube Formation Assay to Examine the Ability of Fc-TPP11 to Inhibit Tube Formation in HUVECs
(109) VEGF165A is known to inhibit angiogenesis using NRP1 as a co-receptor. Based on this, as a method capable of observing angiogenesis in vitro, a tube formation assay was performed. In an experimental method, 50 l of ECMatrix was added to a 96-well plate and polymerized at 37 C. for 2 hours. After 2 hours, HUVEC cells were suspended in EBM2 medium, mixed with VEGF165A (20 ng/ml), Fc or Fc-TPP11 (1 M), plated on the ECMatrix at a density of 110.sup.4 cells per well, and incubated for 8 hours. The incubated cells were imaged with a microscope.
(110)
(111) (2) In Vivo Matrigel Plug Assay to Examine the Anti-Angiogenesis Activity of Fc-TPP11
(112) Additionally, in order to examine anti-angiogenesis activity in vivo, a matrigel plug assay was performed. In an experimental method, each of 6-8-week-old Balb/c nude mice was injected subcutaneously with 7.510.sup.6 A431 cells, 200 g of Fc, Fc-A22p or Fc-TPP11, and 0.4 ml of Matrigel (BD Biosciences). After 8 days, the matrigel plug was extracted, imaged (
(113) (3) Wound Healing Assay to Examine the Inhibitory Activity of Fc-TPP11 Against Migration of Vascular Endothelial Cells
(114) In addition to the results obtained in Examples 8(1) and 8(2), in order to examine the inhibitory activity of Fc-TPP11 against VEGF165A-induced migration of vascular endothelial cells, a wound healing assay was performed. In an experimental method, 510.sup.5 HUVEC cells were seeded into each well of a 6-well plate, and then incubated in 0.5% serum EBM2 medium containing 1 g/ml mitomycin c for 1 hour until the cells were saturated (95% or more) in the plate. The dish bottom was linearly rubbed with a yellow tip to make injury lines having a uniform width. Then, the cells were washed with PBS such that the cells were detached from the bottom. After removal of PBS, medium was added slowly to the HUVEC cells. The cells were treated with 0 or 20 ng/ml of VEGF165A, treated with each of Fc and Fc-TPP11 (1 M), and then incubated under the conditions of 37 C. and 5% CO.sub.2. The cells were imaged with a microscope (Primo vert, Carl Zeiss co., Germany) at 0 hour and 18 hours, and the distance between both ends, measured with a computer program (AxioVision LE, Carl Zeiss co., Germany) included in the microscope, was statistically processed.
(115)
(116) (4) Transwell Assay to Examine the Inhibitory Activity of Fc-TPP11 Against Invasion of Vascular Endothelial Cells
(117) Additionally, in order to examine the inhibitory activity of Fc-TPP11 against VEGF165A-induced invasion of vascular endothelial cells, a transwell assay was performed. A transwell (Corning Costar, USA) having a polycarbonate membrane with a 8-mm pore size was used. Matrigel (Corning Costar, USA) was coated on the lower layer surface of the filter at a ratio of 1:10 and polymerized for 2 hours under the conditions of 37 C. and 5% CO.sub.2, and then 510.sup.4 HUVEC cells and each of Fc and Fc-TPP11 (1 M) were seeded in EBM2 medium in the upper layer well. In addition, EBM2 medium containing VEGF165A (20 ng/ml) was added to the lower layer well. Next, the cells were incubated for 12 hours under the conditions of 37 C. and 5% CO.sub.2, and then unmoved cells in the upper layer well were removed with cotton, and the cells were fixed with 4% para-formaldehyde. Then, the cells were stained with crystal violet. Moved cells were observed with a microscope and counted.
(118)
Example 9: In Vivo Evaluation of Inhibitory Activity of Fc-TPP11 Against Tumor Growth and Angiogenesis
(119) In Example 8, the anti-angiogenesis of Fc-TPP11 was confirmed. Thus, in order to examine whether Fc-TPP11 has tumor growth inhibitory activity resulting from anti-angiogenesis activity in mouse models, each of Balb/c nude mice was injected subcutaneously with 510.sup.6 FaDu cells, and then injected with Fc-TPP11. Specifically, about 5 days after transplantation of the cells, when the tumor volume reached about 60 mm.sup.3, 20 mg/kg of each of Fc and Fc-TPP11 was injected intravenously into each mouse six times at 3-day intervals (N=6).
(120) As shown in
(121)
(122) Taking the above-described experimental results together, as shown in
Example 10: Evaluation of Enhanced Tumor Tissue Accumulation and Penetration of Small-Molecule Drug Co-Administered with Fc-TPP11
(123) In order to examine tumor tissue penetration of a small-molecule drug co-administered with the Fc-TPP11 constructed in the above-described experiment, immunohistochemistry was performed. Specifically, each of Balb/c nude mice was injected subcutaneously with 510.sup.6 FaDu cells, and after about 15 days, when the tumor volume reached about 300 to 400 mm.sup.3, 10 mg/kg of the anticancer drug doxorubicin and 2.5 mg/kg of each of PBS, Fc and Fc-TPP11 were injected intravenously into each mouse. At 1 hour after injection, the mouse heart was perfused with PBS and perfused with 4% para-formaldehyde to fix tissue. Next, the tumor tissue was extracted and subjected to immunohistochemistry. The extracted tumor was sectioned to a thickness of 20 m by a frozen-section method, and the blood vessels were stained with the primary antibody CD31 (BD Pharmingen) and a FITC (green fluorescence)-labeled secondary antibody recognizing the same. It was observed that doxorubicin distributed in the tissue showed red fluorescence by itself.
(124)
(125)
(126) The above-described results indicate that the tumor-penetrating peptide that binds specifically to NRP1 may generally be applied to various small-molecule drugs.
Example 11: Construction and Production of TPP11-Fused Full-Length Antibody (mAb-TPP11)
(127) In Examples 7 and 8, it was found in vitro and in vivo that the fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1 has an enhanced ability to penetrate vascular endothelial cells. Thus, in order to verify the effect of the peptide that binds specifically to NRP1 in mouse models, the anti-EGFR antibody Cetuximab which is an antibody for treatment of solid tumors was selected as a model antibody for a peptide that binds specifically to mAb-NRP1. To construct Cetuximab-TPP11, in the vector for producing the fusion protein of the TPP11 peptide and the antibody heavy-chain constant region (Fc) as described in Example 3 above, the TPP11-fused DNA in the antibody heavy-chain constant region CH3 obtained by treatment with BsrGI and HindII restriction enzyme was substituted into a vector encoding a wild-type Cetuxmab heavy-chain.
(128)
(129) Table 6 below the yield of the purified TPP11-fused antibody produced per L of culture. The results obtained in triplicate were statistically processed, and indicates standard deviation value. The yield of the produced protein (Cetuximab-TPP11) did not significantly differ from that of wild-type protein (Cetuximab).
(130) TABLE-US-00009 TABLE 6 Comparison of expression/purification yield of TPP11 peptide-fused antibody with wild-type antibody Name of Clone Yield (mg/L) Cetuximab 39.9 6.2 Cetuximab- 40.2 5.0 TPP11
(131)
Example 12: Evaluation of Enhanced Tissue Penetration Ability of Cetuximab-TPP11 Antibody
(132) In order to evaluate tumor tissue penetration of the TPP11 peptide-fusion antibody constructed in the above-described experiment, each of Balb/c nude mice was injected subcutaneously with 510.sup.6 FaDu cells, and after about 9 days, when the tumor volume reached about 300 to 400 mm.sup.3, 1.25 mg/kg of PBS, Cetuximab and Cetuximab-TPP11 was injected intravenously into each mouse. At 3 hours after injection, the tumor was extracted from the mice and subjected to immunohistochemistry. The tissue was stained and observed in the same manner as described in Example 6.
(133)