Genetically engineered bacteria used for producing uridine with high-yield and its construction method and use

Abstract

The present disclosure relates to a genetically engineered strain with high production of uridine and its construction method and application. The strain was constructed as follows: heterologously expressing pyrimidine nucleoside operon sequence pyrBCAKDFE (SEQ ID NO:1) on the genome of E coli prompted by strong promoter P.sub.trc to reconstruct the pathway of uridine synthesis; overexpressing the autologous prsA gene coding PRPP synthase by integration of another copy of prsA gene promoted by strong promoter P.sub.trc on the genome; deficiency of uridine kinase, uridine phosphorylase, ribonucleoside hydrolase, homoserine dehydrogenase I and ornithine carbamoyltransferase. When the bacteria was used for producing uridine, 40-67 g/L uridine could be obtained in a 5 L fermentator after fermentation for 40-70 h using the technical scheme provided by the discloure with the maximum productivity of 0.15-0.25 g uridine/g glucose and 1.5 g/L/h respectively which is the highest level of fermentative producing uridine reported at present.

Claims

1. A genetically engineered bacteria used for producing uridine, wherein, the genetically engineered bacteria was constructed as follows: heterologously expressing pyrimidine nucleoside operon sequence pyrBCAKDFE as shown in SEQ ID NO:1 on the genome of E coli prompted by strong promoter P.sub.trc to reconstruct the pathway of uridine synthesis; overexpressing the autologous prsA gene coding PRPP synthase by integration of another copy of prsA gene promoted by strong promoter P.sub.trc on the genome; deficiency of uridine kinase, uridine phosphorylase, ribonucleoside hydrolase, homoserine dehydrogenase I and ornithine carbamoyltransferase.

2. The genetically engineered bacteria used for producing uridine according to claim 1, wherein, the pyr operon sequence pyrBCAKDFE as shown in SEQ ID NO:1 was integrated into the yghX locus on the genome of E coli; the udk, udp, rihA, rihB and rihC genes were knocked out; the gene fragment P.sub.trc-prsA was constructed through ligating promoter P.sub.trc and prsA gene and was integrated into the trpR locus; the thrA gene was knocked out and the argF gene was knocked out.

3. The genetically engineered bacteria used for producing uridine according to claim 1, wherein, the host cell of the genetically engineered bacteria is E. coli W3110.

4. The genetically engineered bacteria used for producing uridine according to claim 1, wherein, the pyr operon sequence was derived from B. subtilis CGMCC No. 11775.

5. A construction method of a genetically engineered bacteria used for producing uridine, wherein, directional transformation of E. coli W3110 was implemented by directed chromosomal modifications using the method of CRISPR/Cas9 meditated genome editing, comprising the following steps: (1) reconstructing a uridine synthesis pathway in Escherichia coli: the pyr operon genes derived from Bacillus subtilis CGMCC No. 11775 were successively introduced into the yghX locus on genome of Escherichia coli W3110; (2) knocking out the udk, udp, rihA, rihB and rihC genes to block uridine degradation pathways; (3) constructing a gene fragment P.sub.trc-prsA through ligating promoter P.sub.trc and prsA gene and integrating the fragment into the trpR locus, to enhance the supply of precursor PRPP; (4) knocking out the thrA gene to weaken the metabolism bypass of the precursor aspartic acid; (5) knocking out the argF gene to weaken the metabolism bypass of carbamate phosphoric acid.

6. A use of the genetically engineered bacteria according to claim 1 for producing uridine.

7. The use according to claim 6, wherein, comprising the following steps: preparing a seed liquid after activating the genetically engineered bacteria of claim 1; carrying out the shake-flask fermentation: the seed liquid is inoculated into a fermentation medium according to a inoculum size of 10-15% (a total volume is 30 mL), sealed with nine layers of gauze and cultured for 24-30 hours at 37 C. and 200 rpm; the pH is maintained to be 7.0-7.2 by supplementing NH.sub.4OH, and a 60% (m/v) glucose solution is added for maintaining the fermentation when needed; or, carrying out the fermentor fermentation: the seed liquid is inoculated into a fermentation medium according to a inoculum size of 10-15%, The pH was kept constant at 7.0 by automated addition of NH.sub.4OH (25%, v/v). Dissolved oxygen was maintained at 25-35% by variation of the stirrer speed and the aeration rate. When glucose was exhausted, 80% glucose solution was added at an appropriate rate to maintain the glucose concentration below 5 g/L. The fermentation period is 40-70 hours.

8. The use according to claim 7, wherein, the shake-flask fermentation medium is composed of glucose 20-40 g/L, (NH.sub.4).sub.2SO.sub.4 1-3 g/L, KH.sub.2PO.sub.4 1-3 g/L, MgSO4.7H2O 1-2 g/L, yeast extract 0.1-0.3 g/L, corn steep liquor 1-2 mL/L, FeSO.sub.4.7H.sub.2O 80-100 mg/L, MnSO.sub.4.7H.sub.2O 80-100 mg/L, and the rest is water, pH7.0-7.2.

9. The use according to claim 7, wherein, the fermentor fermentation medium is composed of glucose 15-25 g/L, yeast extract 1-5 g/L, tryptone 1-5 g/L, sodium citrate 0.1-1 g/L, KH.sub.2PO.sub.4 1-5 g/L, MgSO.sub.4.7H.sub.2O 0.1-1 g/L, FeSO.sub.4.7H.sub.2O 80-100 mg/L, MnSO.sub.4.H.sub.2O 80-100 mg/L, VB.sub.1 0.5-2 mg/L, VB.sub.3 0.5-2 mg/L, VB.sub.5 0.5-2 mg/L, VB.sub.12 0.5-2 mg/L, VH 0.5-2 mg/L, threonine 50-200 mg/L, lysine 50-200 mg/L, methionine 50-200 mg/L, glutamine 50-200 mg/L, arginine 50-200 mg/L, 2 drops of defoaming agent and the rest is water, pH 7.0-7.2.

10. The genetically engineered bacteria used for producing uridine according to claim 2, wherein, the host cell of the genetically engineered bacteria is E. coli W3110.

11. The genetically engineered bacteria used for producing uridine according to claim 2, wherein, the pyr operon sequence was derived from B. subtilis CGMCC No. 11775.

12. A use of the genetically engineered bacteria according to claim 2 for producing uridine.

13. The use according to claim 12, wherein, comprising the following steps: preparing a seed liquid after activating the genetically engineered bacteria of claim 2; carrying out the shake-flask fermentation: the seed liquid is inoculated into a fermentation medium according to a inoculum size of 10-15% (a total volume is 30 mL), sealed with nine layers of gauze and cultured for 24-30 hours at 37 C. and 200 rpm; the pH is maintained to be 7.0-7.2 by supplementing NH.sub.4OH, and a 60% (m/v) glucose solution is added for maintaining the fermentation when needed; or, carrying out the fermentor fermentation: the seed liquid is inoculated into a fermentation medium according to a inoculum size of 10-15%, The pH was kept constant at 7.0 by automated addition of NH.sub.4OH (25%, v/v). Dissolved oxygen was maintained at 25-35% by variation of the stirrer speed and the aeration rate. When glucose was exhausted, 80% glucose solution was added at an appropriate rate to maintain the glucose concentration below 5 g/L. The fermentation period is 40-70 hours.

14. A use of the genetically engineered bacteria according to claim 3 for producing uridine.

15. The use according to claim 14, wherein, comprising the following steps: preparing a seed liquid after activating the genetically engineered bacteria of claim 3; carrying out the shake-flask fermentation: the seed liquid is inoculated into a fermentation medium according to a inoculum size of 10-15% (a total volume is 30 mL), sealed with nine layers of gauze and cultured for 24-30 hours at 37 C. and 200 rpm; the pH is maintained to be 7.0-7.2 by supplementing NH.sub.4OH, and a 60% (m/v) glucose solution is added for maintaining the fermentation when needed; or, carrying out the fermentor fermentation: the seed liquid is inoculated into a fermentation medium according to a inoculum size of 10-15%, The pH was kept constant at 7.0 by automated addition of NH.sub.4OH (25%, v/v). Dissolved oxygen was maintained at 25-35% by variation of the stirrer speed and the aeration rate. When glucose was exhausted, 80% glucose solution was added at an appropriate rate to maintain the glucose concentration below 5 g/L. The fermentation period is 40-70 hours.

Description

BRIEF DESCRIPTION OF FIGURES

[0034] FIG. 1: (a): plasmid profile of pREDCas9; (b): plasmid profile of pGRB.

[0035] FIG. 2: electrophoretogram for construction and PCR verification of pyrB gene integrated fragment. Wherein, M: 1 kb DNA marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: pyrB fragment, 4: overlapping fragment of upstream homologous arm, pyrB fragment and downstream homologous arm, 5: PCR fragment obtained by using original genomic DNA as template, 6: PCR fragment obtained after replacing yghX gene with pyrB integrated fragment.

[0036] FIG. 3: electrophoretogram for construction and PCR verification of pyrC-pyrAA integrated fragment. Wherein, M: arker, 1: fragment constituted of upstream fragment of pyrC and pyrC-pyrAA fragment, 2: downstream homologous arm, 3: overlapping fragment of upstream fragment of pyrC, pyrC-pyrAA fragment and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained after integration of pyrC-pyrAA fragment.

[0037] FIG. 4: Construction and PCR verification of pyrAB-pyrK-pyrD-pyrF-pyrE integrated fragment. Wherein, M: Marker, 1: fragment constituted of upstream fragment of pyrAB and pyrAB-pyrK-pyrD-pyrF-pyrE fragment, 2: downstream homologous arm, 3: overlapping fragment of upstream fragment of pyrAB, pyrAB-pyrK-pyrD-pyrF-pyrE fragment and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained with integration of pyrAB-pyrK-pyrD-pyrF-pyrE fragment.

[0038] FIG. 5: Deletion and verification of udk gene. Wherein, M: Marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained by using genomic DNA with deletion of udk gene as template.

[0039] FIG. 6: Deletion and verification of udp gene. Wherein, M: Marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5 PCR fragment obtained by using genomic DNA with deletion of udp gene as template.

[0040] FIG. 7: Deletion and verification of rihA gene. Wherein, M: Marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained by using genomic DNA with deletion of rihA gene as template.

[0041] FIG. 8: Deletion and verification of rihB gene. Wherein, M: Marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained by using genomic DNA with deletion of rihB gene as template.

[0042] FIG. 9: Deletion and verification of rihC gene. Wherein, M: 1 kb DNA marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained by using genomic DNA with deletion of rihC gene as template.

[0043] FIG. 10: Construction and PCR verification of P.sub.trc-prsA integrated fragment. Wherein, M: 1 kb DNA marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm, P.sub.trc-prsA fragment and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained by using genomic DNA with integration of P.sub.trc-prsA fragment as template.

[0044] FIG. 11: Deletion and verification of thrA gene. Wherein, M: 1 kb DNA marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5: PCR fragment obtained by using genomic DNA with deletion of thrA gene as template.

[0045] FIG. 12: Deletion and verification of argF gene. Wherein, M: 1 kb DNA marker, 1: upstream homologous arm, 2: downstream homologous arm, 3: overlapping fragment of upstream homologous arm and downstream homologous arm, 4: PCR fragment obtained by using original genomic DNA as template, 5 PCR fragment obtained by using genomic DNA with deletion of argF gene as template.

[0046] FIG. 13: The fermentation process curve of E. coli UR11.

DETAILED DESCRIPTION

[0047] The invention is further described and illustrated in the following specific examples. Unless otherwise specified, the technical means used in the invention are known to the person skilled in the field. In addition, the description is illustrative of the invention and is not to be construed as limiting the invention, and the substance and scope of the invention shall be limited only by the claims. For technical personnel in this field, without deviating from the substance and scope of the invention, any change or alteration of the material composition and dosage in these descriptions shall also fall within the scope of protection of the invention.

[0048] Unless otherwise specified, the percent sign % referred to in the description means the percentage of quality. The percentage of solution is the mass (g) of solute per 100 mL of solution and the percentage between different liquids refers to their volume ratio of the mixed solution at 25 C.

Example 1 Construction of Strain E. coli UR11

[0049] 1. The Method of Gene Editing

[0050] The gene editing method used in the invention refers to the literature, entitled metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing, published in the journal of metabolic engineering in 2015 by Li Y, Lin Z, Huang C, et al. Two plasmids, pREDCas9 and pGRB, were used in this method and the plasmid profiles were shown in FIG. 1. pREDCas9 consists of the temperature sensitive pSC101 replication origin, spectinomycin resistance gene, Cas9 expression cassette, IPTG inducible -Red recombination system and L-arabinose inducible gRNA.sub.PGRB cassette. pGRB includes the promoter J23100, ampicillin resistance gene, the gRNA scaffold for Cas9 binding and a terminator derived from S. pyogenes, and the bla sequence.

[0051] The specific steps of this method are as follows:

[0052] 1.1 Construction of Plasmid pGRB

[0053] Plasmid pGRB was constructed to transcribe corresponding gRNA that directs the Cas9 protein to cleave a target DNA sequence with a required protospacer adjacent motif (PAM). To construct the gRNA plasmid, a pair of single stranded DNA (ssDNA) sequences were synthesized and annealed to form the dsDNA that contains the gRNA spacer sequence specific for each target and the flanked sequences homologous to the pGRB backbone. The dsDNA and linearized pGRB were then ligated via homologous recombination.

[0054] 1.1.1 Design of Target Sequence

[0055] Target sequences (PAM:5-NGG-3) are designed using CRISPR RGEN Tools.

[0056] 1.1.2 Preparation of DNA Fragments Containing Target Sequences

[0057] A pair of single stranded DNA (ssDNA) sequences were synthesized and annealed to form the dsDNA that contains the gRNA spacer sequence specific for each target and the flanked sequences homologous to the pGRB backbone. Annealing conditions: pre-denaturation at 95 C. for 5 min and annealing at 30-50 C. for 1 min. The reaction system is as follows:

TABLE-US-00001 reaction system Volume (20 L) single stranded DNA (ssDNA) sequences-S (10 mol/L) 10 L single stranded DNA (ssDNA) sequences-A (10 mol/L) 10 L

[0058] 1.1.3 Preparation of Linearized pGRB

[0059] The plasmid was linearized by reverse PCR amplification.

[0060] 1.1.4 Recombination Between the Prepared dsDNA and Linearized pGRB

[0061] The dsDNA and linearized pGRB were then ligated via homologous recombination using ClonExpress II One Step Cloning Kit (Vazyme, China) at 37 C. for 30 min to form the gRNA expressing plasmid. The recombination system is as follows:

TABLE-US-00002 recombination system Volume (20 L) 5 CE II Buffer 4 L linearized pGRB 1 L DNA fragments containing target sequences 1 L Exnase II 2 L ddH.sub.2O 12 L

[0062] 1.1.5 Plasmid Transformation

[0063] 10 L recombinant reaction solution was transformed into 100 L DH5a competent cells by CaCl.sub.2 mediated means and treated by ice bath for 20 min after mixed gently, and then treated by water bath of 42 C. for 45-90 s. After ice bath treatment once again for 2-3 min, cells were immediately added with 0.9 L SOC and recovered at 37 C. for 1 h. The cells were re-suspend by 200 L supernate from the centrifugation at 8000 rpm for 2 min and then spreaded onto a plate coated with 100 mg/L penbritin. After overnight culture at 37 C., the single colonies were verified by colony PCR to select the positive recombinants.

[0064] 1.1.6 Cloning and Identification

[0065] The randomly selected positive transformants were then cultured in LB overnight, preserving the strain and extracting the plasmid for identification by restriction enzyme.

[0066] 1.2 Preparation of DNA Fragment for Recombinant

[0067] Recombinant fragment for gene deletion was composed of upstream homologous arm and downstream homologous arm of genes for deletion (upstream homologous armdownstream homologous arm); recombinant fragment for gene integration was composed of upstream and downstream homologous arm of integration locus and gene fragment for integration (upstream homologous armtarget genesdownstream homologous arm). Using the Primer design software (primer 5), the primers of upstream and downstream homologous arms (400-500 bp) were designed according to the upstream and downstream sequence of the gene to be knocked out or the site to be integrated and the primers of genes to be integrated as the template. The primers of the integrated genes were designed according to the genes to be integrated as the template. The upstream homologous arms, downstream homologous arms and target gene fragment were amplified by PCR and these recombinant fragments were prepared by overlapping PCR. The system and method of PCR are as follows:

PCR System:

[0068]

TABLE-US-00003 Component Volume (50 L) DNA template 1 L Upstream Primer (10 mol/L) 1 L Downstream Primer (10 mol/L) 1 L dNTP mixture(10 mmol/L) 4 L 5 Buffer 10 L HS enzyme (5 U/L) 0.5 L ddH.sub.2O 32.5 L

Overlapping PCR System:

[0069]

TABLE-US-00004 Component Volume (50 L) DNA template 2 L Upstream primer of upstream homologous arms 1 L (10 mol/L) Downtream primer of downstream homologous arms 1 L (10 mol/L) dNTP mixture(10 mmol/L) 4 L 5 Buffer 10 L HS enzyme (5 U/L) 0.5 L ddH.sub.2O 31.5 L Note: the template was composed of equimolar amplification segments of upstream arm and downstream arm and target gene, and the total amount was less than 10 ng.

[0070] Condition of PCR (Takara, PrimeSTAR HS enzyme): denaturation at 95 C. for 5 min; then 30 cycles of denaturation at 98 C. for 10 sec, annealing ((Tm-3/5) C.) for 15 sec and elongation at 72 C. (this enzyme extended about 1 kb for 1 min); and another elongation at 72 C. for 10 min; finally maintain at 4 C.

[0071] 1.3 Transformation of the Plasmid and Recombinant DNA

[0072] 1.3.1 Transformation of pREDCas9

[0073] The plasmid pREDCas9 was electrotransformed into E. coli W3110 competent cells by electroporation means. The cells were plated on LB agar supplemented with spectinomycin after resuscitation. After overnight culture at 32 C., the single colonies were verified by colony PCR using the designed primer to select the positive recombinants.

[0074] 1.3.2 Preparation of Electrocompetent Cells Containing pREDCas9

[0075] A single colony was cultivated overnight in LB medium at 32 C., and the cultures were transferred into 2YT medium (1.6% tryptone, 1% yeast extract, 0.5% NaCl) with a 10% inoculum. When the cells grew to an OD of 0.1-0.2 at 32 C., 0.1 mM IPTG was added to induce the expression of Red recombinases. The bacteria were harvested to prepare the electrocompetent cells till the OD.sub.600 reached 0.4-0.5.

[0076] 1.3.3 Transformation of pGRB and Donor Recombinant Fragment

[0077] Eppendorf Eporator (Germany) was used for electroporation (0.1 cm cuvette, 1.80 kV). 200 ng donor DNA and 100 ng gRNA plasmid were added in each electroporation reaction. Cells after electroporation were immediately added into 1 mL LB and recovered at 32 C. for 2 h prior to plating on LB agar supplemented with ampicillin and spectinomycin. After overnight culture at 32 C., the single colonies were verified by colony PCR.

[0078] 1.4 Curing of Plasmid

[0079] For gRNA plasmid curing, correct colonies were inoculated in LB containing 0.2% L-arabinose and cultivated overnight. The plasmid pREDCas9 could be cured by cultivation at 42 C. for 6-8 h when the strain was not subjected to further engineering.

[0080] 2. Primers Used in Strain Construction

[0081] All primers used in strain construction are as follows:

TABLE-US-00005 Primers Sequence(5-3) UP-yghX-S GCGCAACGTAGAACAGGAATT UP-yghX-A ATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGT CAAGATTGAAGCGCCTTTACTACTCC pyrB-S TATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAAGGAGATATAC CATGAAGCATTTAACGACGATGAG pyrB-A TTACTATGACCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGG TTATGCTAGCCACCTAATTTTTCCTCGGCACTCACCATTTTCGTTTAGTATC CAGC DN-yghX-S1 GGGTTTTTTGGTCATAGTAATCCAGCAACTCTTGTG DN-yghX-A GAGCAGGTATTTACGTGAACCG UP-pyrC-pyrAA-S GCATAGCAGAGTGGCAAGGTC UP-pyrC-pyrAA-A CCTACAAATTGAGTTATGTTCATGGCTTGTGTTCCCGCATAGT DN-yghX-S2 ATGAACATAACTCAATTTGTAGGCTAGCATAACCCCTTGG UP-pyrABKDFE-S CATTACAGCGGAAGAGGTGC UP-pyrABKDFE-A CCCCAAGGGGTTATGCTAGAGCAAGGCTTTGAAGCCTC DN-yghX-S3 GAGGCTTCAAAGCCTTGCTCTAGCATAACCCCTTGGGG UP-udp-S CGCGGATATGTTCATGCAC UP-udp-A CTGGGTGCGGTTAACGATAGACTTGGACATATACAACTCCTCTG DN-udp-S CAGAGGAGTTGTATATGTCCAAGTCTATCGTTAACCGCACCCAG DN-udp-A CATCCGCGTGGTTACTTCA UP-udk-S AACTGCGAAAGCTCAAGCG UP-udk-A GCACGATAATGTCCGCATATTGCCAGCGATACCGATAATGACG DN-udk-S CGTCATTATCGGTATCGCTGGCAATATGCGGACATTATCGTGC DN-udk-A CTGGGTGAAGATAGAACGCCTC UP-rihA-S AAACTGCTGGAGCGTGTCG UP-rihA-A CATTACGGTGGCATTCGGTTTGACCTGGGTCGCAATCTAAC DN-rihA-S GTTAGATTGCGACCCAGGTCAAACCGAATGCCACCGTAATG DN-rihA-A CATCTTTAATCGGACGTTGCAG UP-rihB-S CTTCAATAGCCTGCACCGC UP-rihB-A GTTTTGATGTAGCCGCGCACCCCGGATCACAATCCAGAATA DN-rihB-S TATTCTGGATTGTGATCCGGGGTGCGCGGCTACATCAAAAC DN-rihB-A TGCCGGTAACACCCTGAAAC UP-rihC-S TGACATCTGCTACGCCACGAC UP-rihC-A GTTACGACGCCAGAGCCAGCGAGTTCGGGTGCAAAAATC DN-rihC-S GATTTTTGCACCCGAACTCGCTGGCTCTGGCGTCGTAAC DN-rihC-A AAGCGAGATGGTTCAGCGTA UP-trpR-S ATGGCGATTGCTCGTCAG UP-trpR-A CGCCACAAAGCCATTGAGGTGCGGATCAGTAACGACG prsA-S CGTCGTTACTGATCCGCACCTCAATGGCTTTGTGGCG prsA-A CGGGTATTTGTAGGACGGATAAATGGCAGGTGAAGGAGGC DN-trpR-S GCCTCCTTCACCTGCCATTTATCCGTCCTACAAATACCCG DN-trpR-A CGCCGTTTACTTCCAGAGG UP-thrA-S ACGGGCAATATGTCTCTGTGTG UP-thrA-A GTAACGTCATTGCCCGCACGCTTTCCAGAATATCGGCAAC DN-thrA-S GTTGCCGATATTCTGGAAAGCGTGCGGGCAATGACGTTAC DN-thrA-A TTTAATCCCCGGATACGCC UP-argF-S GTGATATGGATGACGGATGGC UP-argF-A CCTAGAAGAAATCAACCAGCGCATCAGAAAGTCTCCTGTGCATGGACATT TTATCCTCGCATGG DN-argF-S TGCGCTGGTTGATTTCTTCTAGGGTCATAGTAATCCAGCAACTTGACGGAC GAGGTGTTTGAG DN-argF-A GAGGCGATACTTGCCGTTCT gRNA-yghX-S AGTCCTAGGTATAATACTAGTGGTGCCTGACGACCATAAAAGTTTTAGAGC TAGAA gRNA-yghX-A TTCTAGCTCTAAAACTTTTATGGTCGTCAGGCACCACTAGTATTATACCTA GGACT gRNA-pyr1-S AGTCCTAGGTATAATACTAGTATGAACATAACTCAATTTGTGTTTTAGAGCT AGAA gRNA-pyr1-A TTCTAGCTCTAAAACACAAATTGAGTTATGTTCATACTAGTATTATACCTAG GACT gRNA-pyr2-S AGTCCTAGGTATAATACTAGTAGTGCCGAGGAAAAATTAGGGTTTTAGAG CTAGAA gRNA-pyr2-A TTCTAGCTCTAAAACCCTAATTTTTCCTCGGCACTACTAGTATTATACCTAG GACT gRNA-thrA-S AGTCCTAGGTATAATACTAGTCGCCAAAATCACCAACCACCGTTTTAGAG CTAGAA gRNA-thrA-A TTCTAGCTCTAAAACGGTGGTTGGTGATTTTGGCGACTAGTATTATACCTA GGACT gRNA-udk-S AGTCCTAGGTATAATACTAGTCGTGAATTGCGTGAGCAAGTGTTTTAGAGC TAGAA gRNA-udk-A TTCTAGCTCTAAAACACTTGCTCACGCAATTCACGACTAGTATTATACCTA GGACT gRNA-udp-S AGTCCTAGGTATAATACTAGTCTCACTAAAAACGATTTACAGTTTTAGAGC TAGAA gRNA-udp-A TTCTAGCTCTAAAACTGTAAATCGTTTTTAGTGAGACTAGTATTATACCTAG GACT gRNA-rihA-S AGTCCTAGGTATAATACTAGTAAAGCAATTACGTCTTCCGCGTTTTAGAGC TAGAA gRNA-rihA-A TTCTAGCTCTAAAACGCGGAAGACGTAATTGCTTTACTAGTATTATACCTA GGACT gRNA-rihB-S AGTCCTAGGTATAATACTAGTAATGATGGCGGCGAAACATCGTTTTAGAGC TAGAA gRNA-rihB-A TTCTAGCTCTAAAACGATGTTTCGCCGCCATCATTACTAGTATTATACCTAG GACT gRNA-rihC-S AGTCCTAGGTATAATACTAGTCACCGTCGCGGGTAATGTCTGTTTTAGAGC TAGAA gRNA-rihC-A TTCTAGCTCTAAAACAGACATTACCCGCGACGGTGACTAGTATTATACCTA GGACT gRNA-trpR-S AGTCCTAGGTATAATACTAGTGATGGCAGAACAGCGTCACCGTTTTAGAG CTAGAA gRNA-trpR-A AGTCCTAGGTATAATACTAGTGATGGCAGAACAGCGTCACCGTTTTAGAG CTAGAA gRNA-argF-S AGTCCTAGGTATAATACTAGTCTCAAAGCCGATAAAAAAAAGTTTTAGAG CTAGAA gRNA-argF-A TTCTAGCTCTAAAACTTTTTTTTATCGGCTTTGAGACTAGTATTATACCTAG GACT

[0082] 3. Specific Process for Constructing the Bacteria

[0083] 3.1 Integrating the Pyrimidine Nucleoside Operon Genes Derived from Bacillus subtilis into the yghX Locus on the Genome of W3110

[0084] B. subtilis A260 was obtained from B. subtilis 168 by atmospheric and room temperature plasma (ARTP) mutagenesis coupled with high throughput screening method and this strain has been stored in China General Microbiological Culture Collection Center on Dec. 2, 2015 (address: No. 3, yard 1, beichen west road, chaoyang district, Beijing, Institute of Microbiology, Chinese Academy of Sciences, zip code: 100101) with a strain preservation number CGMCC NO. 11775. Sequence analysis of the pyrimidine nucleotide biosynthetic operon of B. subtilis A260 showed that three consecutive bases from position 2846 to 2848 of pyrAB gene (code the large subunit of CPSase of B. subtilis) were missing resulted in the deletion of the 949.sup.th amino acid residues of large subunit of CPSase. It is proven that the mutation E949* on the large subunit of B. subtilis CPSase was of importance for the resistance to UMP inhibition and we have applied for patent protection for the relevant research results (Chinese Patent CN105671007A).

[0085] In this invention, the pyr operon genes (pyrBCAKDFE, consists of pyrB, pyrC pyrAA pyrAB pyrK, pyrD pyrF and pyrE genes) derived from Bacillus subtilis A260 were successively introduced into the yghX locus on genome of Escherichia coli W3110 and promoted by the strong promoter P.sub.trc by three rounds of integration and assembly to construction the strain E. coli UR3.

[0086] 3.1.1 Integration of P.sub.trc-pyrB Fragment

[0087] The upstream and downstream homologous arms of the yghX gene were amplified by PCR using the genomic DNA of E. coli W3110 (ATCC 27325) as a template and the upstream homologous arm primers (UP-yghX-S, UP-yghX-A) and downstream homologous arm primers (DN-yghX-S1, DN-yghX-A) as primers which were designed according to the upstream and downstream sequence of yghX gene; pyrB gene fragment was amplified by PCR using the genomic DNA of B. subtilis A260 (CGMCC No. 11775) as a template and pyrB-S and pyrB-A as primers which were designed according to the pyrB gene sequence; sequence of promoter P trc was contained in primers DN-yghX-A and pyrB-S; these fragment were fused together by overlapping PCR generating the pyrB integration fragment (upstream homologous arm-P.sub.trc-pyrB-downstream homologous arm); the dsDNA to construct the plasmid gRNA-yghX plasmid was obtained by anneal of primer gRNA-yghX-S and primer gRNA-yghX-A. Competent cells of E. coli W3110 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR1. Construction and PCR verification of pyrB gene integrated fragment are shown in FIG. 2. Wherein, the upstream homologous arm was 560 bp, the P.sub.trc-pyrB fragment was 1003 bp, the downstream homologous arm was about 602 bp, all the pyrB integration fragment after fusion was 2239 bp, PCR fragment obtained by PCR amplication after integration of P.sub.trc-pyrB fragment was 2239 bp, PCR fragment obtained by PCR amplication of the original strain was 1635 bp.

[0088] 3.1.2 Integration of pyrC-pyrAA Fragment

[0089] The upstream homologous arms (upstream sequence of pyrC-pyrC-pyrAA) was amplified by PCR using the genomic DNA of B. subtilis A260 (CGMCC No. 11775) as a template and UP-pyrC-pyrAA-S and UP-pyrC-pyrAA-A as primers which were designed according to upstream sequence of the pyrC gene and the pyrC-pyrAA sequence; the downstream homologous arms of the yghX gene were amplified by PCR using the genomic DNA of E. coli UR1 as a template and DN-yghX-S2 and DN-yghX-A as primers which were designed according to the downstream sequence of yghX gene; these two fragment were fused together by overlapping PCR genetating the pyrC-pyrAA integration fragment (upstream upstream sequence of the pyrC gene-pyrC-pyrAA-downstream homologous arm); the dsDNA to construct the plasmid gRNA-pyr1 plasmid was obtained by anneal of primer gRNA-pyr1-S and primer gRNA-pyr1-A. Competent cells of E. coli UR1 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR2. Construction and PCR verification of pyrC-pyrAA integrated fragment are shown in FIG. 3. Wherein, the upstream homologous arm was 2889 bp, the downstream homologous arm was about 602 bp, all the pyrB integration fragment after fusion was 3468 bp, PCR fragment obtained by PCR amplication after integration of pyrC-pyrAA fragment was 2889 bp and no PCR fragment was obtained by PCR amplication of the original strain.

[0090] 3.1.3 Integration of pyrAB-pyrK-pyrD-pyrF-pyrE Fragment

[0091] The upstream homologous arms (upstream sequence of pyrAB-pyrAB-pyrK-pyrD-pyrF-pyrE) was amplified by PCR using the genomic DNA of B. subtilis A260 (CGMCC No. 11775) as a template and UP-pyrABKDFE-S and UP-pyrABKDFE-A as primers which were designed according to upstream sequence of the pyrAB gene and the pyrAB-pyrK-pyrD-pyrF-pyrE sequence; the downstream homologous arms of the yghX gene were amplified by PCR using the genomic DNA of E. coli UR2 as a template and DN-yghX-S3 and DN-yghX-A as primers which were designed according to the downstream sequence of yghX gene; these two fragment were fused together by overlapping PCR genetating the pyrAB-pyrK-pyrD-pyrF-pyrE integration fragment (upstream upstream sequence of the pyrAB gene-pyrAB-pyrK-pyrD-pyrF-pyrE-downstream homologous arm); the dsDNA to construct the plasmid gRNA-pyr2 plasmid was obtained by anneal of primer gRNA-pyr2-S and primer gRNA-pyr2-A. Competent cells of E. coli UR2 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR3. Construction and PCR verification of pyrAB-pyrK-pyrD-pyrF-pyrE integrated fragment are shown in FIG. 4. Wherein, the upstream homologous arm was 6757 bp, the downstream homologous arm was about 602 bp, all the pyrB integration fragment after fusion was 7336 bp, PCR fragment obtained by PCR amplication after integration of pyrAB-pyrK-pyrD-pyrF-pyrE fragment was 1262 bp and no PCR fragment was obtained by PCR amplication of the original strain.

[0092] 3.2 Knock Out of Genes Related to Uridine Degradation

[0093] 3.2.1 Deletion of Udk Gene

[0094] The upstream and downstream homologous arms of the udk gene were obtained by PCR amplification using the genomic DNA of E. coli W3110(ATCC27325) as a template and upstream homologous arm primers (UP-udk-S, UP-udk-A) and downstream homologous arm primers (DN-udk-S, DN-udk-A) as primers which were designed according to the upstream and downstream sequence of udk gene; these two fragment were fused together by overlapping PCR genetating the udk gene deletion fragment. the dsDNA to construct the plasmid gRNA-udk plasmid was obtained by anneal of primer gRNA-udk-S and primer gRNA-udk-A. Competent cells of E. coli UR3 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR5. Deletion and verification of udk gene are shown in FIG. 5. Wherein, the upstream homologous arm was 477 bp, the downstream homologous arm was about 436 bp, the udk gene deletion fragment obtained by overlapping PCR was 894 bp; PCR fragment obtained by PCR amplication after deletion of udk gene was 894 bp and PCR fragment by PCR amplication of the original strain was 1422 bp.

[0095] 3.2.2 Deletion of Udp Gene

[0096] The upstream and downstream homologous arms of the udp gene were obtained by PCR amplification using the genomic DNA of E. coli W3110(ATCC27325) as a template and upstream homologous arm primers (UP-udp-S, UP-udp-A) and downstream homologous arm primers (DN-udp-S, DN-udp-A) as primers which were designed according to the upstream and downstream sequence of udp gene; these two fragment were fused together by overlapping PCR genetating the udpgene deletion fragment. the dsDNA to construct the plasmid gRNA-udp plasmid was obtained by anneal of primer gRNA-udp-S and primer gRNA-udp-A. Competent cells of E. coli UR4 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR5. Deletion and verification of udp gene are shown in FIG. 6. Wherein, the upstream homologous arm was 492 bp, the downstream homologous arm was about 516 bp, the udp gene deletion fragment obtained by overlapping PCR was 1008 bp; PCR fragment obtained by PCR amplication after deletion of udp gene was 1008 bp and PCR fragment by PCR amplication of the original strain was 1653 bp.

[0097] 3.2.3 Deletion of rihA Gene

[0098] The upstream and downstream homologous arms of the rihA gene were obtained by PCR amplification using the genomic DNA of E. coli W3110(ATCC27325) as a template and upstream homologous arm primers (UP-rihA-S, UP-rihA-A) and downstream homologous arm primers (DN-rihA-S, DN-rihA-A) as primers which were designed according to the upstream and downstream sequence of rihA gene; these two fragment were fused together by overlapping PCR genetating the rihA gene deletion fragment. the dsDNA to construct the plasmid gRNA-rihA plasmid was obtained by anneal of primer gRNA-rihA-S and primer gRNA-rihA-A. Competent cells of E. coli UR5 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR6. Deletion and verification of rihA gene are shown in FIG. 7. Wherein, the upstream homologous arm was 527 bp, the downstream homologous arm was about 515 bp, the rihA gene deletion fragment obtained by overlapping PCR was 1021 bp; PCR fragment obtained by PCR amplication after deletion of rihA gene was 1021 bp and PCR fragment by PCR amplication of the original strain was 1857 bp.

[0099] 3.2.4 Deletion of rihB Gene

[0100] The upstream and downstream homologous arms of the rihA gene were obtained by PCR amplification using the genomic DNA of E. coli W3110(ATCC27325) as a template and upstream homologous arm primers (UP-rihB-S, UP-rihB-A) and downstream homologous arm primers (DN-rihB-S, DN-rihB-A) as primers which were designed according to the upstream and downstream sequence of rihB gene; these two fragment were fused together by overlapping PCR genetating the rihA gene deletion fragment. the dsDNA to construct the plasmid gRNA-rihB plasmid was obtained by anneal of primer gRNA-rihB-S and primer gRNA-rihB-A. Competent cells of E. coli UR6 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR7. Deletion and verification of rihB gene are shown in FIG. 8. Wherein, the upstream homologous arm was 474, the downstream homologous arm was about 438, the rihB gene deletion fragment obtained by overlapping PCR was 891; PCR fragment obtained by PCR amplication after deletion of rihB gene was 891 and PCR fragment by PCR amplication of the original strain was 1789 bp.

[0101] 3.2.5 Deletion of rihC Gene

[0102] The upstream and downstream homologous arms of the rihC gene were obtained by PCR amplification using the genomic DNA of E. coli W3110(ATCC27325) as a template and upstream homologous arm primers (UP-rihC-S. UP-rihC-A) and downstream homologous arm primers (DN-rihC-S, DN-rihC-A) as primers which were designed according to the upstream and downstream sequence of rihC gene; these two fragment were fused together by overlapping PCR genetating the rihC gene deletion fragment. the dsDNA to construct the plasmid gRNA-rihC plasmid was obtained by anneal of primer gRNA-rihC-S and primer gRNA-rihC-A. Competent cells of E. coli UR7 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR8. Deletion and verification of rihC gene are shown in FIG. 9. Wherein, the upstream homologous arm was 520 bp, the downstream homologous arm was about 455, the rihC gene deletion fragment obtained by overlapping PCR was 955; PCR fragment obtained by PCR amplication after deletion of rihC gene was 955 and PCR fragment by PCR amplication of the original strain was 1787 bp.

[0103] 3.3 Integration of P.sub.trc-prsA Fragment on trpR Gene Locus

[0104] The upstream and downstream homologous arms of the trpR gene were obtained by PCR amplification using the genomic DNA of E. coli W3110 (ATCC27325) as a template and upstream homologous arm primers (UP-trpR-S, UP-trpR-A) and downstream homologous arm primers (DN-trpR-S, DN-trpR-A) as primers which were designed according to the upstream and downstream sequence of trpR gene; prsA gene fragment was amplified by PCR using the genomic DNA of E. coli W3110(ATCC27325) as a template and prsA-S and prsA-A as primers which were designed according to the prsA gene sequence; sequence of promoter P.sub.t, was contained in primers DN-trpR-A and prsA-S; these fragment were fused together by overlapping PCR genetating the P.sub.trc-prsA integration fragment (upstream homologous arm-P.sub.trc-prsA-downstream homologous arm); the dsDNA to construct the plasmid gRNA-trpR plasmid was obtained by anneal of primer gRNA-trpR-S and primer gRNA-trpR-A. Competent cells of E. coli UR8 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR9. Construction and PCR verification of P.sub.trc-prsA gene integrated fragment are shown in FIG. 10. Wherein, the upstream homologous arm was 451 bp, the prsA fragment was 1243 bp, the downstream homologous arm was about 404 bp, all the P.sub.trc-prsA integration fragment after fusion was 2058 bp, PCR fragment obtained by PCR amplication after integration of P.sub.trc-prsA fragment was 2058 bp, PCR fragment obtained by PCR amplication of the original strain was 1333 bp.

[0105] 3.4 Deletion of thrA Gene

[0106] The upstream and downstream homologous arms of the thrA gene were obtained by PCR amplification using the genomic DNA of E. coli W3110(ATCC27325) as a template and upstream homologous arm primers (UP-thrA-S, UP-thrA-A) and downstream homologous arm primers (DN-thrA-S, DN-thrA-A) as primers which were designed according to the upstream and downstream sequence of thrA gene; these two fragment were fused together by overlapping PCR genetating the thrA gene deletion fragment. the dsDNA to construct the plasmid gRNA-thrA plasmid was obtained by anneal of primer gRNA-thrA-S and primer gRNA-thrA-A. Competent cells of E. coli UR9 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR10. Deletion and verification of thrA gene are shown in FIG. 11. Wherein, the upstream homologous arm was 394 bp, the downstream homologous arm was about 621, the thrA gene deletion fragment obtained by overlapping PCR was 1015; PCR fragment obtained by PCR amplication after deletion of thrA gene was 1015 and PCR fragment by PCR amplication of the original strain was 3323 bp.

[0107] 3.5 Deletion of argF Gene

[0108] The upstream and downstream homologous arms of the argF gene were obtained by PCR amplification using the genomic DNA of E. coli W3110(ATCC27325) as a template and upstream homologous arm primers (UP-argF-S, UP-argF-A) and downstream homologous arm primers (DN-argF-S, DN-argF-A) as primers which were designed according to the upstream and downstream sequence of argF gene; these two fragment were fused together by overlapping PCR genetating the argF gene deletion fragment. the dsDNA to construct the plasmid gRNA-argF plasmid was obtained by anneal of primer gRNA-argF-S and primer gRNA-argF-A. Competent cells of E. coli UR10 were prepared and treated following the method shown in chapter 1.3 and 1.4 to construct the strain E. coli UR11. Deletion and verification of argF gene are shown in FIG. 12. Wherein, the upstream homologous arm was 568 bp, the downstream homologous arm was about 434, the thrA gene deletion fragment obtained by overlapping PCR was 1002 bp; PCR fragment obtained by PCR amplication after deletion of thrA gene was 1002 and PCR fragment by PCR amplication of the original strain was 1897 bp.

Example 2 Method of Fermentative Producing Uridine by E. coli UR11

[0109] (1) Shake-Flask Fermentation

[0110] Slant culture: a loop of thallus was scraped off from the strain deposit tube stored in 80 C., and spread evenly on the agar slant culture medium to culture for 12 h, then transferred into a second-generation agar slant to culture for 12 h.

[0111] Seed culture: a loop of thallus was inoculated into a 500 mL erlenmeyer flask with 30 mL seed medium, sealed with nine layers of gauze and cultured for 6-8 h at 37 C. and 200 rpm.

[0112] Shake-flask fermentation: the seed liquid is inoculated into a fermentation medium according to a inoculum size of 10-15% (a total volume is 30 mL), sealed with nine layers of gauze and cultured for 24-30 h at 37 C. and 200 rpm; The pH is maintained to be 7.0-7.2 by supplementing NH.sub.4OH, and a 60% (m/v) glucose solution is added for maintaining the fermentation when needed (the phenol red is used as an indicator, and that the color of the fermentation broth changes no longer means sugar deficiency, and then 1-2 ml of 60% glucose solution is added).

[0113] The slant culture medium: glucose 1-5 g/L, tryptone 5-10 g/L, beef extract 5-10 g/L, yeast extract 1-5 g/L, NaCl 1-2.5 g/L, agar 15-20 g/L, the rest is water, pH 7.0-7.2.

[0114] The seed medium: glucose 20-30 g/L, (NH.sub.4).sub.2SO.sub.4 1-5 g/L, KH.sub.2PO.sub.4 1-5 g/L, MgSO.sub.4.7H.sub.2O 1-2 g/L, yeast extract 5-10 g/L, FeSO.sub.4.7H.sub.2O 1-3 mg/L, MnSO.sub.4.H.sub.2O 1-3 mg/L, the rest is water, pH 7.0-7.2.

[0115] The fermentation medium: glucose 20-40 g/L, (NH.sub.4).sub.2SO.sub.4 1-3 g/L, KH.sub.2PO.sub.4 1-3 g/L, MgSO.sub.4.7H.sub.2O 1-2 g/L, yeast extract 0.1-0.3 g/L, corn steep liquor 1-2 mL/L, FeSO.sub.4.7H.sub.2O 80-100 mg/L, MnSO.sub.4.7H.sub.2O 80-100 mg/L, the rest is water, pH 7.0-7.2.

[0116] The titer of uridine reached 8-12 g/L after 24-30 h fermentation in shake flask.

[0117] (2) Bioreactor Fermentation:

[0118] Slant culture: a loop of thallus was scraped off from the strain deposit tube stored in 80 C., and spread evenly on the agar slant culture medium to culture for 12-16 h, then transferred into an eggplant bottle to culture for 12-16 h.

[0119] Seed culture: transferring the cells cultured in the eggplant bottle into a 5 L bioreactor (Baoxing, Shanghai, China) containing 3 L seed medium. The pH was kept constant at 7.0 by automated addition of NH.sub.4OH (25%, v/v). Dissolved oxygen was maintained above 20% by variation of the stirrer speed and the aeration rate. The temperature was kept constant at 37 C. The seed cultures were continued until OD.sub.600 of the culture achieved approximately 12-15, and 500 mL of culture broth was retained for the fed-batch cultures.

[0120] Bioreactor fermentation: fed-batch cultures were carried out in a 5 L bioreactor containing 3 L medium in total. The pH was kept constant at 7.0 by automated addition of NH.sub.4OH (25%, v/v). Dissolved oxygen was maintained at 25-35% by variation of the stirrer speed and the aeration rate. When glucose was exhausted, 80% glucose solution was added at an appropriate rate to maintain the glucose concentration below 5 g/L. The fermentation period is 40-70 h.

[0121] The slant culture or eggplant bottle medium: glucose 1-5 g/L, tryptone 5-10 g/L, beef extract 5-10 g/L, yeast extract 1-5 g/L, NaCl 1-2.5 g/L, agar 15-20 g/L, the rest is water, pH 7.0-7.2.

[0122] The seed medium: glucose 15-30 g/L, yeast extract 5-10 g/L, peptone 5-10 g/L, KH.sub.2PO.sub.4 5-15 g/L, MgSO.sub.4.7H.sub.2O 2-5 g/L, FeSO.sub.4.7H.sub.2O 5-15 mg/L, MnSO.sub.4.H.sub.2O 5-15 mg/L, VH.sub.1 1-3 mg/L, VH 0.1-1 mg/L, 2 drops of defoamer and the rest is water, pH 7.0-7.2.

[0123] The fermentation medium: glucose 15-25 g/L, yeast extract 1-5 g/L, tryptone 1-5 g/L, sodium citrate 0.1-1 g/L, KH.sub.2PO.sub.4 1-5 g/L, MgSO.sub.4.7H.sub.2O 0.1-1 g/L, FeSO.sub.4.7H.sub.2O 80-100 mg/L, MnSO.sub.4.H.sub.2O 80-100 mg/L, VB.sub.1 0.5-2 mg/L, VB.sub.3 0.5-2 mg/L, VB.sub.5 0.5-2 mg/L, VB.sub.12 0.5-2 mg/L, VH 0.5-2 mg/L, threonine 50-200 mg/L, lysine 50-200 mg/L, methionine 50-200 mg/L, glutamine 50-200 mg/L, arginine 50-200 mg/L, 2 drops of defoamer and the rest is water, pH 7.0-7.2.

[0124] The titer of uridine reached 40-67 g/L after 40-70 h fermentation in a 5 L bioreactor.

Example 3: Fermentation Experiment in a 5 L Bioreactor by E. coli UR11

[0125] Slant culture: a loop of thallus was scraped off from the strain deposit tube stored in 80 C., and spread evenly on the agar slant culture medium to culture at 37 C. for 12 h, then transferred into an eggplant bottle to culture for 12 h.

[0126] Seed culture: transferring the cells cultured in the eggplant bottle into a 5 L bioreactor (Baoxing, Shanghai, China) containing 3 L seed medium. The pH was kept constant at 7.0 by automated addition of NH.sub.4OH (25%, v/v). Dissolved oxygen was maintained above 20% by variation of the stirrer speed and the aeration rate. The temperature was kept constant at 37 C. The seed cultures were continued until OD.sub.600 of the culture achieved approximately 12-15, and 500 mL of culture broth was retained for the fed-batch cultures.

[0127] Bioreactor fermentation: fed-batch cultures were carried out in a 5 L bioreactor containing 3 L medium in total. The pH was kept constant at 7.0 by automated addition of NH.sub.4OH (25%, v/v). Dissolved oxygen was maintained at 25-35% by variation of the stirrer speed and the aeration rate. When glucose was exhausted, 80% glucose solution was added at an appropriate rate to maintain the glucose concentration below 5 g/L. The fermentation period is 64 h.

[0128] The slant medium: glucose 1 g/L, tryptone 10 g/L, beef extract 10 g/L, yeast extract 5 g/L, NaCl 2.5 g/L, agar 25 g/L, the rest is water, pH 7.0.

[0129] The seed medium: glucose 25 g/L, yeast extract 5 g/L, tryptone 3 g/L, KH.sub.2PO.sub.4 1.2 g/L, MgSO.sub.4.7H.sub.2O 0.5 g/L, FeSO.sub.4.7H.sub.2O 10 mg/L, MnSO.sub.4.H.sub.2O 10 mg/L, V.sub.B1 1 mg/L, VB.sub.3 1 mg/L, VB.sub.5 1 mg/L, VB.sub.12 1 mg/L, VH 1 mg/L, 2 drops of defoamer and the rest is water, pH 7.0.

[0130] The fermentation medium: glucose 20 g/L, yeast extract 4 g/L, tryptone 5 g/L, sodium citrate 2 g/L, KH.sub.2PO.sub.4 2 g/L, MgSO.sub.4.7H.sub.2O 2 g/L, FeSO.sub.4.7H.sub.2O 20 mg/L, MnSO.sub.4.H.sub.2O 10 mg/L, VB.sub.1 2 mg/L, VB.sub.3 2 mg/L, VB.sub.5 2 mg/L, VB.sub.12 2 mg/L, VH 2 mg/L, threonine 200 mg/L, lysine 200 mg/L, methionine 200 mg/L, glutamine 200 mg/L, arginine 200 mg/L, 2 drops of defoamer and the rest is water, pH 7.0.

[0131] The titer of uridine reached 67 g/L after 64 h fermentation by E. coli UR11 in a 5 L bioreactor and the fermentation process curves are shown in FIG. 13.

[0132] Although the method of implementation of the invention is better disclosed above, it is not used to limit the invention. Those skilled in the field can make various changes and modifications without breaking away from the spirit and scope of the invention. Therefore, the scope of protection of the invention shall be subject to the limitation of the claim.