Restricted Immunoglobulin Heavy Chain Mice

20190261612 ยท 2019-08-29

    Inventors

    Cpc classification

    International classification

    Abstract

    Mice having a restricted immunoglobulin heavy chain locus are provided, wherein the locus is characterized by a single polymorphic human V.sub.H gene segment, a plurality of human D.sub.H gene segments and a plurality of J.sub.H gene segments. Methods for making antibody sequences that bind an antigen (e.g., a viral antigen) are provided, comprising immunizing a mouse with an antigen of interest, wherein the mouse comprises a single human V.sub.H gene segment, a plurality of human D.sub.H gene segments and a plurality of J.sub.H gene segments, at the endogenous immunoglobulin heavy chain locus.

    Claims

    1. A rat or mouse having a restricted immunoglobulin heavy chain locus characterized by the presence of a single human V.sub.H gene segment, one or more human D.sub.H gene segments, and one or more human J.sub.H gene segments.

    2. The rat or mouse of claim 1, wherein the mouse comprises a deletion of all or substantially all endogenous V.sub.H, D.sub.H, and J.sub.H gene segments.

    3. The mouse of claim 1, wherein the single human V.sub.H gene segment is selected from V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, V.sub.H3-23.

    4.-5. (canceled)

    6. The rat or mouse of claim 1, wherein the single human V.sub.H gene segment is operably linked to a human or non-human immunoglobulin constant region gene.

    7. The rat or mouse of claim 6, wherein the immunoglobulin constant region gene is a mouse, rat, or human constant region gene.

    8. The rat or mouse of claim 1, further comprising a one or more human immunoglobulin V.sub.L gene segments operably linked to one or more human J.sub.L gene segments.

    9. The rat or mouse of claim 8, wherein the one or more human V.sub.L gene segments and/or the one or more human J.sub.L gene segments are selected from human ? and human ? gene segments.

    10. The rat or mouse of claim 8, wherein the one or more human immunoglobulin V.sub.L gene segments and one or more human J.sub.L gene segments are operably linked to a non-human light chain constant gene.

    11. The rat or mouse of claim 10, wherein the non-human light chain constant gene is selected from a mouse ? or ? constant region gene.

    12. A mouse comprising, in its germline, a replacement at an endogenous immunoglobulin heavy chain locus of all or substantially all endogenous V.sub.H, D.sub.H, and J.sub.H gene segments with single human V.sub.H gene segment and/or polymorphic variants thereof, one or more human D.sub.H gene segments and one or more human J.sub.H gene segments.

    13. The mouse of claim 12, further comprising a replacement at an endogenous immunoglobulin light chain locus of all or substantially all endogenous V.sub.L and J.sub.L gene segments with one or more human V.sub.L and one or more human J.sub.L gene segments.

    14. (canceled)

    15. A cell or tissue derived from the rat or mouse of claim 1.

    16. A method of making a nucleic acid sequence encoding a human V.sub.H domain, comprising (a) immunizing a rat or mouse of claim 1 with an antigen of interest; (b) allowing said mouse to mount an immune response to the antigen of interest; and, (c) obtaining a nucleic acid sequence encoding a human V.sub.H domain from said mouse.

    17.-19. (canceled)

    20. The method of claim 16, wherein the immunoglobulin V.sub.H region sequence is at least 95% identical to SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66 or SEQ ID NO: 68.

    21. The method of claim 16, wherein the immunoglobulin V.sub.H region sequence comprises SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68. or a polymorphic variant thereof.

    22. The method of claim 16, wherein the immunoglobulin V.sub.H region sequence encodes a protein that is at least 95% identical with SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO: 69.

    23. The method of claim 16, wherein the method further comprises making a nucleic acid sequence encoding a human V.sub.L domain that is cognate with the human V.sub.H domain, comprising isolating a B cell encoding the human V.sub.H domain and the human V.sub.L domain from said mouse and obtaining therefrom the sequence of the heavy and light chain variable domains.

    24. The method of claim 23, wherein the human V.sub.L domain is a V? domain.

    25. The method of claim 16, wherein the mouse comprises a deletion of the endogenous immunoglobulin heavy chain locus and the endogenous ? light chain.

    26. A rat or mouse comprising an endogenous immunoglobulin heavy chain locus, wherein the endogenous immunoglobulin heavy chain locus consists essentially of a) one or more polymorphic variants of a single human V.sub.H gene segment, b) one or more human D.sub.H gene segments, and c) one or more human J.sub.H gene segments, wherein the single human V.sub.H gene segment is a polymorphic V.sub.H gene segment associated with a high copy number in human populations, and wherein the single human V.sub.H gene segment, one or more human D.sub.H gene segments, and one or more J.sub.H gene segments are operably linked to a non-human immunoglobulin heavy chain constant region gene.

    27. A cell or tissue derived from the rat or mouse of claim 26.

    28. A method of making a nucleic acid sequence encoding a human V.sub.H domain, comprising (a) immunizing a rat or mouse of claim 26 with an antigen of interest; (b) allowing said mouse to mount an immune response to the antigen of interest; and, (c) obtaining a nucleic acid sequence encoding a human V.sub.H domain from said mouse.

    Description

    BRIEF DESCRIPTION OF FIGURES

    [0200] FIG. 1 shows a general illustration, not to scale, of a series of targeting and molecular engineering steps employed to make a targeting vector for construction of a modified heavy chain locus containing a single human V.sub.H1-69 gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at an endogenous immunoglobulin heavy chain locus.

    [0201] FIG. 2 shows a general illustration, not to scale, of a series of targeting and molecular engineering steps employed to make a targeting vector for construction of a modified heavy chain locus containing a single human V.sub.H1-2 gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at an endogenous immunoglobulin heavy chain locus.

    [0202] FIG. 3 shows contour plots of splenocytes gated on single lymphocytes and stained for CD19 (B cell) and CD3 (T cell) from a wild type mouse (WT) and a mouse homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0203] FIG. 4A shows, on the left, the percent of CD19.sup.+ B cells in spleens harvested from wild type mice (WT) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO). On the right, the number of CD19.sup.+ B cells per spleen is shown for both wild type mice (WT) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0204] FIG. 4B shows, on the left, the percent of CD19.sup.+ B cells in bone marrow harvested from femurs of wild type mice (WT) and mice homozygous for a single human V.sub.R gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO). On the right, the number of CD19.sup.+ B cells per femur is shown for both wild type mice (WT) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.R and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0205] FIG. 5 shows contour plots of splenocytes gated on CD19.sup.+ B cells and stained for Ig?+ and Ig?+ expression from a wild type mouse (WT) and a mouse homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0206] FIG. 6 shows contour plots of splenocytes gated on CD19.sup.+ B cells and stained for immunoglobulin D (IgD) and immunoglobulin M (IgM) from a wild type mouse (WT) and a mouse homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0207] FIG. 7 shows the total number of transitional B cells (CD19.sup.+ IgM.sup.hiIgD.sup.int), mature B cells (CD19.sup.+ IgM.sup.intIgD.sup.hi), and the ratio of mature to immature B cells in harvested spleens from wild type mice (WT) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.R and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0208] FIG. 8 shows contour plots of bone marrow gated on singlets stained for immunoglobulin M (IgM) and B220 from a wild type mouse (WT) and a mouse homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0209] FIG. 9 shows the total number of immature (B220.sup.intIgM.sup.+) and mature (B220.sup.hiIgM.sup.+) B cells in bone marrow isolated from the femurs of wild type mice (WT) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0210] FIG. 10 shows contour plots of bone marrow gated on CD19.sup.+ B cells and stained for ckit.sup.+ and CD43.sup.+ from a wild type mouse (WT) and a mouse homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0211] FIG. 11A shows the percent of CD19.sup.+ cells in populations of pro B (CD19.sup.+CD43.sup.+ckit.sup.+) and pre B (CD19.sup.+CD43.sup.?ckit.sup.?) cells in bone marrow harvested from the femurs of wild type mice (WT) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0212] FIG. 11B shows the absolute number of cells per femur in populations of pro B (CD19.sup.+CD43.sup.+ckit.sup.+) and pre B (CD19.sup.+CD43.sup.?ckit.sup.?) cells in bone marrow harvested from wild type mice (WT) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO).

    [0213] FIG. 12 shows the relative mRNA expression (y-axis) in purified splenic B cells of V.sub.H1-69-derived heavy chains in a quantitative PCR assay using a probe specific for the human V.sub.H1-69 gene segment in mice homozygous for a replacement of the endogenous heavy chain V.sub.H, D.sub.H, J.sub.H, and a replacement of the endogenous light chain V? and J? gene segments with human V.sub.H, D.sub.H, J.sub.H, V? and J? gene segments (H?), wild type mice (WT), mice heterozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HET) and mice homozygous for a single human V.sub.H gene segment, twenty-seven human D.sub.H and six human J.sub.H gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.H HO). Signals are normalized to expression of mouse C?.

    [0214] FIG. 13 shows the nucleotide alignment of the second exon for each of thirteen reported alleles for the human V.sub.H1-69 gene. Lower case bases indicate germline nucleotide differences among the alleles. Complementary determining regions (CDRs) are indicated with boxes around the sequence. Dashes indicate artificial gaps for proper sequence alignment. V.sub.H1-69*01 (SEQ ID NO: 34); V.sub.H1-69*02 (SEQ ID NO: 36); V.sub.H1-69*03 (SEQ ID NO: 38); V.sub.H1-69*04 (SEQ ID NO: 40); V.sub.H1-69*05 (SEQ ID NO: 42); V.sub.H1-69*06 (SEQ ID NO: 44); V.sub.H1-69*07 (SEQ ID NO: 46); V.sub.H1-69*08 (SEQ ID NO: 48); V.sub.H1-69*09 (SEQ ID NO: 50); V.sub.H1-69*10 (SEQ ID NO: 52); V.sub.H1-69*11 (SEQ ID NO: 54); V.sub.H1-69*12 (SEQ ID NO: 56); V.sub.H1-69*13 (SEQ ID NO: 58).

    [0215] FIG. 14 shows the protein alignment of the mature heavy chain variable gene sequence for each of thirteen reported alleles for the human V.sub.H1-69 gene. Lower case amino acids indicate germline differences among the alleles. Complementary determining regions (CDRs) are indicated with boxes around the sequence. Dashes indicate artificial gaps for proper sequence alignment. V.sub.H1-69*01 (SEQ ID NO: 35); V.sub.H1-69*02 (SEQ ID NO: 37); V.sub.H1-69*03 (SEQ ID NO: 39); V.sub.H1-69*04 (SEQ ID NO: 41); V.sub.H1-69*05 (SEQ ID NO: 43); V.sub.H1-69*06 (SEQ ID NO: 45); V.sub.H1-69*07 (SEQ ID NO: 47); V.sub.H1-69*08 (SEQ ID NO: 49); V.sub.H1-69*09 (SEQ ID NO: 51); V.sub.H1-69*10 (SEQ ID NO: 53); V.sub.H1-69*11 (SEQ ID NO: 55); V.sub.H1-69*12 (SEQ ID NO: 57); V.sub.H1-69*13 (SEQ ID NO: 59).

    [0216] FIG. 15 shows a percent identity/percent similarity matrix for the aligned protein sequences of the mature variable gene for each of thirteen reported alleles for the human V.sub.H1-69 gene. Percent identity among the V.sub.H1-69 alleles is indicated above the shaded boxes and percent similarity is indicated below the shaded boxes. Scores for percent identity and percent similarity were scored by a ClustalW (v1.83) alignment tool using MacVector software (MacVector, Inc., North Carolina).

    [0217] FIG. 16 shows the nucleotide alignment of the second exon for each of five reported alleles for the human V.sub.H1-2 gene. Lower case bases indicate germline nucleotide differences among the alleles. Complementary determining regions (CDRs) are indicated with boxes around the sequence. Dashes indicate artificial gaps for proper sequence alignment. V.sub.H1-2*01 (SEQ ID NO: 60); V.sub.H1-2*02 (SEQ ID NO: 62); V.sub.H1-2*03 (SEQ ID NO: 64); V.sub.H1-2*04 (SEQ ID NO: 66); V.sub.H1-2*05 (SEQ ID NO: 68).

    [0218] FIG. 17 shows the protein alignment of the mature heavy chain variable gene sequence for each of five reported alleles for the human V.sub.H1-2 gene. Lower case amino acids indicate germline differences among the alleles. Complementary determining regions (CDRs) are indicated with boxes around the sequence. Dashes indicate artificial gaps for proper sequence alignment. V.sub.H1-2*01 (SEQ ID NO: 61); V.sub.H1-2*02 (SEQ ID NO: 63); V.sub.H1-2*03 (SEQ ID NO: 65); V.sub.H1-2*04 (SEQ ID NO: 67); V.sub.H1-2*05 (SEQ ID NO: 69).

    [0219] FIG. 18 shows a percent identity/percent similarity matrix for the aligned protein sequences of the mature variable gene for each of five reported alleles for the human V.sub.H1-2 gene. Percent identity among the V.sub.H1-2 alleles is indicated above the shaded boxes and percent similarity is indicated below the shaded boxes. Scores for percent identity and percent similarity were scored by a ClustalW (v1.83) alignment tool using MacVector software (MacVector, Inc., North Carolina).

    [0220] FIG. 19 shows the antibody titer from mice homozygous for human heavy and human ? light chain variable gene loci (H?; n=4) and mice homozygous for a single human V.sub.H1-69 gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.HHO; n=10) that were immunized with a human cell surface receptor (Antigen A).

    [0221] FIG. 20 shows the antibody titer from mice homozygous for human heavy and human ? light chain variable gene loci (fix; n=5) and mice homozygous for a single human V.sub.H1-69 gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus (1hV.sub.HHO; n=5) that were immunized with two different influenza vaccines.

    [0222] FIG. 21 shows the percentage (y-axis) of IgM-primed heavy chains having a specified amino acid length for the V.sub.H CDR3 region (x-axis) from mice homozygous for a single human V.sub.H1-69 gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus and homozygous for a replacement of the endogenous ? light chain variable loci with human ? light chain variable loci that were immunized with a human cell surface receptor (Antigen A).

    [0223] FIG. 22 shows the percentage (y-axis) of IgG-primed heavy chains having a specified amino acid length for the V.sub.H CDR3 region (x-axis) from mice homozygous for a single human V.sub.H1-69 gene segment, twenty-seven human D.sub.R and six human J.sub.R gene segments at the endogenous immunoglobulin heavy chain locus and homozygous for a replacement of the endogenous ? light chain variable loci with human ? light chain variable loci that were immunized with a human cell surface receptor (Antigen A).

    DETAILED DESCRIPTION

    [0224] This invention is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention is defined by the claims.

    [0225] Unless defined otherwise, all terms and phrases used herein include the meanings that the terms and phrases have attained in the art, unless the contrary is clearly indicated or clearly apparent from the context in which the term or phrase is used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, particular methods and materials are now described. All publications mentioned are hereby incorporated by reference.

    [0226] The phrase substantial or substantially when used to refer to an amount of gene segments (e.g., substantially all V gene segments) includes both functional and non functional gene segments and include, in various embodiments, e.g., 80% or more, 85% or more, 90% or more, 95% or more 96% or more, 97% or more, 98% or more, or 99% or more of all gene segments; in various embodiments, substantially all gene segments includes, e.g., at least 95%, 96%, 97%, 98%, or 99% of functional (i.e., non-pseudogene) gene segments.

    [0227] The term replacement includes wherein a DNA sequence is placed into a genome of a cell in such a way as to replace a sequence within the genome with a heterologous sequence (e.g., a human sequence in a mouse), at the locus of the genomic sequence. The DNA sequence so placed may include one or more regulatory sequences that are part of source DNA used to obtain the sequence so placed (e.g., promoters, enhancers, 5- or 3-untranslated regions, appropriate recombination signal sequences, etc.). For example, in various embodiments, the replacement is a substitution of an endogenous sequence for a heterologous sequence that results in the production of a gene product from the DNA sequence so placed (comprising the heterologous sequence), but not expression of the endogenous sequence; the replacement is of an endogenous genomic sequence with a DNA sequence that encodes a protein that has a similar function as a protein encoded by the endogenous genomic sequence (e.g., the endogenous genomic sequence encodes an immunoglobulin gene or domain, and the DNA fragment encodes one or more human immunoglobulin genes or domains). In various embodiments, an endogenous gene or fragment thereof is replaced with a corresponding human gene or fragment thereof. A corresponding human gene or fragment thereof is a human gene or fragment that is an ortholog of, a homolog of, or is substantially identical or the same in structure and/or function, as the endogenous gene or fragment thereof that is replaced.

    [0228] A precise, in situ replacement of six megabases of the variable regions of the mouse heavy chain immunoglobulin loci (V.sub.H-D.sub.H-J.sub.H) with a restricted human immunoglobulin heavy chain locus was performed, while leaving the flanking mouse sequences intact and functional within the hybrid loci, including all mouse constant chain genes and locus transcriptional control regions (FIG. 1 and FIG. 2). Specifically, a single human V.sub.H, 27 D.sub.H, and six J.sub.H gene segments were introduced through chimeric BAC targeting vectors into mouse ES cells using VELOCIGENE? genetic engineering technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela et al., 2003, High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nat Biotechnol 21:652-659).

    Non-Human Animals with Restricted Immunoglobulin V.sub.H Gene Segments

    [0229] Non-human animals comprising immunoglobulin loci that comprise a restricted number of V.sub.H genes, and one or more D genes and one or more J genes, are provided, as are methods of making and using them. When immunized with an antigen of interest, the non-human animals generate B cell populations with antibody variable regions derived only from the restricted, pre-selected V.sub.H gene or set of V.sub.H genes (e.g., a pre-selected V.sub.H gene and variants thereof). In various embodiments, non-human animals are provided that generate B cell populations that express human antibody variable domains that are human heavy chain variable domains, along with cognate human light chain variable domains. In various embodiments, the non-human animals rearrange human heavy chain variable gene segments and human light chain variable gene segments from modified endogenous mouse immunoglobulin loci that comprise a replacement or insertion of the non-human unrearranged variable region sequences with human unrearranged variable region sequences.

    [0230] Early work on the organization, structure, and function of the immunoglobulin genes was done in part on mice with disabled endogenous loci and engineered to have transgenic loci (randomly placed) with partial human immunoglobulin genes, e.g., a partial repertoire of human heavy chain genes linked with a human constant gene, randomly inserted into the genome, in the presence or absence of a human light chain transgene. Although these mice were somewhat less than optimal for making useful high affinity antibodies, they facilitated certain functional analyses of immunoglobulin loci. Some of these mice had as few as two or three, or even just a single, heavy chain variable gene.

    [0231] Mice that express fully human immunoglobulin heavy chains derived from a single human V.sub.H5-51 gene and 10 human D.sub.H genes and six human J.sub.R genes, with human ? and ?1 constant genes, on a randomly inserted transgene (and disabled endogenous immunoglobulin loci) have been reported (Xu and Davis, 2000, Diversity in the CDR3 Region of V.sub.H Is Sufficient for Most Antibody Specificities, Immunity 13:37-45). The fully human immunoglobulin heavy chains of these mice are mostly expressed with one of just two fully mouse ? light chains derived from the endogenous mouse ? light chain locus (V?1-J?1 or V?2-J?2 only), and can express no ? light chain (the mice are Ig?.sup.?/?). These mice exhibit severely abnormal dysfunction in B cell development and antibody expression. B cell numbers are reportedly 5-10% of wild-type, IgM levels 5-10% of wild-type, and IgG1 levels are only 0.1-1% of wild-type. The observed IgM repertoire revealed highly restricted junctional diversity. The fully human heavy chains display largely identical CDR3 length across antigens, the same J.sub.H (J.sub.H2) usage across antigens, and an initial junctional Q residue, thus reflecting a certain lack of CDR3 diversity. The fully mouse ? light chains nearly all had a V?96L substitution in J?1 as initial junctional residue. The mice are reportedly unable to generate any antibodies against bacterial polysaccharide. Because the human variable domains couple with mouse light chains, the utility of the human variable regions is highly limited.

    [0232] Other mice that have just a single human V.sub.H3-23 gene, human D.sub.H and J.sub.H genes, and mouse light chain genes have been reported, but they exhibit a limited diversity (and thus a limited usefulness) due in part to mispairing potential between human V.sub.H and mouse V.sub.L domains (see, e.g., Mageed et al., 2001, Rearrangement of the human heavy chain variable region gene V3-23 in transgenic mice generates antibodies reactive with a range of antigens on the basis of V.sub.HCDR3 and residues intrinsic to the heavy chain variable region, Clin. Exp. Immunol. 123:1-5). Similarly, mice that bear two V.sub.H genes (3-23 and 6-1) along with human D.sub.H and J.sub.H genes in a transgene containing the human ? constant gene (Bruggemann et al., 1991, Human antibody production in transgenic mice: expression from 100 kb of the human IgH locus, Eur. J. Immunol. 21:1323-1326) and express them in human IgM chains with mouse light chains may exhibit a repertoire limited by mispairing (Mackworth-Young et al., 2003, The role of antigen in the selection of the human V3-23 immunoglobulin heavy chain variable region gene, Clin. Exp. Immunol. 134:420-425).

    [0233] Other transgenic mice that express V.sub.H-restricted fully human heavy chains from a human transgene randomly inserted in the genome, with a limited human ? repertoire expressed from a fully human randomly inserted transgene, have also been reported (see, e.g., Taylor et al., 1992, A transgenic mouse that expresses a diversity of human sequence heavy and light chain immunoglobulins, Nucleic Acids Res. 20(23):6287-6295; Wagner et al., 1994, Antibodies generated form human immunoglobulin miniloci in transgenic mice, Nucleic Acids Res. 22(8):1389-1393). However, transgenic mice that express fully human antibodies from transgenes randomly integrated into the mouse genome, and that comprise damaged endogenous loci, are known to exhibit substantial differences in immune response as compared with wild-type mice that affect the diversity of the antibody variable domains obtainable from such mice.

    [0234] Useful non-human animals that generate a diverse population of B cells that express human antibody variable domains from a restricted V.sub.H gene repertoire and one or more D genes and one or more J genes will be capable of generating, preferably in some embodiments, repertoires of rearranged variable region genes that will be sufficiently diverse. In various embodiments, diversity includes junctional diversity, somatic hypermutation, and polymorphic diversity in V.sub.H gene sequence (for embodiments where V.sub.H genes are present in polymorphic forms). Combinatorial diversity occurs in the pairing of the V.sub.H gene with one of a plurality of cognate human light chain variable domains (which, in various embodiments, comprise junctional diversity and/or somatic hypermutations).

    [0235] Non-human animals comprising a restricted human V.sub.H gene repertoire and a complete or substantially complete human V.sub.L gene repertoire will in various embodiments generate populations of B cells that reflect the various sources of diversity, such as junctional diversity (e.g., VDJ, VJ joining, P additions, N additions), combinatorial diversity (e.g., cognate V.sub.H-restricted human heavy, human light), and somatic hypermutations. In embodiments comprising a restriction of the V.sub.H repertoire to one human V.sub.H gene, the one human V.sub.H gene can be present in two or more variants. In various embodiments, the presence of two or more polymorphic forms of a V.sub.H gene will enrich the diversity of the variable domains of the B cell population.

    [0236] Variations in the germline sequences of gene segments (e.g., V genes) contribute to the diversity of the antibody response in humans. The relative contribution to diversity due to V gene sequence differences varies among V genes. The degree of polymorphism varies across gene families, and is reflected in a plurality of haplotypes (stretches of sequence with coinherited polymorphisms) capable of generating further diversity as observed in V.sub.H haplotype differences between related and unrelated individuals in the human population (see, e.g., Souroujon et al., 1989, Polymorphisms in Human H Chain V Region Genes from the V.sub.HIII Gene Family, J. Immunol. 143(2):706-711). Some have suggested, based on data from particularly polymorphic human V.sub.H gene families, that haplotype diversity in the germline is a major contributor to V.sub.H gene heterogeneity in the human population, which is reflected in the large diversity of different germline V.sub.H genes across the human population (see, Sasso et al., 1990, Prevalence and Polymorphism of Human V.sub.H3 Genes, J. Immunol. 145(8):2751-2757).

    [0237] Although the human population displays a large diversity of haplotypes with respect to the V.sub.H gene repertoire due to widespread polymorphism, certain polymorphisms are reflected in prevalent (i.e., conserved) alleles observed in the human population (Sasso et al., 1990). V.sub.H polymorphism can be described in two principle forms. The first is variation arising from allelic variation associated with differences among the nucleotide sequence between alleles of the same gene segment. The second arises from the numerous duplications, insertions, and/or deletions that have occurred at the immunoglobulin heavy chain locus. This has resulted in the unique situation in which V.sub.H genes derived by duplication from identical genes differ from their respective alleles by one or more nucleotide substitutions. This also directly influences the copy number of V.sub.H genes at the heavy chain locus.

    [0238] Polymorphic alleles of the human immunoglobulin heavy chain variable gene segments (V.sub.H genes) have largely been the result of insertion/deletion of gene segments and single nucleotide differences within coding regions, both of which have the potential to have functional consequences on the immunoglobulin molecule. Table 1 sets forth the functional V.sub.H genes listed by human V.sub.H gene family and the number of identified alleles for each V.sub.H gene in the human immunoglobulin heavy chain locus. There are some findings to suggest that polymorphic V.sub.H genes have been implicated in susceptibility to certain diseases such as, for example, rheumatoid arthritis, whereas in other cases a linkage between V.sub.H and disease has been less clear. This ambiguity has been attributed to the copy number and presence of various alleles in different human populations. In fact, several human V.sub.H genes demonstrate copy number variation (e.g., V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, and V.sub.H3-23). In various embodiments, humanized mice as described herein with restricted V.sub.H repertoires comprise multiple polymorphic variants of an individual V.sub.H family member (e.g., two or more polymorphic variants of V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, or V.sub.H3-23, replacing all or substantially all functional mouse V.sub.H segments at an endogenous mouse locus). In a specific embodiment, the two or more polymorphic variants of mice described herein are in number up to and including the number indicated for the corresponding V.sub.H family member in Table 1 (e.g., for V.sub.H1-69, 13 variants; for V.sub.H1-2, five variants; etc.).

    [0239] Commonly observed variants of particular human V.sub.H genes are known in the art. For example, one of the most complex polymorphisms in the V.sub.H locus belongs to the V.sub.H1-69 gene. The human V.sub.H1-69 gene has 13 reported alleles (Sasso et al., 1993, A fetally expressed immunoglobulin V.sub.H1 gene belongs to a complex set of alleles, Journal of Clinical Investigation 91:2358-2367; Sasso et al., 1996, Expression of the immunoglobulin V.sub.H gene 51p1 is proportional to its germline gene copy number, Journal of Clinical Investigation 97(9):2074-2080) and exists in at least three haplotypes that carry duplications of the V.sub.H1-69 gene, which results in multiple copies of the V.sub.H gene at a given locus. These polymorphic alleles include differences in the complementarity determining regions (CDRs), which may dramatically influence antigen specificity. Table 2 sets for the reported alleles for human V.sub.H1-69 and the SEQ ID NOs for the DNA and protein sequences of the mature heavy chain variable regions. Table 3 sets forth the reported alleles for human V.sub.H1-2 genes and the SEQ ID NOs for the DNA and protein sequences of the mature heavy chain variable regions.

    [0240] Representative genomic DNA and full-length protein sequences of a V.sub.H1-69 gene are set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. FIG. 13 and FIG. 14 set forth DNA and protein alignments of thirteen reported V.sub.H1-69 alleles, respectively. Representative DNA and protein sequences of a V.sub.H1-2 gene are set forth in SEQ ID NO: 60 and SEQ ID NO: 61, respectively. FIG. 16 and FIG. 17 set forth DNA and protein alignments of five reported V.sub.H1-2 alleles, respectively. FIG. 15 and FIG. 18 set forth a percent identity/similarity matrix for aligned protein sequences corresponding to thirteen reported human V.sub.H1-69 alleles and five reported human V.sub.H1-2 alleles, respectively. In various embodiments, the modified locus of the invention comprises a V.sub.H gene selected from Table 1, present in two or more copy number, wherein the copy number includes up to and including the number of alleles shown in Table 1. In one embodiment, the modified locus of the invention comprises a V.sub.H1-69 gene selected from Table 2, present in two or more copy number, wherein the copy number includes up to and including the number of alleles shown in Table 1. In one embodiment, the modified locus of the invention comprises a V.sub.H1-2 gene selected from Table 3, present in two or more copy number, wherein the copy number includes up to and including the number of alleles shown in Table 1.

    [0241] Although embodiments employing a restricted human V.sub.H repertoire in a mouse are extensively discussed, other non-human animals that express a restricted human V.sub.H repertoire are also provided. Such non-human animals include any of those which can be genetically modified to express a restricted human V.sub.H repertoire as disclosed herein, including, e.g., mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey), etc. For example, for those non-human animals for which suitable genetically modifiable ES cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. Methods for modifying a non-human animal genome (e.g., a pig, cow, rodent, chicken, etc. genome) include, e.g., employing a zinc finger nuclease (ZFN) or a transcription activator-like effector nuclease (TALEN) to modify a genome to include a restricted human V.sub.H repertoire. Thus, in one embodiment a method is provided for editing a non-human animal genome to include a restricted human V.sub.H repertoire, comprising a step of editing the genome employing a ZFN or a TALEN to include no more than one, or no more than two, human V.sub.H gene segments (or polymorphic variants thereof), wherein the no more than one or no more than two human V.sub.H gene segments are operably linked to an immunoglobulin constant gene sequence. In one embodiment, the constant gene sequence is selected from a human heavy chain constant sequence and a non-human heavy chain constant sequence. In one embodiment, the constant sequence is non-human and the no more than one or no more than two human V.sub.H gene segments are operably linked to non-human constant gene sequence at an endogenous non-human immunoglobulin locus.

    [0242] In one aspect, the non-human animal is a small mammal, e.g., of the superfamily Dipodoidea or Muroidea. In one embodiment, the genetically modified animal is a rodent. In one embodiment, the rodent is selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from the superfamily Muroidea. In one embodiment, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat. In one embodiment, the genetically modified mouse is from a member of the family Muridae,

    [0243] In one embodiment, the non-human animal is a rodent that is a mouse of a C57BL strain. In one embodiment, the C57BL strain is selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6N, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/01a. In another embodiment, the mouse is a 129 strain. In one embodiment, the 129 strain is selected from the group consisting of 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/Svlm), 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2 (see, e.g., Festing et al. (1999) Revised nomenclature for strain 129 mice, Mammalian Genome 10:836, see also, Auerbach et al. (2000) Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines). In one embodiment, the genetically modified mouse is a mix of an aforementioned 129 strain and an aforementioned C57BL strain (e.g., a C57BL/6 strain). In another embodiment, the mouse is a mix of aforementioned 129 strains, or a mix of aforementioned C57BL/6 strains. In one embodiment, the 129 strain of the mix is a 129S6 (129/SvEvTac) strain. In another embodiment, the mouse is a mix of a 129/SvEv- and a C57BL/6-derived strain. In a specific embodiment, the mouse is a mix of a 129/SvEv- and a C57BL/6-derived strain as described in Auerbach et al. 2000 BioTechniques 29:1024-1032. In another embodiment, the mouse is a BALB strain, e.g., BALB/c strain. In another embodiment, the mouse is a mix of a BALB strain (e.g., BALB/c strain) and another aforementioned strain.

    [0244] In one embodiment, the non-human animal is a rat. In one embodiment, the rat is selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In one embodiment, the rat strain is a mix of two or more of a strain selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

    TABLE-US-00001 TABLE 1 V.sub.H Family V.sub.H Gene Alleles V.sub.H1 1-2 5 1-3 2 1-8 2 1-18 3 1-24 1 1-45 3 1-46 3 1-58 2 1-69 13 V.sub.H2 2-5 10 2-26 1 2-70 13 V.sub.H3 3-7 3 3-9 2 3-11 4 3-13 4 3-15 8 3-16 2 3-20 1 3-21 4 3-23 5 3-30 19 3-30-3 2 3-30-5 1 3-33 6 3-35 1 3-38 2 3-43 2 3-48 4 3-49 5 3-53 4 3-64 5 3-66 4 3-72 2 3-73 2 3-74 3 V.sub.H4 4-4 7 4-28 6 4-30-1 1 4-30-2 5 4-30-4 6 4-31 10 4-34 13 4-39 7 4-59 10 4-61 8 V.sub.H5 5-51 5 V.sub.H6 6-1 2 V.sub.H7 7-4-1 5 7-81 1

    TABLE-US-00002 TABLE 2 SEQ ID NO: IgHV1-69 Allele Accession Number (DNA/Protein) IgHV1-69*01 L22582 34/35 IgHV1-69*02 Z27506 36/37 IgHV1-69*03 X92340 38/39 IgHV1-69*04 M83132 40/41 IgHV1-69*05 X67905 42/43 IgHV1-69*06 L22583 44/45 IgHV1-69*07 Z29978 46/47 IgHV1-69*08 Z14309 48/49 IgHV1-69*09 Z14307 50/51 IgHV1-69*10 Z14300 52/53 IgHV1-69*11 Z14296 54/55 IgHV1-69*12 Z14301 56/57 IgHV1-69*13 Z14214 58/59

    TABLE-US-00003 TABLE 3 SEQ ID NO: IgHV1-2 Allele Accession Number (DNA/Protein) IgHV1-2*01 X07448 60/61 IgHV1-2*02 X62106 62/63 IgHV1-2*03 X92208 64/65 IgHV1-2*04 Z12310 66/67 IgHV1-2*05 HM855674 68/69

    Antigen-Dependent V.SUB.H .Gene Usage

    [0245] Antigen-dependent preferential usage of V.sub.H genes can be exploited in the development of human therapeutics targeting clinically significant antigens. The ability to generate a repertoire of antibody variable domains using a particular V.sub.H gene can provide a significant advantage in the search for high-affinity antibody variable domains to use in human therapeutics. Studies on naive mouse and human V.sub.H gene usage in antibody variable domains reveal that most heavy chain variable domains are not derived from any particular single or dominantly used V.sub.H gene. On the other hand, studies of antibody response to certain antigens reveal that in some cases a particular antibody response displays a biased usage of a particular V.sub.H gene in the B cell repertoire following immunization.

    [0246] Although the human V.sub.H repertoire is quite diverse, by some estimates the expected frequency of usage of any given V.sub.H gene, assuming random selection of V.sub.H genes, is about 2% (Brezinschek et al., 1995, Analysis of the Heavy Chain Repertoire of Human Peripheral B Cells Using Single-Cell Polymerase Chain Reaction, J. Immunol. 155:190-202). But V.sub.H usage in peripheral B cells in humans is skewed. In one study, functional V gene abundance followed the pattern V.sub.H3>V.sub.H4>V.sub.H1>V.sub.H2>V.sub.H5>V.sub.H6 (Davidkova et al., 1997, Selective Usage of V.sub.H Genes in Adult Human Lymphocyte Repertoires, Scand. J. Immunol. 45:62-73). One early study estimated that V.sub.H3 family usage frequency was about 0.65, whereas V.sub.H1 family usage frequency was about 0.15; these and other observations suggest that the germline complexity of the human V.sub.H repertoire is not precisely reflected in the peripheral B cell compartment in humans that have a normal germline V.sub.H repertoire, a situation that is similar to that observed in the mousei.e., V.sub.H gene expression is non-stochastic (Zouali and These, 1991, Probing V.sub.H Gene-Family Utilization in Human Peripheral B Cells by In Situ Hybridization, J. Immunol. 146(8):2855-2864). According to one report, V.sub.H gene usage in humans, from greatest to least, is V.sub.H3>V.sub.H4>V.sub.H1>V.sub.H5>V.sub.H2>V.sub.H6; rearrangements in peripheral B cells reveal that V.sub.H3 family usage is higher than to be expected based on the relative number of germline V.sub.H3 genes (Brezinschek et al., 1995). According to another report V.sub.H usage in humans follows the pattern V.sub.H3>V.sub.H5>V.sub.H2>V.sub.H1>V.sub.H4>V.sub.H6, based on analysis of pokeweed mitogen-activated peripheral small immunocompetent B cells (Davidkova et al., 1997, Selective Usage of V.sub.H Genes in Adult Human B Lymphocyte Repertoires, Scand. J. Immunol. 45:62-73). One report asserts that among the most frequently used V.sub.H3 family members are 3-23, 3-30 and 3-54 (Brezinschek et al., 1995). In the V.sub.H4 family, member 4-59 and 4-4b were found relatively more frequently (Id.), as well as 4-39 and 4-34 (Brezinscheck et al., 1997, Analysis of the Human V.sub.H Gene Repertoire, J. Clin. Invest. 99(10):2488-2501). Others postulate that the activated heavy chain repertoire is skewed in favor of high V.sub.H5 expression and lower V.sub.H3 expression (Van Dijk-Hard and Lundkvist, 2002, Long-term kinetics of adult human antibody repertoires, Immunology 107:136-144). Other studies assert that the most commonly used V.sub.H gene in the adult human repertoire is V.sub.H4-59, followed by V.sub.H3-23 and V.sub.H3-48 (Arnaout et al., 2001, High-Resolution Description of Antibody Heavy-Chain Repertoires in Humans, PLoS ONE 6(8):108). Although usage studies are based on relatively small sample numbers and thus exhibit high variance, taken together the studies suggest that V gene expression is not purely stochastic. Indeed, studies with particular antigens have established thatin certain casesthe deck is firmly stacked against certain usages and in favor of others.

    [0247] Over time, it became apparent that the observed repertoire of human heavy chain variable domains generated in response to certain antigens is highly restricted. Some antigens are associated almost exclusively with neutralizing antibodies having only certain particular V.sub.H genes, in the sense that effective neutralizing antibodies are derived from essentially only one V.sub.H gene. Such is the case for a number of clinically important human pathogens.

    [0248] V.sub.H1-69-derived heavy chains have been observed in a variety of antigen-specific antibody repertoires of therapeutic significance. For instance, V.sub.H1-69 was frequently observed in heavy chain transcripts of an IgE repertoire of peripheral blood lymphocytes in young children with atopic disease (Bando et al., 2004, Characterization of V.sub.HE gene expressed in PBL from children with atopic diseases: detection of homologous V.sub.H1-69 derived transcripts from three unrelated patients, Immunology Letters 94:99-106). V.sub.H1-69-derived heavy chains with a high degree of somatic hypermutation also occur in B cell lymphomas (Perez et al., 2009, Primary cutaneous B-cell lymphoma is associated with somatically hypermutated immunoglobulin variable genes and frequent use of V.sub.H1-69 and V.sub.H4-59 segments, British Journal of Dermatology 162:611-618), whereas some V.sub.H1-69-derived heavy chains with essentially germline sequences (i.e., little to no somatic hypermutation) have been observed among autoantibodies in patients with blood disorders (Pos et al., 2008, V.sub.H1-69 germline encoded antibodies directed towards ADAMTS13 in patients with acquired thrombotic thrombocytopenic purpura, Journal of Thrombosis and Haemostasis 7:421-428).

    [0249] Further, neutralizing antibodies against viral antigens such as HIV, influenza and hepatitis C (HCV) have been found to utilize germline and/or somatically mutated V.sub.H1-69-derived sequences (Miklos et al., 2000, Salivary gland mucosa-associated lymphoid tissue lymphoma immunoglobulin V.sub.H genes show frequent use of 1/1-69 with distinctive CDR3 features, Blood 95(12):3878-3884; Kunert et aL, 2004, Characterization of molecular features, antigen-binding, and in vitro properties of IgG and IgM variants of 4E10, an anti-HIV type I neutralizing monoclonal antibody, Aids Research and Human Retroviruses 20(7):755-762; Chan et al., 2001, V.sub.H1-69 gene is preferentially used by hepatitis C virus-associated B cell lymphomas and by normal B cells responding to the E2 viral antigen, Blood 97(4):1023-1026; Carbonari et al., 2005, Hepatitis C virus drives the unconstrained monoclonal expansion of V.sub.H1-69-expressing memory B cells in type II cryoglobulinemia: A model of infection-driven lymphomagenesis, Journal of Immunology 174:6532-6539; Wang and Palese, 2009, Universal epitopes of influenza virus hemagglutinins?, Nature Structural & Molecular Biology 16(3):233-234; Sui et al., 2009, Structural and functional bases for broad-spectrum neutralization of avian and human influenza A viruses, Nature Structural & Molecular Biology 16(3):265-273; Marasca et aL, 2001, Immunoglobulin Gene Mutations and Frequent Use of V.sub.H1-69 and V.sub.H4-34 Segments in Hepatitis C Virus-Positive and Hepatitis C Virus-Negative Nodal Marginal Zone B-Cell Lymphoma, Am. J. Pathol. 159(1):253-261).

    [0250] V.sub.H usage bias is also observed in the humoral immune response to Haemophilus influenzae type b (Hib PS) in humans. Studies suggest that the V.sub.HIII family (the V.sub.HIIIb subfamily in particular, V.sub.H9.1) exclusively characterizes the human humoral response to Hib PS, with diverse D and J genes (Adderson et al., 1991, Restricted Ig H Chain V Gene Usage in the Human Antibody Response to Haemophilus influenzae Type b Capsular Polysaccharide, J. Immunol. 147(5):1667-1674; Adderson et al., 1993, Restricted Immunoglobulin V.sub.H Usage and VDJ Combinations in the Human Response to Haemophilus influenzae Type b Capsular Polysaccharide, J. Clin. Invest. 91:2734-2743). Human J.sub.H genes also display biased usage; J.sub.H4 and J.sub.H6 are observed at about 38-41% in peripheral B cells in humans (Brezinschek et aL, 1995).

    [0251] V.sub.H usage in HIV-1-infected humans is reportedly biased against V.sub.H3 usage and in favor of V.sub.H1 and V.sub.H4 gene families (Wisnewski et al., 1996, Human Antibody Variable Region Gene Usage in HIV-1 Infection, J. Acquired Immune Deficiency Syndromes &Human Retroviology 11(1):31-38). However, cDNA analysis of bone marrow from affected patients' revealed significant V.sub.H3 usage not expressed in the functional B cell repertoire, where Fabs reflecting the V.sub.H3 usage exhibited effective in vitro neutralization of HIV-1 (Id.). It might be postulated that the humoral immune response to HIV-1 infection is possibly attenuated due to the V.sub.H restriction; modified non-human animals as described herein (not infectable by HIV-1) might thus be useful for generating neutralizing antibody domains derived from particular V.sub.H genes present in the genetically modified animals described herein, but derived from different V.sub.H genes than those observed in the restricted repertoire of affected humans.

    [0252] Thus, the ability to generate high affinity human antibody variable domains in V.sub.H-restricted mice, e.g., (restricted, e.g., to a V.sub.H3 family member and polymorph(s) thereof) immunized with HIV-1 might provide a rich resource for designing effective HIV-1-neutralizing human therapeutics by thoroughly mining the restricted (e.g., restricted to a V.sub.H3 family member or variant(s) thereof) repertoire of such an immunized mouse.

    [0253] Restriction of the human antibody response to certain pathogens may reduce the likelihood of obtaining antibody variable regions from affected humans that can serve as springboards for designing high affinity neutralizing antibodies against the pathogen. For example, the human immune response to HIV-1 infection is clonally restricted throughout HIV-1 infection and into AIDS progression (Muller et al., 1993, B-cell abnormalities in AIDS: stable and clonally restricted antibody response in HIV-1 infection, Scand. J. Immunol. 38:327-334; Wisnewski et al., 1996). Further, V.sub.H genes are in general not present in all polymorphic forms in any particular individual; certain individuals in certain populations possess one variant, whereas individuals in other populations possess a different variant. Thus, the availability of a biological system that is restricted to a single V.sub.H gene and its variants will in various embodiments provide a hitherto unexploited source of diversity for generating antibody variable regions (e.g., human heavy and light cognate domains) based on a restricted V.sub.H gene. Thus, in one aspect, a genetically modified non-human animal is provided that comprises a plurality of polymorphic variants of no more than one, or no more than two, human V.sub.H gene segment family member. In one embodiment, the no more than one, or no more than two, human V.sub.H gene segments are operably linked to one or more human D.sub.H gene segments, one or more human J.sub.H gene segments, and a human or non-human constant region gene segment. In one embodiment the constant region is at an endogenous non-human immunoglobulin constant gene locus. In one embodiment, the non-human animal further comprises a nucleic acid sequence derived from a human V.sub.L sequence, e.g., a rearranged or unrearranged human V.sub.L gene segment or a rearranged human V.sub.L/J.sub.L sequence. In one embodiment, the nucleic acid sequence derived from the human V.sub.L sequence is at an endogenous non-human V.sub.L gene locus; in one embodiment, the nucleic acid sequence derived form the human V.sub.L sequence is on a transgene. In a specific embodiment, the non-human animal is incapable of expressing an immunoglobulin light chain variable domain that itself comprises an endogenous V.sub.L or J.sub.L gene segment, and comprises no more than one, or no more than two, light chain genes that encode rearranged human V.sub.L domains (i.e., from no more than one, or no more than two, rearranged human V.sub.L/J.sub.L sequences).

    [0254] Genetically modified mice that express human heavy chain variable regions with restricted V.sub.H gene segment usage are useful to generate a relatively large repertoire of junctionally diverse, combinatorially diverse, and somatically mutated high affinity human immunoglobulin heavy chain variable regions from an otherwise restricted repertoire. A restricted repertoire, in one embodiment, refers to a predetermined limitation in the number and/or identity of germline genes that results in the mouse being unable to form a rearranged heavy chain gene that is derived from any V gene other than a preselected V gene. In embodiments that employ a preselected V gene but not a preselected D and/or J gene, the repertoire is restricted with respect to the identity of the V gene but not the D and/or J gene (e.g., the repertoire consists essentially of no more than one, or no more than two, V.sub.H gene segments (and/or polymorphs thereof); and a plurality of D gene segments and a plurality of J gene segments)). The identity of the preselected V gene (and any preselected D and/or J genes) is not limited to any particular V gene.

    [0255] Designing a mouse so that it rearranges a single V.sub.H gene (present as a single segment or a set of variants) with a variety of human D and J gene segments (e.g., D.sub.H and J.sub.H segments) provides an in vivo junctional diversity/combinatorial diversity/somatic hypermutation permutation machine that can be used to iterate mutations in resulting rearranged heavy chain variable region sequences (e.g., V/D/J or V/J, as the case may be). In such a mouse, the clonal selection process operates to select suitable variable regions that bind an antigen of interest that are based on a single preselected V.sub.H gene (or variants thereof). Because the mouse's clonal selection components are dedicated to selection based on the single preselected V.sub.H gene segment, background noise (e.g., a wide variety of non antigen-binding V.sub.H domains derived from many germline gene segments) is largely eradicated. With judicious selection of the V.sub.H gene segment, a relatively larger number of clonally selected, antigen-specific antibodies can be screened in a shorter period of time than with a mouse with a large diversity of V segments.

    [0256] Preselecting limited repertoire and restricting a mouse to a single V segment provides a system for permuting V/D/J junctions at a rate that is in various embodiments higher than that observed in mice that otherwise have up to 40 or more V segments to recombine with D and J regions. Removal of other V segments frees the locus to form more V/D/J combinations for the preselected V segment than otherwise observed. The increased number of transcripts that result from the recombination of the preselected V with one of a plurality of D and one of a plurality of J segments will feed those transcripts into the clonal selection system in the form of pre-B cells, and the clonal selection system is thus dedicated to cycling B cells that express the preselected V region. In this way, more unique V region rearrangements derived from the preselected V segment can be screened by the organism than would otherwise be possible in a given amount of time.

    [0257] In various aspects, mice are described that enhance the junctional diversity of V/D/J recombinations for the preselected V region, because all or substantially all recombinations of the immunoglobulin heavy chain variable locus will be of the preselected V segment and the D and J segments that are placed in such mice. Therefore, the mice provide a method for generating a diversity of CDR3 segments using a base, or restricted V.sub.H gene repertoire.

    [0258] In one aspect, a non-human animal is provided, wherein the B cell population of the non-human animal expresses immunoglobulin heavy chains that are derived from no more than one, or no more than two human V.sub.H gene segments. In one embodiment, each of the no more than one, or no more than two, human V.sub.H gene segments are present in two or more polymorphic forms. In one embodiment, the human V.sub.H gene segment is present in three, four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 polymorphic forms. In one embodiment, the non-human animal expresses a human light chain variable domain derived from a human V.sub.L gene segment.

    [0259] In one aspect, a method is provided for generating a B cell population in a non-human animal, wherein the B cell population expresses human heavy chains derived from a single germline human V.sub.H gene segment and two or more human D gene segments and two or more human J gene segments; the method comprising a step of immunizing a non-human animal as described herein with an antigen of interest, and allowing the non-human animal to mount an immune response to the antigen of interest, wherein the immune response comprises expressing the human heavy chains on the surface of B cells in the B cell population In one embodiment, the non-human animal is a rodent (e.g., a mouse or rat). In one embodiment, the human V.sub.H gene segment, human D.sub.H segment, and human J.sub.H segment are operably linked to a non-human constant region gene. In one embodiment, the non-human animal further comprises a nucleic acid sequence encoding a human V.sub.L domain. In one embodiment, the nucleic acid sequence encoding the human V.sub.L domain is linked to a non-human light chain constant region gene sequence.

    [0260] In one aspect, a method for making a non-human animal that expresses an immunoglobulin population characterized by the immunoglobulins having heavy chains that are derived from a plurality of rearrangements of a single human V.sub.H gene segment (or sing human V.sub.H gene family member) and one of a plurality of D.sub.H gene segments and one of a plurality of J.sub.H gene segments, is provided. In one embodiment, the human V.sub.H gene segment is a human V.sub.H1-69 gene segment. In one embodiment, the human V.sub.H gene segment is a human V.sub.H1-2 gene segment.

    [0261] In one aspect, a method is provided for generating a population of human immunoglobulin heavy chain variable domains whose CDR1 and CDR2 are derived from the same germline V.sub.H gene segment, and whose CDR3 are derived from the germline gene segment and two or more human D segments, and two or more human J segments; the method comprising immunizing a non-human animal as described herein with an antigen of interest, and allowing the non-human animal to mount an immune response to the antigen of interest, wherein the immune response comprises expressing the human heavy chain variable domains in the context of a light chain variable domain. In one embodiment, the non-human animal is a rodent (e.g., a mouse or rat). In one embodiment, the human V.sub.H gene segment, human D segment, and human J segment are operably linked to a non-human constant region gene. In one embodiment, the non-human animal further comprises a nucleic acid sequence encoding a human V.sub.L domain. In one embodiment, the nucleic acid sequence encoding the human V.sub.L domain is linked to a non-human light chain constant region gene sequence.

    [0262] In one aspect, a genetically modified non-human animal is provided, wherein the non-human animal is incapable of expressing a non-human V.sub.H domain, and wherein each immunoglobulin heavy chain of the heavy chain population expressed in the animal comprises a human V.sub.H domain comprising a CDR1 and a CDR2 that are identical but for one or more somatic hypermutations, and wherein the heavy chain population comprises a plurality of CDR3 sequences derived from a plurality of rearrangements with a plurality of D and J gene segments.

    [0263] In one aspect, a biological system for generating variation in CDR3 identity and length is provided, comprising a genetically modified non-human animal as described herein, wherein the non-human animal comprises no more than or no more than two human V.sub.H gene segments, and two or more D gene segments and one or more J gene segments, wherein the non-human animal further comprises a humanized immunoglobulin light chain locus. In various embodiments, the non-human animal in response to immunization with an antigen of interest generates an immune response that comprises expressing an immunoglobulin heavy chain population characterized by each heavy chain having CDR1s and CDR2s that differ only by somatic hypermutation, and CDR3s that differ by rearrangement and somatic hypermutation. In one embodiment, the biological system is a mouse that is genetically modified as described herein. In one embodiment, the human V.sub.H gene segment and the human V.sub.L gene segment are at endogenous mouse heavy and light immunoglobulin loci, respectively. In one embodiment, one or more of the human V.sub.H gene segment and the human V.sub.L gene segment are on transgenes (i.e., at a locus other than an endogenous immunoglobulin locus).

    EXAMPLES

    [0264] The following examples are provided so as to describe to those of ordinary skill in the art how to make and use methods and compositions of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Unless indicated otherwise, temperature is indicated in Celsius, and pressure is at or near atmospheric. In the foregoing Examples, when the use of kits and/reagents from various suppliers is indicated, all procedures were carried out according to manufacturer's specifications.

    Example 1 Construction of Restricted Heavy Chain Loci

    [0265] A uniquely engineered human heavy chain locus containing a single human V.sub.H gene segment located upstream of all the human D.sub.H and J.sub.H gene segments was created by a series of homologous recombination reactions in bacterial cells (BHR) using Bacterial Artificial Chromosome (BAC) DNA. Several targeting constructs for creation of a single V.sub.H containing heavy chain locus were constructed using VELOCIGENE? genetic engineering technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela, D. M. et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis. Nature Biotechnology 21(6): 652-659).

    [0266] Construction of a Human V.sub.H1-69 Restricted Heavy Chain Locus. Briefly, four modifications were performed using human BAC DNA to create a targeting construct containing a human V.sub.H1-69 gene segment with all the human D.sub.H and J.sub.H segments (FIG. 1). In the first modification, a modified human BAC containing multiple distal (5) human V.sub.H gene segments, including V.sub.H1-69, an upstream hygromycin selection cassette and a 5 mouse homology arm was targeted with a second spectinomycin cassette, which also contained a modified recombination signal sequence (RSS; BHR 1, FIG. 1, top left). This modified recombination signal sequence (RSS) introduced two point mutations (T to A and G to A) in the 3 RSS region of the human V.sub.H1-69 gene changing the RSS nonamer to the optimal consensus sequence. Thus, the first modification (BHR 1) created a human genomic fragment containing the human V.sub.H1-69 gene segment with a modified 3 RSS, a unique AsiSI restriction site about 180 bp downstream of the RSS and a spectinomycin cassette (FIG. 1, middle left).

    [0267] The second modification (BHR 2) included the use of a neomycin (Neo) cassette flanked by Frt sites to delete the hygromycin cassette and 5 human V.sub.H gene segments upstream of the V.sub.H1-69 gene segment. This modification was targeted 5 to the human V.sub.H1-69 gene segment to leave intact about 8.2 kb of the promoter region of human V.sub.H1-69 and the 5 mouse homology arm (FIG. 1, bottom left).

    [0268] The third modification (BHR 3) included another spectinomycin cassette flanked by uniquely engineered 5 PI-SceI and 3 AsiSI sites targeted to a human genomic fragment containing the first three functional human V.sub.H gene segments and all the human D.sub.H and J.sub.H gene segments (FIG. 1, middle right). The human genomic fragment was previously targeted with a neomycin cassette and contained 5 and 3 homology arms containing the mouse genomic sequence 5 and 3 of the endogenous heavy chain locus including the 3 intronic enhancer and the IgM gene. This modification deleted the 5 mouse genomic sequence and human V.sub.H gene segments, leaving about 3.3 kb of the V.sub.H-D.sub.H intergenic region upstream of the human D.sub.H1-1 gene segment, all of the human D.sub.H and J.sub.H segments, and the 3 mouse genomic fragment containing the 3 intronic enhancer and the IgM gene (FIG. 1, bottom right).

    [0269] The fourth modification was achieved by employing the unique PI-SceI and AsiSI sites (described above) to ligate the two modified BACs from BHR 2 and BHR 3 (FIG. 1, bottom center), which yielded the final targeting construct. The final targeting construct for the creation of a modified heavy chain locus containing a single human V.sub.H gene segment and all the human D.sub.H and J.sub.H gene segments in ES cells contained, from 5 to 3, a 5 homology arm containing about 20 kb of mouse genomic sequence upstream of the endogenous heavy chain locus, a 5 Frt site, a neomycin cassette, a 3 Frt site, about 8.2 kb of the human V.sub.H1-69 promoter, the human V.sub.H1-69 gene segment with a modified 3 RSS, 27 human D.sub.H gene segments, six human J.sub.H segments, and a 3 homology arm containing about 8 kb of mouse genomic sequence downstream of the mouse J.sub.H gene segments including the 3 intronic enhancer and IgM gene (FIG. 1, bottom). The Human V.sub.H1-69 Targeting Vector (SEQ ID NO: 3) was linearized and electroporated into mouse ES cells heterozygous for a deletion of the endogenous heavy chain locus.

    [0270] Construction of a Human V.sub.H1-2 Restricted Heavy Chain Locus.

    [0271] Using the steps described above, other polymorphic V.sub.H gene segments in the context of mouse heavy chain constant regions are employed to construct a series of mice having a restricted number immunoglobulin heavy chain V segments (e.g., 1, 2, 3, 4, or 5), wherein the V segments are polymorphic variants of a V gene family member. Exemplary polymorphic V.sub.H gene segments are derived from human V.sub.H gene segments including, e.g., V.sub.H1-2, V.sub.H2-26, V.sub.H2-70 and V.sub.H3-23. Such human V.sub.H gene segments are obtained, e.g., by de novo synthesis (e.g., Blue Heron Biotechnology, Bothell, Wash.) using sequences available on published databases. Thus, DNA fragments encoding each V.sub.H gene are, in some embodiments, generated independently for incorporation into targeting vectors, as described herein. In this way, multiple modified immunoglobulin heavy chain loci comprising a restricted number of V.sub.H gene segments are engineered in the context of mouse heavy chain constant regions. An exemplary targeting strategy for creating a restricted humanized heavy chain locus containing a human V.sub.H1-2 gene segment, 27 human D.sub.H gene segments, and six human J.sub.H gene segments is shown in FIG. 2.

    [0272] Briefly, a modified human BAC clone containing three human V.sub.H gene segments (V.sub.H6-1, V.sub.H1-2, V.sub.H1-3), 27 human D.sub.H gene segments, and six human J.sub.H gene segments (see U.S. Ser. No. 13/404,075; filed 24 Feb. 2012, herein incorporated by reference) is used to create a restricted humanized heavy chain locus containing a human V.sub.H1-2 gene segment. This modified BAC clone functionally links the aforementioned human heavy chain gene segments with the mouse intronic enhancer and the IgM constant region. The restricted human V.sub.H1-2 based heavy chain locus is achieved by two homologous recombinations using the modified human BAC clone described above.

    [0273] For the first homologous recombination, 205 bp of the human V.sub.H6-1 gene segment (from about 10 bp upstream (5) of the V.sub.H6-1 start codon in exon 1 to about 63 bp downstream (3) of the beginning of exon 2) in the modified human BAC clone is deleted by bacterial homologous recombination using a spectinomycin (aadA) cassette flanked by unique PI-SceI restriction sites (FIG. 2, BHR 1). This allows for subsequent removal of the aadA cassette without disrupting other human gene segments within the restricted heavy chain locus.

    [0274] For the second homologous recombination, the 5 end of the modified human BAC clone including the entire human V.sub.H1-3 gene segment and about 60 bp downstream (3) of the gene segment is deleted by homologous recombination using a hygromycin cassette containing flanking 5 AsiSI and 3 AscI restriction sites (FIG. 2, BHR 2). As described above, the spectinomycin cassette is optionally removed after confirmation of the final targeting vector including deletion of the two human V.sub.H gene segments flanking the human V.sub.H1-2 gene segment (FIG. 2, bottom). An exemplary human V.sub.H1-2 targeting vector is set forth in SEQ ID NO: 70.

    [0275] Employing polymorphic V.sub.H gene segments in a restricted immunoglobulin heavy chain locus represents a novel approach for generating antibodies, populations of antibodies, and populations of B cells that express antibodies having heavy chains with diverse CDRs derived from a single human V.sub.H gene segment. Exploiting the somatic hypermutation machinery of the host animal along with combinatorial association with rearranged human immunoglobulin light chain variable domains results in the engineering of unique heavy chains and unique V.sub.HN.sub.L pairs that expand the immune repertoire of genetically modified animals and enhance their usefulness as a next generation platform for making human therapeutics, especially useful as a platform for making neutralizing antibodies specific for human pathogens.

    [0276] Thus, using the strategy outlined above for incorporation of additional and/or other polymorphic V.sub.H gene segments into the mouse immunoglobulin heavy chain locus allows for the generation of novel antibody repertoires for use in neutralizing human pathogens that might otherwise effectively evade the host immune system.

    [0277] Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE? method (supra). Mice bearing a humanized heavy chain locus containing a single human V.sub.H gene segment, all the human D.sub.H and J.sub.H gene segments operably linked to the mouse immunoglobulin constant region genes were identified by genotyping using a modification of allele assay (Valenzuela et al., supra) that detected the presence of the neomycin cassette, the human V.sub.H gene segment and a region within the human D.sub.H and J.sub.H gene segments as well as endogenous heavy chain sequences. Table 4 sets forth the primers and probes used in this assay to confirm mice harboring a restricted heavy chain locus containing a single human V.sub.H1-69 gene segment, 27 human D.sub.H gene segments and six human J.sub.H gene segments.

    [0278] Mice bearing an engineered heavy chain locus that contains a single human V.sub.H gene segment can be bred to a FLPe deletor mouse strain (see, e.g., Rodriguez, C. I. et al. (2000) High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nature Genetics 25: 139-140) in order to remove any Frt'ed neomycin cassette introduced by the targeting vector that is not removed, e.g., at the ES cell stage or in the embryo. Optionally, the neomycin cassette is retained in the mice.

    [0279] Pups are genotyped and a pup heterozygous for a humanized heavy chain locus containing a single human V.sub.H gene segment, all the human D.sub.R and J.sub.H segments operably linked to the endogenous mouse immunoglobulin constant genes is selected for characterizing the immunoglobulin heavy chain repertoire.

    TABLE-US-00004 TABLE4 Name SEQID (RegionDetected) Sequence(5'-3') NO: hyg Forward:TGCGGCCGATCTTAGCC 4 (hygromycin Reverse:TTGACCGATTCCTTGCGG 5 cassette) Probe:ACGAGCGGGTTCGGCCCATTC 6 neo Forward:GGTGGAGAGGCTATTCGGC 7 (neomycin Reverse:GAACACGGCGGCATCAG 8 cassette) Probe:TGGGCACAACAGACAATCGGCTG 9 hIgH9T Forward:TCCTCCAACGACAGGTCCC 10 (humanD.sub.H-J.sub.H Reverse:GATGAACTGACGGGCACAGG 11 genomic Probe:TCCCTGGAACTCTGCCCCGACACA 12 sequence) 77h3 Forward:CTCTGTGGAAAATGGTATGGAGATT 13 (humanV.sub.H1-69 Reverse:GGTAAGCATAGAAGGTGGGTATCTTT 14 genesegment) Probe:ATAGAACTGTCATTTGGTCCAGCAATCCCA 15 mIgHA7 Forward:TGGTCACCTCCAGGAGCCTC 16 (mouseD.sub.H-J.sub.H Reverse:GCTGCAGGGTGTATCAGGTGC 17 genomic Probe:AGTCTCTGCTTCCCCCTTGT 18 sequence) GGCTATGAGC 88710T Forward:GATGGGAAGAGACTGGTAACATTTGTAC 19 (mouse3 V.sub.H Reverse:TTCCTCTATTTCACTCTTTGAGGCTC 20 genomic Probe:CCTCCACTGTGTTAATGGCTGCCACAA 21 sequence) mIgHd10 Forward:GGTGTGCGATGTACCCTCTGAAC 22 (mouse5 V.sub.H Reverse:TGTGGCAGTTTAATCCAGCTTTATC 23 genomic Probe:CTAAAAATGCTACACCTGGG 24 sequence) GCAAAACACCTG mIgHp2 Forward:GCCATGCAAGGCCAAGC 25 (mouseJ.sub.H Reverse:AGTTCTTGAGCCTTAGGGTGCTAG 26 genomic Probe:CCAGGAAAATGCTGCCAGAGCCTG 27 sequence)

    Example 2 Characterization of Mice Expressing Heavy Chains Derived from a Single Human V.SUB.H .Gene Segment

    [0280] Mice homozygous for a single human V.sub.H gene segment at the endogenous heavy chain locus as described in Example 1 were evaluated for expression and B cell development using flow cytometry.

    [0281] Briefly, spleens and bone marrow was harvested from wild type (n=3 per group; six weeks old, male and female) and mice homozygous for a single human V.sub.H gene segment, all human D.sub.H and J.sub.H gene segments operably linked to mouse heavy chain constant regions. Red blood cells from spleens were lysed with ACK lysis buffer (Lonza Walkersville), followed by washing with complete RPMI medium.

    [0282] Flow cytometry. Cells (1?10.sup.6) were incubated with anti-mouse CD16/CD32 (2.4G2, BD PHARMINGEN?) on ice for 10 minutes, followed by labeling with the following antibody panels for 30 minutes on ice. Bone marrow panel: anti-mouse FITC-CD43 (1B11, BioLegend), PE-ckit (2B8, BIOLEGEND?), PeCy7-IgM (11/41, EBIOSCIENCE?), PerCP-Cy5.5-IgD (11-26c.2a, BIOLEGEND?), APC-eFluor 780-6220 (RA3-6B2, EBIOSCIENCE?), APC-CD19 (MB19-1, EBIOSCIENCE?). Bone marrow and spleen panel: anti-mouse FITC-ID((187.1, BD Biosciences), PE-10, (RML-42, BIOLEGEND?), PeCy7-IgM (II/41, EBIOSCIENCE?), PerCP-Cy5.5-IgD (11-26c.2a, BIOLEGEND?), Pacific Blue-CD3 (17A2, BIOLEGEND?), APC-B220 (RA3-6B2, EBIOSCIENCE?), APC-H7-CD19 (ID3, BD Biosciences). Bone marrow: immature B cells (B220.sup.intIgM.sup.+), mature B cells (B220.sup.hiIgM.sup.+), pro B cells (CD19.sup.+ckit.sup.+CD43.sup.+), pre B cells (CD19.sup.+ckit.sup.?CD43.sup.?), immature Ig?.sup.+ B cells (B220.sup.intIgM.sup.+Ig?.sup.+Ig?), immature Ig?.sup.+ B cells (B220.sup.intIgM.sup.+Ig?.sup.?Ig?.sup.+), mature Ig?.sup.+ B cells (B220.sup.intIgM.sup.+Ig?.sup.+), mature Ig?.sup.+ B cells (B220.sup.intIgM.sup.+Ig?.sup.?Ig?.sup.+). Spleen: B cells (CD19.sup.+), mature B cells (CD19.sup.+IgD.sup.hiIgM.sup.int), transitional/immature B cells (CD19.sup.+IgD.sup.intIgM.sup.hi) Bone marrow and spleen: Ig?.sup.+ B cells (CD19.sup.+Ig?.sup.+Ig?.sup.?), Ig?.sup.+ B cells (CD19.sup.+Ig?.sup.?Ig?.sup.+).

    [0283] Following staining, cells were washed and fixed in 2% formaldehyde. Data acquisition was performed on a LSRII flow cytometer and analyzed with FLOWJO? software (Tree Star, Inc.). Results for the splenic compartment are shown in FIGS. 3, 4A and 5-7. Results for the bone marrow compartment are shown in FIGS. 4B and 8-11B.

    [0284] Human V.sub.H Expression. Expression of the human V.sub.H1-69 gene segment was determined for mice heterozygous and homozygous for a human V.sub.H1-69 gene segment, all human D.sub.H and J.sub.H gene segments operably linked to mouse heavy chain constant regions by a quantitative PCR assay using TAQMAN? probes.

    [0285] Briefly, CD19.sup.+ B cells were purified from the spleens of groups of mice (n=3 per group) using mouse CD19 microbeads (Miltenyi Biotec) according to manufacturer's specifications. Total RNA was purified using the RNEASY? Mini kit (Qiagen) and genomic RNA was removed using an RNase-free DNase on-column treatment (Qiagen). About 200 ng mRNA was reverse-transcribed into cDNA using the First Stand cDNA Synthesis kit (Invitrogen), followed by amplification with the TAQMAN? Universal PCR Master Mix (Applied Biosystems) using the ABI 7900 Sequence Detection System (Applied Biosystems). Unique primer/probe combinations were employed to specifically determine expression of human V.sub.H1-69-derived heavy chains (Table 5). Relative expression was normalized to the mouse ? constant region (mC.sub.?). The results are shown in FIG. 12.

    TABLE-US-00005 TABLE5 Name Sequence(5-3) SEQIDNO: hIgHV1-69 Sense:AACTACGCACAGAAGTTCCAGG 28 Anti-sense:GCTCGTGGATTTGTCCGC 29 Probe:CAGAGTCACGATTACC 30 mCK Sense:TGAGCAGCACCCTCACGTT 31 Antisense:GTGGCCTCACAGGTATAGCTGTT 32 Probe:ACCAAGGACGAGTATGAA 33

    Example 3 Humoral Immune Response in Mice Expressing Heavy Chains Derived from a Single Human V.SUB.H .Gene Segment

    [0286] The humoral immune response was determined for mice homozygous for human heavy and ? light chain variable gene loci (H.sub.?) and mice homozygous for a single human V.sub.H gene segment, all human D.sub.H and J.sub.H gene segments operably linked to mouse heavy chain constant regions (1hV.sub.H HO) by comparative immunization using a human cell surface receptor (Antigen A).

    [0287] Immunization.

    [0288] Serum was collected from groups of mice prior to immunization with the above antigen. Antigen (2.35 ?g each) was administered in an initial priming immunization mixed with 10 ?g of CpG oligonucleotide (Invivogen) and 25 ?g of Adju-phos (Brenntag) as adjuvants. The immunogen was administered via footpad (f.p.) in a volume of 25 ?l per mouse. Subsequently, mice were boosted via f.p. with 2.3 ?g of antigen along with 10 ?g CpG and 25 ?g Adju-Phos as adjuvants on days 3, 6, 11, 13, 17, and 20 for a total of six boosts. Mice were bled on days 15 and 22 after the fourth and sixth boosts, respectively, and antisera were assayed for antibody titers to Antigen A.

    [0289] Antibody titers were determined in sera of immunized mice using an ELISA assay. Ninety six-well microtiter plates (Thermo Scientific) were coated with Antigen A (1 ?g/ml) in phosphate-buffered saline (PBS, Irvine Scientific) overnight at 4? C. The following day, plates were washed with phosphate-buffered saline containing 0.05% Tween 20 (PBS-T, Sigma-Aldrich) four times using a plate washer (Molecular Devices). Plates were then blocked with 250 ?l of 1% bovine serum albumin (BSA, Sigma-Aldrich) in PBS and incubated for one hour at room temperature. The plates were then washed four times with PBS-T. Sera from immunized mice and pre-immune sera were serially diluted ten-fold in 0.1% BSA PBS-T starting at 1:100 and added to the blocked plates in duplicate and incubated for one hour at room temperature. The last two wells were left blank to be used as secondary antibody control. The plates were again washed four times with PBS-T in a plate washer. A 1:5000 dilution of goat anti-mouse IgG-Fc-Horse Radish Peroxidase (HRP, Jackson Immunoresearch) conjugated secondary antibody was added to the plates and incubated for one hour at room temperature. Plates were again washed eight times with PBS-T and developed using TMB/H.sub.2O.sub.2 as substrate. The substrate was incubated for twenty minutes and the reaction stopped with 1 N H.sub.2SO.sub.4 (VWR). Plates were read on a spectrophotometer (Victor, Perkin Elmer) at 450 nm. Antibody titers were calculated using GRAPHPAD PRISM? (GraphPad Software, Inc).

    [0290] Serum titer was calculated as serum dilution within experimental titration range at the signal of antigen binding equivalent to two times above background. Antibody titer for the humoral immune response against a human cell surface receptor (Antigen A) is set forth in FIG. 19.

    [0291] In a similar experiment, humoral immune responses were determined for mice homozygous for human heavy and ? light chain variable gene loci (H.sub.?) and mice homozygous for a single human V.sub.H gene segment, all human D.sub.H and J.sub.H gene segments operably linked to mouse heavy chain constant regions (1hV.sub.H HO) by comparative immunization using influenza viral vaccines FLUVIRIN? (Novartis Vaccines) and FLUMIST? (MedImmune LLC).

    [0292] Briefly, serum was collected from groups of mice prior to immunization with the above antigen (as described above). Mice (n=5) homozygous for a single human V.sub.H gene segment (V.sub.H1-69), all human D.sub.H and J.sub.H gene segments operably linked to mouse heavy chain constant regions (1hV.sub.H HO) were immunized intra-nasally (i.n.) with FLUMIST? (live attenuated influenza vaccine) at 1/3 the normal dose/mouse. One normal dose of FLUMIST? contains 10.sup.65-75 FFU (fluorescent focus units) of live attenuated influenza vaccine. Therefore, each mouse was primed with 70 ?l FLUMIST? on day 1 followed by i.n. boost on days 3, 6, 11, 13, 17, 20 for a total of 6 boosts. No adjuvants were employed in this immunization. The mice were bled on days 15 and 22 after 4th and 6th boosts respectively and antiserum assayed for antibody titers to FLUMIST? (as described above).

    [0293] In a similar manner, in immunizations with FLUVIRIN?, pre-immune serum was collected from mice prior to initiation of immunization. Mice (n=5) homozygous for a single human V.sub.H gene segment (V.sub.H1-69), all human D.sub.H and J.sub.H gene segments operably linked to mouse heavy chain constant regions (1hV.sub.H HO) were immunized with FLUVIRIN? (trivalent inactivated influenza vaccine) via footpad (fp.) with 0.75 ?g each of hemagglutinin/mouse/boost. Mice were primed on day 1 followed by f.p. boost on days 3, 6, 11, 13, 17, 20 for a total of 6 boosts. No adjuvants were employed in this immunization. The mice were bled on days 15 and 22 after 4th and 6th boosts respectively and antiserum assayed for antibody titers to FLUVIRIN? (as described above).

    [0294] Serum titer was calculated as serum dilution within experimental titration range at the signal of antigen binding equivalent to two times above background. Antibody titer for the humoral immune response against FLUMIST? and FLUVIRIN? is set forth in FIG. 20.

    [0295] As shown in this Example, antibody titers generated in 1hV.sub.H HO mice were comparable to those generated in mice having a plurality of human V.sub.H gene segments (H.sub.?) for both a human cell surface receptor and a viral antigen (e.g., influenza). Thus, mice having immunoglobulin heavy chain loci restricted to a single V.sub.H gene segment are capable of mounting a robust immune response to antigen in a manner comparable to mice having immunoglobulin heavy chain loci containing a plurality of human V.sub.H gene segments (e.g., 80 V.sub.H).

    Example 4 Analysis of Antibody Gene Usage and CDR3 Length in Mice Having a Restricted Immunoglobulin Heavy Chain Locus

    [0296] Splenocytes harvested from mice homozygous for a single human V.sub.H gene segment at the endogenous heavy chain locus and homozygous for a replacement of the endogenous ? light chain variable loci with human ? light chain variable loci immunized with a human cell surface receptor (Antigen A) were analyzed for heavy and light chain gene segment usage by reverse-transcriptase polymerase chain reaction (RT-PCR) on mRNA from splenic B cells.

    [0297] Briefly, spleens were harvested and homogenized in 1?PBS (Gibco) using glass slides. Cells were pelleted in a centrifuge (500?g for 5 minutes), and red blood cells were lysed in ACK Lysis buffer (Gibco) for 3 minutes. Cells were washed with 1?PBS and filtered using a 0.7 ?m cell strainer. B-cells were isolated from spleen cells using MACS magnetic positive selection for CD19 (Miltenyi Biotec). Total RNA was isolated from pelleted B-cells using the RNeasy Plus Kit (Qiagen). PolyA.sup.+ mRNA was isolated from total RNA using the Oligotex? Direct mRNA mini kit (Qiagen).

    [0298] Double-stranded cDNA was prepared from splenic B cell mRNA by 5 RACE using the SMARTer? Pico cDNA Synthesis Kit (Clontech) with substitution of the supplied reverse transcriptase and dNTPs with Superscript? II and dNTPs (Invitrogen). V.sub.H and V? antibody repertoires were amplified from the cDNA using primers specific for IgM, IgG, or Ig? constant regions and the SMARTer? 5 RACE primer (Table 6). PCR products were purified using a QIAquick? PCR Purification Kit (Qiagen). A second round of PCR was done using the same 5 RACE primer and a nested 3 primer specific for the IgM, IgG, or Ig? constant regions (Table 7). Second round PCR products were purified using a SizeSelect? E-Gel? system (Invitrogen). A third PCR was performed with primers that added 454 adapters and barcodes. Third round PCR products were purified using Agencourt? AMPure? XP Beads (Beckman Coulter). Purified PCR products were quantified by SYBR? qPCR using a KAPA Library Quantification Kit (KAPA Biosystems). Pooled libraries were subjected to emulsion PCR (emPCR) using a 454 GS Junior Titanium Series Lib-A emPCR Kit (Roche Diagnostics) and bidirectional sequencing using Roche 454 GS Junior instrument according to manufacturer's specifications.

    [0299] Bioinformatic Analysis.

    [0300] The 454 sequences were sorted based on the sample barcode perfect match and trimmed for quality. Sequences were annotated based on alignment of rearranged immunoglobulin sequences to human germline V(D)J segment database using local installation of lgblast (NCBI, v2.2.25+). A sequence was marked as ambiguous and removed from analysis when multiple best hits with identical score were detected. A set of perl scripts was developed to analyze results and store data in mysql database. CDR3 region was defined between conserved C codon and FGXG motif for light and WGXG motif for heavy chains. CDR3 length was determined using only productive antibodies. From the nucleic acid sequences and predicted amino acid sequences of the antibodies, gene usage was identified for IgM-primed (15,650), IgG-primed (18,967), and Ig?-primed (26,804) sequences. Results are shown in Table 8, Table 9, FIG. 21 and FIG. 22.

    [0301] Table 8 sets forth the percentage of observed human D.sub.H and J.sub.H gene segments used among IgM-primed (15,650 sequences) and IgG-primed (18,967 sequences) V.sub.H1-69 derived heavy chain variable region sequences. Human D.sub.H4-4/D.sub.H4-11 and human D.sub.H5-5/D.sub.H5-18 gene segments are presented in Table 8 together due to identical sequence identity between the respective pairs of D.sub.H gene segments. Table 9 sets forth the percentage of human V? and J? gene segments observed among light chains (26,804 sequences) cognate with V.sub.H1-69 derived heavy chain variable regions. Percentages in Tables 8 and 9 represent rounded values and in some cases may not equal 100% when added together.

    [0302] Amino acid length of the CDR3 region of IgM-primed V.sub.H1-69-derived heavy chains is shown in FIG. 21. Amino acid length of the CDR3 region of IgG-primed V.sub.H1-69-derived heavy chains is shown in FIG. 22.

    [0303] As shown in Tables 8 and 9, mice according to the invention generate antigen-specific antibodies containing V.sub.H1-69-derived heavy chains, which demonstrate a variety of rearrangements of a human V.sub.H1-69 gene segment with a variety of human D.sub.H segments and human J.sub.H segments. Further, the antigen-specific antibodies contain cognate human light chains containing human V? domains resulting from a variety of rearrangements of human V? and J? gene segments.

    TABLE-US-00006 TABLE6 Primer Sequence(5-3) 3 Cg1outer GGAAGGTGTGCACACCGCTGGAC(SEQIDNO:71) 3 Cg2acouter GGAAGGTGTGCACACCACTGGAC(SEQIDNO:72) 3 Cg2bouter GGAAGGTGTGCACACTGCTGGAC(SEQIDNO:73) 3 Cg3outer AGACTGTGCGCACACCGCTGGAC(SEQIDNO:74) 3 mIgMCH1outer TCTTATCAGACAGGGGGCTCTC(SEQIDNO:75) 3 mIg?Couter AAGAAGCACACGACTGAGGCAC(SEQIDNO:76)

    TABLE-US-00007 TABLE7 Primer Sequence(5-3) 3 mIgG1/2bCH1inner AGTGGATAGACWGATGGGGGTG(SEQIDNO:77) 3 mIgG2a/2cCH1inner AGTGGATAGACCGATGGGGCTG(SEQIDNO:78) 3 mIgG3CH1inner AAGGGATAGACAGATGGGGCTG(SEQIDNO:79) 3 mIgMCH1inner GGAAGACATTTGGGAAGGACTG(SEQIDNO:80) 3 mIg?C-2inner GGAAGATGGATACAGTTGGTGC(SEQIDNO:81)

    TABLE-US-00008 TABLE 8 Human D.sub.H IgM IgG Human J.sub.H IgM IgG 1-1 1.2 6.0 1 7.5 1.5 1-7 39.9 9.0 2 3.3 4.2 1-14 0.5 2.3 3 22.2 12.8 1-20 2.3 1.4 4 51.5 36.4 1-26 3.5 5.7 5 10.5 9.5 2-2 1.1 3.2 6 4.9 29.4 2-8 0.7 0.6 2-15 0.3 1.2 2-21 0.7 0.3 3-3 6.3 5.2 3-9 0.6 0.6 3-10 0.9 10.3 3-16 0.9 2.0 3-22 5.1 2.7 4-4/4-11 1.5 4.0 4-17 1.5 4.7 4-23 11.5 2.4 5-12 1.1 1.8 5-5/5-18 1.3 3.2 5-24 0.3 3.3 6-6 1.8 4.5 6-13 6.1 7.4 6-19 3.0 5.1 6-25 0.1 0.6 7-27 3.3 7.3

    TABLE-US-00009 TABLE 9 Human V.sub.? % Observed Human J.sub.? % Observed 1-5 3.4 1 28.1 1-6 1.3 2 25.3 1-8 0 3 12.1 1-9 1.3 4 22.5 1-12 1.0 5 11.1 1-13 0 1-16 2.5 1-17 3.6 1-22 0 1-27 0.5 1-32 0 1-33 14.3 1-35 0 1-37 0 1-39 1.6 2-4 0 2-10 0 2-14 0 2-18 0 2-19 0 2-23 0 2-24 0.7 2-26 0 2-28 0 2-29 0 2-30 1.9 2-36 0 2-38 0 2-40 1.5 3-7 0 3-11 2.7 3-15 3.9 3-20 41.2 3-25 0 3-31 0 3-34 0 4-1 13.2 5-2 0.1 6-21 0 7-3 0