Method of promoting bone regrowth

11541084 · 2023-01-03

Assignee

Inventors

Cpc classification

International classification

Abstract

A composition having Lactobacillus Plantarum strain GMNL-662 for promoting bone regrowth is provided. The Lactobacillus Plantarum strain GMNL-662 has an ability to promote the expression of osteogenic genes, inhibit the expression of osteoclast related genes, and promote the expression of osteogenesis-related cytokine TGF-β, so that the bone loss is improved.

Claims

1. A method of promoting bone regrowth, comprising: administrating to a subject in need thereof, an effective amount of a composition comprising Lactobacillus plantarum GMNL-662 and a pharmaceutically acceptable carrier, wherein the Lactobacillus plantarum GMNL-662 is deposited in the China Center for Type Culture Collection (CCTCC) with an accession number of CCTCC M2016571 on Oct. 17, 2016; wherein the Lactobacillus plantarum GMNL-662 has an ability to improve expression of osteocalcin gene, an ability to promote expression of cytokine TGF-b, and an ability to inhibit expression of osteoclast gene TRAP-5.

2. The method according to claim 1, wherein the Lactobacillus plantarum GMHL-662 is a viable strain.

3. The method according to claim 1, wherein the Lactobacillus plantarum GMHL-662 is a dead strain.

4. The method according to claim 1, wherein the composition is a nutritional supplement, food, or a combination thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a diagram showing the expression of cytokine TGF-β of each group in the experiment 2 according to one embodiment of the present invention.

(2) FIG. 2 is a diagram showing the expression of osteogenesis-related gene osteocalcin of each group in the experiment 2 according to one embodiment of the present invention.

(3) FIG. 3 is a diagram showing the expression of osteoclast related gene TRAP-5 of each group in the experiment 2 according to one embodiment of the present invention.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(4) The structure and the technical means adopted by the present invention to achieve the above and other objects can be best understood by referring to the following detailed description of the preferred embodiments. Furthermore, if there is no specific description in the invention, singular terms such as “a”, “one”, and “the” include the plural number. For example, “a compound” or “at least one compound” may include a plurality of compounds, and the mixtures thereof. If there is no specific description in the invention, “%” means “weight percentage (wt %)”, and the numerical range (e.g. 10%-11% of A) contains the upper and lower limit (i.e. 10%≤A≤11%). If the lower limit is not defined in the range (e.g. less than, or below 0.2% of B), it means that the lower limit may be 0 (i.e. 0%≤B≤0.2%). The proportion of “weight percent” of each component can be replaced by the proportion of “weight portion” thereof. The abovementioned terms are used to describe and understand the present invention, but the present invention is not limited thereto.

(5) One embodiment of the present invention provides a Lactobacillus Plantarum strain for promoting bone regrowth. The Lactobacillus Plantarum strain is referred to as Lactobacillus Plantarum strain GMNL-662, which is deposited in the China Center for Type Culture Collection (CCTCC) with an accession number of CCTCC M2016571.

(6) One embodiment of the present invention provides a composition for promoting bone regrowth, comprising the abovementioned Lactobacillus Plantarum strain GMNL-662. Preferably, the composition can be a pharmaceutical composition, a nutritional supplement, a health food, a medical food, or the combination thereof. The composition can be formed in various form based on the effectivity or convenience. In addition, the composition is preferably administrated by means of food to enter the digestive system, and can stimulate the expression of osteogenic genes, inhibiting the expression of osteoclast related genes, and promoting the expression of osteogenesis-related cytokine TGF-β to slow down bone loss.

(7) The Lactobacillus Plantarum strain GMNL-662 in the abovementioned embodiments is one of a plurality of isolates mainly isolated from human intestines. The primers (SEQ ID NO: 1 and SEQ ID NO: 2) listed in Table 1 are used to perform PCR to reproduce 16S rDNA segments of each isolate, and then sequencing the 16S rDNA segment of each isolate. After sequencing, a 16S rDNA gene sequence of one of the isolates can be obtained as below (SEQ ID NO: 3); subsequently, from the comparison results on the NCBI website, it shows that the 16S rDNA sequences of the isolates are similar to that of the Lactobacillus Plantarum strains with identities all over 99%, so that the strain GMNL-662 indeed belongs to the Lactobacillus Plantarum genus.

(8) TABLE-US-00001 TABLE 1 PCR primer Primer SEQ ID NO: SEQ PAF 1 AGA GTT TGA TCC TGG CTC AG 536R 2 GTA TTA CCG CGG CTG CTG

(9) TABLE-US-00002 TABLE 2 NCBI NO Description Identity KT236093.1 Lactobacillus plantarum KLB 410 99% KT962240.1 Lactobacillus plantarum USIM03 99% KT025848.1 Lactobacillus plantarum KF 99% KR816164.1 Lactobacillus plantarum KF9 99%

(10) A complete 16S rDNA sequence (SEQ ID NO: 3) of the Lactobacillus Plantarum strain GMNL-662 is listed as below:

(11) TABLE-US-00003 GCCGTTGGCGTCGGATACATGCATGTCGTACGAACTCTGG TATTGATTGGTGCTTGCATCATGATTTACATTTGAGTGAGTGGCGAAC TGGTGAGTAACACGTGGGAAACCTGCCCAGAAGCGGGGGATAACACCT GGAAACAGATGCTAATACCGCATAACAACTTGGACCGCATGGTCCGAG CTTGAAAGATGGCTTCGGCTATCACTTTTGGATGGTCCCGCGGCGTAT TAGCTAGATGGTGGGGTAACGGCTCACCATGGCAATGATACGTAGCCG ACCTGAGAGGGTAATCGGCCACATTGGGACTGAGACACGGCCCAAACT CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGACGAAAGTCTGA TGGAGCAACGCCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAACTCT GTTGTTAAAGAAGAACATATCTGAGAGTAACTGTTCAGGTATTGACGG TATTTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGGTA AACAC

(12) A fermentation test to the Lactobacillus Plantarum strain GMNL-662 is carried out to obtain the results shown in Table 3.

(13) TABLE-US-00004 TABLE 3 Fermentation Test Strips No. carbohydrates substrate GMNL-662 0 CONTROL − 1 Glycerol − 2 Erythritol − 3 D-Arabinose − 4 L-Arabinose − 5 D-Ribose + 6 D-Xylose − 7 L-Xylose − 8 D-Adonitol − 9 Methyl-β-D-Xylopyranoside − 10 D-Galactose + 11 D-Glucose + 12 D-Fructose + 13 D-Mannose + 14 L-Sorbose − 15 L-Rhamnose − 16 Dulcitol − 17 Inositol − 18 D-Mannitol + 19 D-Sorbitol + 20 Methyl-α-D-mannopyranoside + 21 Methyl-α-D-glucopyranoside − 22 N-Acetyl glucosamine + 23 Amygdalin + 24 Arbutin + 25 Esculin ferric citrate − 26 Salicin + 27 D-Cellobiose + 28 D-Maltose + 29 D-Lactose (bovine origin) + 30 D-Melibiose + 31 D-Saccharose (sucrose) + 32 D-Trehalose + 33 Inulin − 34 D-Melezitose + 35 D-Raffinose − 36 Amidon (starch) − 37 Glycogen − 38 Xylitol − 39 Gentiobiose + 40 D-Turanose + 41 D-Lyxose − 42 D-Tagatose − 43 D-Fucose − 44 L-Fucose − 45 D-Arabitol − 46 L-Arabitol − 47 Potassium gluconate + 48 Potassium 2-ketogluconate − 49 Potassium 5-ketogluconate − −: negative; +: positive

(14) To verify the bone regrowth properties of the Lactobacillus Plantarum GMNL-662 according to the present invention, and to confirm that the bone loss can be improved, experiments 1 to 3 are executed.

(15) Experiment 1: Bone tissue analysis

(16) Strain: Lactobacillus plantarum strain GMNL-662

(17) Strain treatment:

(18) (1) preparation of viable bacteria: Inoculating the Lactobacillus plantarum GMNL-662 from a frozen tube to 1 ml of MRS broth, and standing under 37° C. for aerobically incubating for 20 hours. The next day, adding 15 μl culture solution into 1.5 ml of MRS broth (1% secondary activation), and then standing under 37° C. for aerobically incubating for 20 hours. Estimating the bacteria number by using OD 600 to adjust the bacteria concentration to 8×107 CFU/ml.

(19) (2) preparation of dead bacteria: Inoculating the Lactobacillus Plantarum strain GMNL-662 from a frozen tube to 1 ml of MRS broth, and standing under 37° C. for aerobically incubating for 20 hours. The next day, adding 15 μl culture solution into 1.5 ml of MRS broth (1% secondary activation), and then standing under 37° C. for aerobically incubating for 20 hours. Estimating the bacteria number by using OD 600 to adjust the bacteria concentration to 4.1×10.sup.8 CFU/ml.

(20) Osteoporosis mouse model:

(21) 8-week-old ICR female rats were purchased from BioLASCO Taiwan and ovariectomy was performed when they were 9 week-old. Mice were underwent anesthesia and were ovariectomized through back on both sides of the ovaries. All groups were given the test substance by means of tube feed at 4 days after surgery. The groups were divided into a sham operation group (control group, their abdominal cavity were cut but their ovaries were not removed); and 4 groups ovariectomized group (Ovariectomy; OVX). When the mice were sacrificed, the ovarian tissues were checked and confirmed whether the removal of ovarian was successful. The experimental results of the mice under failure operation were not used. In the 4 groups of the ovariectomized mice, one group was the vehicle group (H.sub.2O group), and one group was the positive drug group (anti-osteoporosis drug Alendronate). Alendronate was formulated with deionized water at a concentration of 0.25 mg/ml. The mice were given 0.1 ml per 10 grams of body weight and 4 times a week. The remaining two groups were fed with 0.2 ml of alive GMNL-662 (strain concentration is 8×10.sup.7 cfu/ml; daily dose of the mouse is 1.6×10.sup.7 cfu/mouse, the human dose is 4×10.sup.9 cfu/60 kg adult), and 0.2 ml of dead GMNL-662 (strain concentration is 4.1×10.sup.8 cfu/ml; daily dose of the mouse is 8.2×10.sup.7 cells/mouse, the human dose is 2×10.sup.10 cells/60 kg adult). The two groups were fed with tube one time every day, continued for 28 days, the mice were anesthetized and sacrificed for intraperitoneal cephalic vein sampling, and each femur was removed for analysis.

(22) Analysis method:

(23) The backbone of the right femur far from the end was taken a computer tomography by a micro computed tomography (SkyScan 1076, Kontizh, Belgium, with resolution of 18 μm), and the trabecular bone volume ratio (i.e. bone volume/tissue volume) is analyzed by a software. The analyzed position was selected to include the area of 100 pieces under the growth plate excluding cortical bone. The bone mineral density analysis was applied to the same area. The obtained data in the experiments were analyzed with two-way analysis of variance, and executed T-test statistical analysis. All data were presented as mean ±SD. After comparisons, the abovementioned groups were analyzed statistically and noted by different marks to represent the statistically significant differences (* represents p<0.05; ** represents p<0.01). See Table 4 and Table 5, showing results of the experiment 1.

(24) TABLE-US-00005 TABLE 4 Trabecular bone volume ratio (BV/TV, bone volume/tissue volume) BV/TV(%) OVX+ OVX+ OVX + GMNL-662 GMNL-662 OVX+ Control H.sub.2O alive dead Alendronate 42.12 ± 2.4** 30.9 ± 1.1 36.92 ± 1.7** 36.8 ± 1.2** 34.88 ± 0.9**

(25) From table 4, after removing the ovarian, the trabecular bone volume ratio in (OVX+H.sub.2O) group (disease group) was lower than the control group, which means that the osteoporosis animal model was successful. Comparing the alive GMNL-662 group with the dead GMNL-662 group, it can be found that BV/TV thereof were higher than the disease group, which means that the GMNL-662 indeed slows down bone loss in a certain degree after removing the ovarian. Alendronate was positive control group which also had protective effect against bone loss. The two groups of the tube fed GMNL-662 strains even have slightly better protective effects than the anti-osteoporosis drug Alendronate.

(26) TABLE-US-00006 TABLE 5 Femur bone mineral density (BMD, excluding cortical bone) BMD (g/cm.sup.3) OVX+ OVX+ OVX + GMNL-662 GMNL-662 OVX+ Control H.sub.2O Alive Dead Alendronate 0.502 ± 0.04** 0.344 ± 0.04 0.488 ± 0.02** 0.474 ± 0.01** 0.426 ± 0.02*

(27) From table 5, it can be noted that the disease group (OVX+H.sub.2O) has lower BMD than the control group; in the groups of alive and dead GMNL-662 strains, the BMD is significantly higher than the BMD in the disease group (OVX+H.sub.2O). That is, both of the two groups of the tube fed GMNL-662 strains can slow down bone loss of the mice after removing the ovarian.

(28) Experiment 2: effects of GMNL-662 on osteogenic genes, cytokines, and osteoclast genes

(29) Extraction of tibial RNA: The left femur of the mice were removed, cut into small pieces with scissor, and an appropriate amount of liquid nitrogen was added to grind the bones quickly. The ground bone powder was added to 0.5 ml TRIzol® Reagent to extract RNA; 0.1 ml chloroform was then added thereto to turn up and down 15 times. The solution was placed at room temperature to react for 5 minutes, followed by centrifugalized and extracted the upper layer to new microcentrifuge tubes (eppendorf); 0.25 ml isopropanol was added thereto and the solution was placed at room temperature for 10 minutes and then centrifugalized; the supernatant was removed and the precipitate was washed with 0.5 ml 75% ethanol; after the precipitate was dried, 20-50 μl DEPC water was added to dissolve the precipitate and the RNA concentration was measured.

(30) RNA reverse transcription cDNA: 1-5 μg RNA was obtained and RNase-free water was added therein to 10 μl; additionally, 10×Random primer (2 μl), 10 mM dNTP (1 μl) were added, at 65° C. for 5 minutes, and on ice for 2-3 minutes; after first stage interaction, additional 5×RT buffer (4 μl), 0.1M DTT (1 μl), RNase inhibitor (Invitrogen, RNaseOUTTM, 1 μl), RT enzyme (Invitrogen, SuperScript®III, 1 μl) were added and mixed at room temperature for 5 minutes, and then placed at 50° C. for 60 minutes, at 70° C. for 15 minutes, to proceed the enzyme reverse transcription.

(31) Tibial cDNA in real-time PCR analysis: 1 μl tibial cDNA was obtained and added 4 μl of 1 μM F+R primers (forward/reverse primers are listed below), and 5 μl of 2×Rotor-Gene SYBR Green PCR Master Mix (Qiagen, Cat. 204076), placed into Q-PCR apparatus to react. The relative expression of TGF-β and RANKL were obtained by deducting the GAPDH itself.

(32) TABLE-US-00007 TABLE 6 Primers TGF-β Forward  SEQ ID NO: 4 GAGTAACGCTTTCCGGAGTC primer TGF-β Reverse  SEQ ID NO: 5 ACAGTCACCAGCATCTCAGC primer Osteocalcin  SEQ ID NO: 6 ACGGTATCACTATTTAGGAC Forward primer CTGTG Osteocalcin  SEQ ID NO: 7 ACTTTATTTTGGAGCTGCTG Reverse primer TGAC TRAP-5 Forward  SEQ ID NO: 8 GACGATGGGCGCTGACTTCA primer TRAP-5 Reverse  SEQ ID NO: 9 GCGCTTGGAGATCTTAGAGT primer GAPDH Forward  SEQ ID NO: 10 GCACAGTCAAGGCCGAGAAT primer GAPDH Reverse  SEQ ID NO: 11 GCCTTCTCCATGGTGGTGAA primer

(33) Analysis method: The obtained data in the experiments were analyzed with two-way analysis of variance, and executed T-test statistical analysis. The abovementioned groups were analyzed statistically compared with the OVX+H.sub.2O group, wherein * represents p<0.05; ** represents p<0.01.

(34) As shown in FIG. 1, GMNL-662 alive strain and dead strain both can increase the expression of cytokine TGF-β which can protect bone against bone loss. Comparing the mice of the control group with the disease group (OVX+H.sub.2O), the expression of bone regrowth related cytokine TGF-β of the disease group is significantly reduced; the mice fed with GMNL-662 (GMNL-662 alive strain and dead strain) have significant increased expression of TGF-β compared with the disease group (OVX+H.sub.2O). This result means that the GMNL-662 strain has ability of promoting the expression of TGF-β so as to slow down bone loss.

(35) Next, as shown in FIG. 2, in the groups of the mice given GMNL-662 (alive or dead strain) after removing ovarian, the expression of osteocalcin gene are higher than the disease group (OVX+H.sub.2O), which means that the GMNL-662 strains, no matter the strain is dead or alive, have ability to promote the expression of osteogenic genes, especially osteocalcin gene, thereby slowing down bone loss.

(36) Refer to FIG. 3, it can be observed apparently, compared with the mice in the sham operation group (Control), the expression of osteoclast related genes TRAP-5 in the disease group (OVX+H.sub.2O) is increased; while in the groups of GMNL-662 alive strain and dead strain, the expression of osteoclast related genes TRAP-5 is significantly lower than that in the disease group (OVX+H.sub.2O). That is, GMNL-662 strains have ability to inhibit the expression of osteoclast genes so as to slow down bone loss.

(37) In summary, according to the above results, it is certain that the Lactobacillus Plantarum strain GMNL-662 according to the present invention, no matter the strains are viable or dead, can significantly slow down bone loss of the mice after removing ovarian in the bone tissue analysis (Trabecular bone volume ratio, BV/TV) of animal experiments and bone mineral density (BMD). It is also noted that the GMNL-662 strain has abilities of promoting the expression of osteogenic genes (Osteocalcin gene), inhibiting the expression of osteoclast related genes (TRAP-5), and promoting the expression of osteogenesis-related cytokine TGF-β, so that the bone loss can be improved. In addition, it can be found in the experiment results that the GMNL-662 has protective effect better than the anti-osteoporosis drug “Alendronate”. Alendronate has been found to have many side effects, including heart disease, stubborn pain, jaw osteonecrosis, fractures, and esophageal cancer. Therefore, Lactobacillus Plantarum strain GMNL-662, safe and with no side effects, is applicable to slow down bone loss. It should be a better choice for the menopausal women in considering the future prevention and improvement of bone loss. A deposit designation of a culture of the Lactobacillus plantarum GMNL-662 in the present invention was deposited in the China Center for Type Culture Collection (CCTCC) located at Wuhan University, Wuhan 430072 P.R. China with Accession No. CCTCC M 2016571 on Oct. 17, 2016 under the Budapest Treaty.

(38) The present invention has been described with preferred embodiments thereof and it is understood that many changes and modifications to the described embodiments can be carried out without departing from the scope and the spirit of the invention that is intended to be limited only by the appended claims.