TAGLESS ENCODED CHEMICAL LIBRARY

Abstract

Described is a method for screening an encoded chemical library, which library comprises a plurality of different chemical structures each releasably linked to an encoding tag, the method comprising the steps of: (a) providing said library of tagged chemical structures; (b) releasing each chemical structure from its tag to produce a plurality of free, tagless chemical structures (TCSs); (c) screening the TCSs by contacting them with a assay system under conditions whereby a spatial association between each TCS and its tag is maintained, to produce a plurality of different screened TCSs each spatially associated with its tag; and (d) identifying a screened TCS by decoding a tag that is spatially associated therewith.

Claims

1. A method for screening an encoded chemical library, which library comprises a plurality of different chemical structures each releasably linked to an encoding tag, the method comprising the steps of: (a) providing said library of tagged chemical structures; (b) releasing each chemical structure from its tag to produce a plurality of free, tagless chemical structures (TCSs); (c) screening the TCSs by contacting them with a assay system under conditions whereby a spatial association between each TCS and its tag is maintained, to produce a plurality of different screened TCSs each spatially associated with its tag; and (d) identifying a screened TCS by decoding a tag that is spatially associated therewith.

2. The method of claim 1 wherein the encoding tag comprises a nucleic acid, the method being for screening a nucleic acid-encoded chemical library.

3-4. (canceled)

5. The method of claim 1, wherein the chemical structures are small molecules.

6. The method of claim 1, wherein the chemical structures are releasably linked to the encoding tag by a cleavable linker, optionally wherein the cleavable linker comprises a linker selected from: enzymatically cleavable linkers; nucleophile/base-sensitive linkers; reduction sensitive linkers; photocleavable linkers; electrophile/acid-sensitive linkers; metal-assisted cleavage-sensitive linkers; oxidation-sensitive linkers; and combinations of two or more of the foregoing.

7. The method of claim 1, wherein the chemical structures are releasably linked to the encoding tag by a self-immolative linker comprising a cleavage moiety and a self-immolative moiety (SIM), optionally wherein the cleavage moiety is a peptide or non-peptide enzymatically cleavable moiety, e.g. Val-Cit-PAB.

8. The method of claim 1, wherein the chemical structures are releasably linked to the encoding tag by nucleic acid hybridization.

9.-14. (canceled)

15. The method of claim 1, wherein the encoded chemical library of step (a) comprises a number n of clonal populations of tagged chemical structures, each clonal population being confined to n discrete library microcompartments.

16.-20. (canceled)

21. The method of claim 1, wherein the tags of step (c) are functionally or physically partitioned from the assay system.

22-29. (canceled)

30. The method of claim 2, wherein the encoding nucleic acid tag is a template for the chemical structure.

31. The method of claim 9 wherein step (a) comprises the step of nucleic acid-templated, for example DNA-templated, synthesis of the chemical structures.

32-37. (canceled)

38. The method of claim 10, wherein said templated synthesis comprises hybridization between nucleic acid coupled to the chemical structure and the nucleic acid of the encoding tag template.

39. The method of claim 2, wherein the encoding nucleic acid tag is not a template for the chemical structure.

40-41. (canceled)

42. The method of claim 1, wherein the library comprises a clonal population of chemical structures and step (a) comprises the step of releasably linking an encoding tag to each of the chemical structures within said clonal population.

43-47. (canceled)

48. The method of claim 1, wherein the screening step (c) comprises a phenotypic screen.

49. The method of claim 4, wherein the assay system comprises a live target cell.

50-69. (canceled)

70. An encoded chemical library for use in the method of claim 1, which library comprises a number n of clonal populations of chemical structures each releasably linked to an encoding tag, each clonal population being confined to n discrete library microcompartments.

71. The library of claim 16 wherein the chemical structures are linked to the encoding tags by a cleavable linker as defined in claim 5.

72. The library of claim 16, wherein the chemical structures are linked to the encoding tags by nucleic acid hybridization, for example as defined in claim 5.

73. The library of claim 16, wherein the chemical structures are contained within the microcompartments together with encoding tags but are not covalently linked to the encoding tags.

74-80. (canceled)

81. An assay composition for use in the method of claim 1, comprising the library of claim 16 in which the chemical structures contained within the microcompartments are in contact with an assay system.

82-86. (canceled)

Description

FIGURE LEGENDS

[0190] FIG. 1: schematic representation of split-and-pool DECL generation. A primary pharmacore is tagged and anchored to a bead via a complementary oligonucleotide which is specific for the primary pharmacore. The M-mM concentrations of guide DNA in the bead yields corresponding M-mM concentrations of the pharmacore in the bead. Assembly around the primary pharmacore using traditional chemistry methodseach addition is coupled to specific DNA ligated to the end of the encoding tag (which serves as a barcode). The bead can therefore be used for solid-phase synthesis and large quantities of reactive secondary pharmacores can be added for reaction. The ligation of additional oligonucleotide can occur simultaneously (for example via click or similar chemistry) or by a post-synthesis step.

[0191] FIG. 2: schematic representation of split-and-pool DECL. The synthesis step comprises pharmacore (substructure) assembly encoded by DNA sequence (tag) addition as shown in FIG. 1. The M-mM concentrations of guide DNA in the bead yields corresponding M-mM concentrations of the synthesised chemical structure. The indicator cells are for phenotypic screening. Tag release inside the droplet yields free, tagless chemical structures at concentrations sufficient to interact with the indicator cells in the phenotypic screen. The DNA tags remain spatially associated with the free chemical structures within the droplet. Positive FACs hits are sequenced by NGS sequencing to identify the structure of the chemical structure.

[0192] FIG. 3: Ligation of encoded oligonucleotides onto bead mounted capture oligonucleotide.

[0193] FIG. 4: Enzymatic release of a payload from a cleavable linker on a gel.

[0194] FIG. 5: Enzymatic release of a payload from a cleavable linker in 100 m aqueous droplets.

[0195] FIG. 6: Release of a chemical structure payload functionalised with a fluorescent dye using huisgen 1,3-Dipolar cycloaddition from a bead-bound oligonucleotide.

[0196] FIG. 7: Release of a chemical structure payload functionalised with a fluorescent dye using isothiocyanate addition from a bead-bound oligonucleotide.

[0197] FIG. 8: Schematic representation of release of free chemical structure using a self-immolative linker.

[0198] FIG. 9: Schematic representation of split-and-pool DECL using a self-immolative dipeptide linker.

[0199] FIG. 10: Schematic representation of release of free chemical structures using a Val-Cit-PAB self-immolative peptide linker coupled to beads bearing encoding tag.

EXAMPLE 1: GENERATING A TAGLESS COMPOUND LIBRARY USING A HYDROGEL MATRIX BEAD WITH SCREENING IN DROPLETS

1: Assembly of Guide Sequence

[0200] 1) Assembly involves a 5 tag oligonucleotide which includes a 12C linker to an amine group for crosslinking and a 3 tag oligonucleotide, note the guide sequences are a pool of oligonucleotides corresponding to the monomers for use in the library in this case 200 oligonucleotides allowing for the assembly >1.610.sup.9 unique sequences.
2) 5 and 3 tag are added at 1 M final concentration
3) 250 barcode oligonucleotides are pooled at final concentration of 1.25 M

Reaction Mixture:

[0201] 10 l NEBuffer 1 (New England Biolabs) [0202] (1 reaction mix is 10 mM Bis-Tris-Propane-HCl, 10 mM MgCl2, 1 mM DTT, pH 7 @ 25 C.) [0203] 5 l 5 tag oligonucleotide @ 100 M [0204] 5 l 3 tag oligonucleotide @ 100 M [0205] 6.25 l of pooled oligonucleotides @ 100 M [0206] 2.5 l Thermostable 5 AppDNA/RNA Ligase (New England Biolabs) [0207] 70.25 l of nuclease free water

Incubate for 4 h at 65 C.

[0208]

TABLE-US-00001 Oligo.name Oligo.sequence 5 modification 3 modification 5 tag ATTATGACCGTAGGCCTTGGC NH.sub.2C.sub.12linker None 3 tag CGCGATATTAGCCATTAA Adenylated Finalresidueisa CCC dideoxyto preventligation ontoendoftag Poololigos Variable18mers Adenylated None
4) Make up 300 l with 110 mM Tris 1 mM EDTA pH7.0 buffer and clean up reaction using an illustra S-200 microspin HR column (GE Healthcare) to eliminate unligated oligonucleotides and reagents.
5) Add 40 l of sodium acetate pH5.2 and 2.5 volumes (1 ml) of 100% ethanol. Mix and put at 20 C. for at least 1 hour and then pellet DNA by centrifugation at 15,000 rpm for 15 minutes at 4 C.
6) Remove supernatant and wash with 1 ml of 70% ethanol and spin for 5 minutes, repeat the wash and then air dry the pellet
7) Resuspend the pellet in 25 l of nuclease free water

2: Crosslinking 5 Tag Oligonucleotide to the Agarose to Allow Crosslinking During PCR

[0209] 1) Prepare agarose for cross linking by weighing 25 g of low melt agarose into 50 ml 18.2 M water and mix at 4 C. for 30 minutes to hydrate. Dry by filtering and wash with 100 ml of water, recover the slurry and measure the volume (usually 15-20 ml).
2) Add an equal volume of 0.05M NaOH to the slurried agarose, confirm pH and adjust to between 10.5 and 11, if need be, by adding 10M NaOH as needed.
3) Place the slurry on a magnetic stirrer and mix as CNBr is added.
4) Add 100 mg/ml of slurry Cyanogen Bromide-activated Sepharose (CNBr) (Sigma) (i.e. in 40 ml of slurry add 4 g of CNBr), immediately check the pH and monitor till the CNBr has fully dissolved (the addition of 1-2 ml of 10M NaOH may be required to keep pH between 10.5 and 11). Monitor the pH as reaction proceeds for 15 minutes.
5) After 15 minutes or once the pH becomes static the reaction is complete. Block any remaining active CNBr by adding equal volume of 200 mM NaHCO.sub.3 at pH 8.5.
6) Using a Buchner funnel filter the slurry and wash 350 ml with 100 mM NaHCO.sub.3500 mM NaCl at pH8.5.
7) Resuspend in a total volume 25 ml of 100 mM NaHCO.sub.3500 mM NaCl at pH 8.5 buffer.
8) Take 250 l of 5tag oligonucleotide at 100 M with NH2-linker on 5 end and mix with the slurried agarose, mix for 2 hours at room temperature.
9) Add equal volume (25 ml) of 0.2M Glycine to block any remaining active CNBr binding sites.
10) Filter the slurry and wash with 100 ml of 100 mM NaHCO.sub.3500 mM NaCl at pH8.5 buffer, then wash with 100 ml of water air dry and collect gel and weigh (note this material can be kept for storage by adding 0.1% Sodium Azide, alternatively it can be freeze dried and stored at RT for long term usage. If adding Sodium Azide, then the slurry must be filtered and washed to remove azide before usage.
11) This is approximately 40% agarose and is saturated with 5tag oligonucleotide crosslinked via the amine linker at this stage and can be used later to produce hydrogel matrix. A small aliquot (100 l) is taken and assayed to check it still melts at roughly 75 C. and sets solid below 20 C. to check crosslinking has not adversely affected gelling properties.

3: PCR in Beads

[0210] This step amplifies up, in a single droplet, a single specific DNA guide, thus yielding a clonal DNA population in each bead. Note the cross linked 5tag oligonucleotide is used in the PCR, but remains bound to the agarose as covalent linkage. This cannot be lost from the agarose. This gives a clonal bead with M concentrations of DNA guide attached all over and within the bead.

[0211] 1) Either dissolve dried agarose-CNBr-oligonucleotide or add slurry to a final concentration of 0.5% as needed.

[0212] 2) Make the aqueous reaction mixture as follows and keep it warm. The reduced 3Rev tag favours production of 5tag product by asymmetric PCR, thus more cross-linked guide is produced compared to the template. Assembled guide DNA is at 1 copy/droplet (some droplets are empty)

Reaction make up 1 ml volume/encapsulation [0213] 200 l 5 Phusion HF buffer [0214] 20 l 10 mM dNTP mix (equal mix) [0215] 2 l of 3 Rev-comp oligonucleotide (GGGTTAATGGCTAATATCGCG) [0216] 50 l Phusion HSII polymerase (New England Biolabs)
To 1000 l with nuclease free water with 0.015 g of CNBr-5 tag agarose (so 1.5% agarose beads).
3) Encapsulate in a 14 m etched droplet generation chip (Dolomite, UK) using Pico-Surf 1 (2% surfactant, Dolomite, UK) as the continuous phase (20 L/min aqueous phase, 40 L/min oil phase.
4) PCR the complete droplet mix in bulksplit between 48 wells (50 l/well).
5) 98 C. 2 minutes [98 C. 15 seconds, 54 C. 15 seconds, 72 C. 10 seconds]30 72 C. 2 minutes then to 4 C. for 20 minutes to solidify (keep at 4 C. until ready to proceed).
6) Pool beads and add 5 volumes (5 ml) of PBS+1% Tween80 and mix by inversion, centrifuge at 2500 g for 15 minutes at 4 C. to pellet.
7) Remove supernatant and wash beads with 5 volumes (5 ml) PBS+1% Tween80 again to remove all oil, centrifuge at 2500 g for 15 minutes at 4 C. to pellet.
8) Beads are now free of oil, to remove any hybridised and not crosslinked DNA (or reverse complement to guide) wash with 5 ml of 0.1M NaOH, mix at RT for 5 minutes, then centrifuge at 2500 g for 15 minutes at 4 C. to pellet.
9) Repeat 0.1M NaOH wash
10) Add 5 ml of water to the beads and centrifuge at 2500 g for 15 minutes at 4 C. to pellet.
11) Repeat water wash, beads are now ready to guide chemistry reaction

4: Guided Assembly of Chemical Library

[0217] DNA guides assembly of monomerswere synthesised using conventional chemistry the RNA tags were synthesised in advance by IDT. The last 3 nucleotides contain phosphorothioate linkages to prevent cleavage by exonucleases. Individual reagents are then tagged with a guide to a specific RNA specific to a unique sequence incorporated into the guide oligonucleotide (100 unique monomers can be assembled, assuming up to 4 guide sequences into over 100,000,000 unique compounds). Guides and tags are between 18 and 25mers and with a Tm for DNA of >60 C. however as RNA-DNA interactions are more stable we have seen real melting temperatures of 75-85 C. for these oligonucleotides.

1) Beads are packed into a column (each bead is clonal with a unique DNA sequence to guide assembly but M concentrations of this clonal guide on each bead) and at 20 M 200 million can be present per ml of bead volume.
2) A pool of monomers and appropriate reagents are then washed onto the column and reactions allowed to proceed, the column can be washed and new reaction chemistry added as needed (note fresh monomers can also be added).
3) Chemical synthesis varies with monomers used (see example 2, section 4).
4) Finally the beads are washed with 10 column volumes of TE with 100 mM NaCl and then 2 column volumes of appropriate media for growth of cells in the phenotypic screen e.g. RPMI.
5) Beads are then collected in the growth media and ready for encapsulation with target cells. The newly synthesised compound remains bound via the DNA guideRNA tag interaction (as long as pH kept 5-9 and temperature below 75 C. (as the new compound is attached via 2-4 guides it is very stable).
5: Encapsulation of Chemical Bead with Indicator Cells
Chemicals on bead remain bound until encapsulation. Jurkat cells are diluted so as to trap 2-8/droplet.
1) The agarose beads, 2-8 Jurkat cells in RPMI media and 0.4% w/v type IX-A agarose and 0.1 g/ml RNaseA are encapsulated at 100 L/min aqueous flowrate and 200 L/min with Picosurf 1 (Dolomite, uk) in a droplet generation chip with a 100 m junction. <1 agarose bead is encapsulated per droplet to maintain clonality.
2) Chemical release from the hybridised compounds is due to incorporation of 0.1 g/ml RNaseA in the cell mixture. This doesn't affect cellular growth and is active for at least 48 h in growth media tested. Cleavage of RNA guides occurs within 15-20 minutes in RPMI, lysogeny broth, tryptic soy broth and DMEM. RNaseA cleaves the RNA tag (but not the DNA) leaving and untagged compound no longer bound to the guide and free to diffuse out of the agarose bead and into the indicator droplet. This occurs at 0.5-100 M concentrations.

6: Phenotypic Screening

[0218] 1) After incubation of chemical bead with indicator cell for 24 h the droplets are broken. It is possible to incubate the cells for longer periods: for example, human cells can be incubated in assays for 10 days and bacterial cells are recovered after 28. However, usual incubation times are 24-144 h.
2) Beads are solidified by putting on ice, then broken by adding 4 volumes of Phosphate Buffered Saline (PBS)+1% Tween80, mixing by inversion and then centrifugation at 3500 g for 15 minutes at 4 C.
3) Supernatant is removed and the bead pellet washed again with 4 volumes PBS+1% Tween80.
4) Bead pellet is then filtered through 125 m onto a 45 m particle filter, this removes larger droplets and washed through smaller debris and cells.
5) The beads on the filter are rinsed with 5 volumes of PBS and then collected in a centrifuge tube.
6) Make up mixture to 100 ml with PBS
7) Add TMRM and Hoescht 33342 (Thermo Fisher Scientific) dyes at 200 M final concentration and 1 g/ml respectively. Incubate at room temperature for 30 minutes.
8) Pellet beads by centrifugation at 3500 g for 15 minutes at 4 C.
9) Resuspend in 50 ml PBS and repeat wash step to remove dye
10) Using the Fluorescent Activated Cell Sorter (FACS) excite the Hoescht using 405 nm laser and the TMRM using 488 nm laser, detect output of these channels compared to the known controls.
11) Any droplets showing increased TMRM/Hoescht stain ratio are sorted into a tube

7: Sequencing Targets to Identify Hit Compounds

[0219] 1) Pellet hit beads and resuspend in 25 l of water
2) Set up 1st round PCR to increase copies of each hitnoted millions per droplet attached to agarose by long linker. [0220] 10 l of HF buffer (Thermo Fisher Scientific) [0221] 1 l of 5tag at 10 M (no linker version ATTATGACCGTAGGCCTTGGC) [0222] 1 l 3 Rev-comp oligonucleotide at 10 M (GGGTTAATGGCTAATATCGCG) [0223] 0.25 l Phusion DNA polymerase (Thermo Fisher Scientific) [0224] 25 l of beads in water [0225] 12.75 l of nuclease free water to bring to 50 l
PCR 98 C. 2 minutes [98 C. 15 seconds, 54 C. 15 seconds, 72 C. 10 seconds]15 72 C. 2 minutes
3) Clean up with Ampure XP beads (Beckman Coulter) [0226] Add 1.8 volumes (90 l of Ampure XP beads) mix well by pipetting [0227] Wait 2 minutes and then place on magnet, remove supernatant once beads have collected 2-5 minutes [0228] Wash with 200 l of 80% ethanol, incubate at room temperature for 2 [0229] Place back on the magnet for 2-5 minutes and remove ethanol [0230] Repeat ethanol wash this time air dry for 5 minutes until the beads are dry [0231] Resupend in 20 l of 10 mM Tris-HCL pH7.0 this elutes DNA and place back on magnet [0232] Collect and keep supernatant
4) Second round PCR to add primers
5) Using 5 and 3 tag and modified RC_INDEX and PS_I2 index primers from illumina to encode (12EC and 8PS_I2) with the tag sequences on the 3 end of the primer, these tags are constant but index changes to encode 96 well plate PCR with following conditions: [0233] 10 l 2NEBNext PCR master mix (New England Biolabs) [0234] 2.5 l of RC_INDEX at 3.3 M (1 in 30 dilution of stock) [0235] 2.5 l of PS_I2 primer at 3.3 M (1 in 30 dilution of stock) [0236] 5 l of DNA eluted from PCR one (step 3) [0237] PCR 98 C. 2 minutes [98 C. 10 seconds, 54 C. 60 seconds, 72 C. 30 seconds]30 72 C. 2 minutes

6) Size Selection of PCR Products Selectin 250-350 bp Using Ampure XP Beads (Beckman Coulter).

[0238] To remove larger fragments: [0239] Add 15 l of water to increase volume to 65 l. [0240] Add 49 l (0.75 volumes) of Ampure beads and mix well, incubate for 5 minutes. [0241] Place on magnet for 2 minutes and transfer supernatant to a clean well. [0242] To bin desired fragments [0243] Add 10 l (0.15 volumes of Ampure beads and mix well, incubate for 5 minutes. [0244] Place on magnet and this time discard the supernatant. [0245] Wash with 200 l of 80% ethanol, incubate at room temperature for 2 minutes. [0246] Place back on the magnet for 2-5 minutes and remove ethanol. [0247] Repeat ethanol wash this time air dry for 5 minutes until the beads are dry. [0248] Resupend in 35 l of 10 mM Tris-HCL pH7.0 this elutes DNA and place back on magnet. [0249] Collect and keep 25 l of supernatant.
7) Set up dilutions 1:100. 1:10000 and 1:200000. Using Kapa Fast qPCR (Kapabiosytems) for Illumina quant kit in 141 reactions determine DNA concentration by qPCR.
8) Using qPCR results create a 2 nM library mix of all samples and load onto sequencer following the Illumina protocols for NextSeq500 system guide (Ser. No. 15/046,563) and NextSeq Denature and Dilute Libraries Guide (Ser. No. 15/048,776).
9) Returned sequences of guide nucleic acid flagged by the two tags are easily identified and used to determine the order of compound assembly and its structurethe guide, being less than 200 nucleotides, can be synthesised using ultramers from IDT if required to make more compound from monomers this way quickly and confirm activity. Alternatively, the compound is synthesised directly based on structure decoded from DNA sequencing data.

EXAMPLE 2GENERATING A TAGLESS COMPOUND LIBRARY USING AN IMMOBILISED DNA GUIDE ON SOLID BEADS

1: Assembly of Guide Sequence

[0250] As described in Example 1, section 1, except the 5 tag will be biotinylated rather than an amine.

2: Attaching a Single Guide to a Streptavidin Coated Bead

[0251] To attach a single DNA molecule to an activated bead coated in streptavidin to allow attachment. Beads were purchased from Bangs laboratories Cat No: CP01N with mean diameter of 4.95 m. Beads are polymer coated in streptavidin.
1) 1000 l (5 mg of beads) were taken and pelleted by centrifugation 5000 g for 5 at room temperature.
2) Supernatant was removed and the beads were washed with 1000 l of 100 mM Tris-HCl pH8, 0.1% Tween20
3) Wash was repeated 2 more to remove any remaining buffer
4) Resuspend the beads in 100 l final volume of 100 mM Tris-HCl pH8, 0.1% Tween20
5) Beads are 610.sup.7 beads/mg so in 1000 l we have 6108 beads meaning we need the same number of guides to get on average one per bead. To this end we need roughly 3 femto moles of DNA, as the average guide is 123 bp in length this means we need 0.25 ng of oligonucleotide DNA empirically we have found we need roughly twice this to get best results so use 0.4 ng of DNA guide constructthis is diluted into 100 l of 100 mM Tris-HCl pH8, 0.1% Tween20 and mixed with the beads.
6) The beads are mixed at room temperature for 1 hour
7) Beads are pelleted by centrifugation and are washed 5 with 500 l of 100 mM Tris-HCl pH8, 0.5% Tween20 to remove unbound DNA as described in steps 1 and 2
8) Final resuspension is in 500 l of 10 mM Tris-HCl pH8, 1 mM EDTA buffer and can be stored for weeks at 4 C., 10 l are run on a 0.5% agarose gel and stained with 1 sypro-ruby to stain protein on bead and 1Sybr Gold to stain the DNA, should see both localised although SybR gold can be quite weak on gel and up to 4 distinct bands (1-4 variable regions in guide) with the majority running as the larger fragment. As attached to beads fragments appear to be >10 kb in all cases. If more bands are visible the batch is not homogenous and so has to be repeated.
9) Samples are diluted as droplets are made to give one bead per droplet.

3: Amplification of Guide Oligonucleotide on Functional Beads

[0252] 1) Dilute the oligonucleotide functionalised beads to 70,000 beads/uL in the following mixture:
Reaction make up 1 ml volume/encapsulation: [0253] 200 l 5 Phusion HF buffer (Thermo Fisher Scientific) [0254] 20 l 10 mM dNTP mix (equal mix) [0255] 2 l of 3 Rev-comp oligonucleotide (GGGTTAATGGCTAATATCGCG) (IDT) [0256] 50 l Phusion HSII polymerase (Thermo Fisher Scientific)
2) Encapsulate in a 14 m etched droplet generation chip (Dolomite, UK) using Pico-Surf 1 (2% surfactant, Dolomite, UK) as the continuous phase (20 L/min aqueous phase, 40 L/min oil phase. The bead dilution ensures one bead every 10 droplets, guaranteeing clonality and takes roughly 1 hour to encapsulate the full mixture).
3) Collect the resulting 14 m droplets (18 pL) in an Eppendorf tube.
4) PCR the complete droplet mix in bulksplit between 60 wells (50 l/well).
5) 98 C. 2 minutes [98 C. 15 seconds, 54 C. 15 seconds, 72 C. 10 seconds]30 72 C. 2 minutes then to 4 C. for 20 minutes to solidify (keep at 4 C. until ready to proceed).
6) Pool beads and break the droplets using Pico-break 1 (Dolomite, UK) following the manufacturers protocol.
7) Recover the beads and wash beads with 5 volumes (5 ml) PBS+1% Tween80 again to remove all oil, centrifuge at 2500 g for 15 minutes at 4 C. to pellet.
8) Beads are now free of oil, to remove any hybridised and not crosslinked DNA (or reverse complement to guide) wash with 5 ml of 0.1M NaOH, mix at RT for 5 minutes, then centrifuge at 2500 g for 15 minutes at 4 C. to pellet.
9) Repeat 0.1M NaOH wash.
10) Add 5 ml of water to the beads and centrifuge at 2500 g for 15 minutes at 4 C. to pellet.
11) Repeat water wash, beads are now ready for use.

4: DNA Templated Assisted Synthesis on Beads

[0257] The assembly of the tagged monomers for DNA directed assembly were synthesised using conventional chemistry. The RNA tags were synthesised in advance by IDT and the last 3 nucleotides contained phosphorothioate linkages to prevent cleavage by exonucleases. Individual reagents are then tagged with a guide to a specific RNA specific to a unique guide sequence incorporated into the guide oligonucleotide (100 unique monomers can be assembled, assuming up to 4 guide sequences into over 100,000,000 unique compounds). Guides and tags are designed between 18 and 25mers and with a Tm for DNA of >60 C. however as RNA-DNA interactions are more stable we have seen stability to 75-85 C. for these oligonucleotides. Monomer concentrations are kept below 0.5 M to minimise cross reactivity. Reagents were linked to the 5 end of a sequence corresponding the pools of guide oligonucleotides. In this illustrative example, building blocks containing either (a) Aldehydes or (b) amines are used to link monomers together resulting in a secondary amine linkage after reductive amination.
1) Dilute functionalised guidance beads (from section X, Example 2) to 20,000 beads/L in 50 mM TAPS buffer, pH 8.0, with 250 mM NaCl, 10 mM sodium borohydride and 0.5 M reactive oligonucleotide linked monomers.
2) Using a microfluidic chip with a 20 m etched depth (Dolomite, UK), encapsulate this mixture with an aqueous flow rate of 50 L/min and 100 L/min Pico-surf 1 (2% surfactant, Dolomite, UK) resulting in 20 m diameter droplets (42 pL).
3) Collect droplets into a 50 mL Falcon tube, and allow to react at 25 C. for 24 hours.

5: Droplet Merging of Assembled Compound, Guidance Bead and Indicator Cells

[0258] This step involves a custom made microfluidic chip containing a small droplet generation site, a separate larger droplet generation site for making droplets 100 m in diameter, a Y-shaped channel for droplet synchronisation and a pair of addressable electrodes for droplet coalescence. These devices are readily available from companies such as Dolomite, UK or Micronit, NL.
1) Prepare a mixture containing the following for the indicator droplets: [0259] Jurkat cells (21,000 cells/uL for 5 cells/droplet [0260] RNase A, 0.1 g/mL [0261] 0.5% wt Type IX-A agarose (Sigma) [0262] RPMI media
2) Begin reinjection of the 20 m droplets from step 4, example 2 in the custom made chip.
3) Begin making 100 m droplets using a flow rate of 100 L/mL, with a Pico-surf 1 flow rate of 200 L/min.
4) Using a high speed camera (Pixellink, Canada) match the speed of reinjection of the 20 m droplets to the generation rate of the 100 m droplets to ensure 1:1 synchronisation at the Y-channel. The smaller droplets experience less hydrodynamic drag in the channel and move faster, catching up with the 100 m droplets and self-synchronising into pairs.
5) Merge the contiguous pairs of droplet by electrofusion at the electrodes by applying a an electric field of 4 kV/cm with square wave pulses at 1 KHz from a pulse generator (Aim-TTi, RS components, UK) and a high voltage amplifier (Trek 2220, Trek, USA).
6) Collect the merged droplets off chip, incubate in a tissue culture flask (Fisher, UK) at 37 C. with 5% CO2.

6: Phenotypic Screening

[0263] As described in Example 1, section 6.

7: Sequencing Targets to Identify Hit Compounds

[0264] As described in Example 1, section 7.

EXAMPLE 3REVERSIBLY TAGGING AN EXISTING COMPOUND LIBRARY

1: Generation of Random Oligonucleotide Tags for Addition to Compound Library

[0265] 1) Random tags are purchased from Twist Bioscience comprising 100,000-1,000,000 unique sequences 18-25mers with a Tm>55 C., to each is added a 5 RNA_Adaptor1 oligonucleotide and 3 DNA_Adaptor1 oligonucleotide each is modified to ensure addition to specific end. [0266] 2) Reaction mixture for 200 l reaction: [0267] 20 l 10 Buffer (1 Reaction Buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT) [0268] 100 l 50% PEG 8000 (w/v) (125% (w/v) PEG 8000) [0269] 20 l 10 mM hexamine cobalt chloride (11 mM hexamine cobalt chloride) [0270] 20 l (100 units) T4 RNA Ligase [0271] 20 l 10 mM ATP (11 mM ATP)
20 l oligonucleotide mix (equal mix of the random barcode oligonucleotides and the RNA and DNA adaptor at 30 M each in water). Incubate at 25 C. for 16 hours. Stop the reaction by adding 40 l 10 mM Tris-HCl pH 8.0, 2.5 mM EDTA.

TABLE-US-00002 Oligo.name Oligo.sequence 5 modification 3 modification 5 ATTATGACCGTAGGCCTTGGC None None DNA_Adaptor1 3 CGCGATATTAGCCATTAA phosphorylated None RNA_Adaptor1 CCC Barcodeoligo. Variable18-25mers Phosphorylated None Captureoligo. GGGTTAATGGCTAATATCGCG NH.sub.2C.sub.12linker [0272] 3) Make up 300 l with 10 mM Tris, 1 mM EDTA buffer, pH7 and clean up reaction using an illustra S-200 microspin HR column (GE Healthcare) to eliminate unligated oligonucleotides and reagents. [0273] 4) Add 40 l of sodium acetate pH5.2 and 2.5 volumes (1 ml) of 100% ethanol. Mix and put at 20 C. for at least 1 hour and then pellet DNA by centrifugation at 15,000 rpm for 15 minutes at 4 C. [0274] 5) Remove supernatant and wash with 1 ml of 70% ethanol and spin for 5 minutes, repeat the wash and then air dry the pellet. [0275] 6) Resuspend the pellet in 25 l of nuclease free water

2: Crosslinking 5 Tag Oligonucleotide to the Agarose to Allow Crosslinking During PCR

[0276] 1) Prepare agarose for cross linking by weighing 25 g of low melt agarose (Sigma) into 50 ml 18.2 M water and mix at 4 C. for 30 minutes to hydrate. Dry by filtering and wash with 100 ml of water, recover the slurry and measure the volume (usually 15-20 ml). [0277] 2) Add an equal volume of 0.05M NaOH to the slurried agarose, confirm pH and adjust to between 10.5 and 11 if need be by adding 10M NaOH as needed. [0278] 3) Place the slurry on a magnetic stirrer and mix as CNBr (Sigma) is added. [0279] 4) Add 100 mg/ml of slurry CNBr i.e. in 40 ml of slurry add 4 g of CNBr, immediately check the pH and monitor till the CNBr has fully dissolved you may need to add 1-2 ml of 10M NaOH to keep pH between 10.5 and 11 units. Monitor the pH as reaction proceeds for 15 minutes. [0280] 5) After 15 minutes or once the pH becomes static the reaction is complete. Block any remaining active CNBr by adding equal volume of 200 mM NaHCO.sub.3 at pH8.5. [0281] 6) Using a Buchner funnel filter the slurry and wash 350 ml with 100 mM NaHCO.sub.3500 mM NaCl at pH8.5. [0282] 7) Resuspend in a total volume 25 ml of 100 mM NaHCO.sub.3 500 mM NaCl at pH8.5 buffer [0283] 8) Take 250 l of 5tag oligonucleotide at 100 M with NH.sub.2-linker on 5 end and mix with the slurried agarose, mix for 2 h at room temperature [0284] 9) Add equal volume (25 ml) of 0.2M Glycine to block any remaining active CNBr biding sites. [0285] 10) Filter the slurry and wash with 100 ml of 100 mM NaHCO.sub.3 500 mM NaCl at pH8.5 buffer, then wash with 100 ml of water air dry and collect gel and weigh (note this material can be kept for storage by adding 0.1% Sodium Azide, alternatively it can be freeze dried and stored at RT for long term usage. If adding azide, the slurry to be must be filtered and washed to remove azide before usage. [0286] 11) This is approximately 40% agarose and is saturated with 5 tag oligonucleotide crosslinked via the amine linker at this stage and can be used later to produce hydrogel matrix. A small aliquot (100 l is taken and assayed to check it still melts at roughly 75 C. and sets solid below 20 C. to check crosslinking has not adversely affected gelling properties.

3) Tagging the Compound Library (Chemical Method)

[0287] The exact nature of this reaction will depend on the library in question and the functional groups contained within, but in this example the library is heavily functionalised with amino groups. The barcoded oligonucleotide is then functionalised at the terminal end with a succinimidyl ester. The barcoded oligonucleotide is functionalised with a cleavable group in order to release the compound within the droplet. [0288] (1) Dissolve the individual library members in 0.1 M sodium bicarbonate buffer, pH 8.3 to a final concentration of 1 mM. [0289] (2) Add succinimidyl ester functionalised guide oligonucleotide to the individual wells to achieve a 1:1 molar ratio. Ensure only one specific sequence is added to each individual well. [0290] (3) Incubate for one hour at room temperature [0291] (4) Warm the solution to 40 C. [0292] (5) Dilute the stock of beads from step 3 and load into the well. Aim to load at least 100 beads/well to ensure oversampling during the screening process. [0293] (6) Incubate at 40 C. to hybridise the tagged compound to the beads. [0294] (7) Spin down remove the supernatant from each well. Wash three times with 1PBS buffer. [0295] (8) Wash the beads out of the wells using 1PBS buffer. Pool together, then resuspend in fresh 1PBS.

4) Tagging the Compound (Enzymatic Method)

[0296] Again the exact nature of this reaction and functional groups, essentially any suitable enzyme can be used including glycosylases, none ribosomal peptide synthase, ubiquitinase, and phosphorylases to name a few. In this description we use a phosphorylase enzyme.
Dissolve the compound in water or DMSO to 0.5 mM (no more than 2.5 L if in DMSO): [0297] (1) 5 l of 10 reaction buffer (final is 70 mM Tris-HCl, 10 mM MgCl.sub.2, 5 mM DTT pH 7.6 @ 25 C. [0298] (2) 10 l 50% (w/v) PEG-4000 (finale concentration 10%) [0299] (3) 2.5 l 10 mM ATP (Final concentration 500 M) [0300] (4) 5 l T4 PNK (New England Biolabs) [0301] (5) Make up to 50 l with water

Incubate at 37 C. for 4 h

[0302] Random tags are purchased from Twist Bioscience comprising 100,000-1,000,000 unique sequences 18-25mers with a Tm>55 C., to each is added a 5 DNA_Adaptor1 oligonucleotide and 3 RNA_Adaptor1 oligonucleotide each is modified to ensure addition to specific end. This reaction ligates the barcode together.

Make the following mix for 200 [0303] (1) 20 l 10 Buffer (1 Reaction Buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT) [0304] (2) 100 l 50% PEG 8000 (w/v) (125% (w/v) PEG 8000) [0305] (3) 20 l 10 mM hexamine cobalt chloride (11 mM hexamine cobalt chloride) [0306] (4) 20 l (100 units) T4 RNA Ligase (New England Biolabs) [0307] (5) 20 l 10 mM ATP (11 mM ATP) (Sigma) [0308] (6) 20 l oligonucleotide mix (equal mix of the random barcode oligonucleotides and the RNA and DNA adaptor at 30 M each in water)
Incubate at 25 C. for 16 hours.
Stop the reaction by adding 40 l 10 mM Tris-HCl pH 8.0, 2.5 mM EDTA.

TABLE-US-00003 Oligo.name Oligo.sequence 5 modification 3 modification 5 ATTATGACCGTAGGCCTTGGC None None DNA_Adaptor1 3 CGCGATATTAGCCATTAA phosphorylated None RNA_Adaptor1 CCC Barcodeoligo. Variable18-25mers Phosphorylated None [0309] 1) Make up 300 l with 10 mM Tris, 1 mM EDTA pH7 buffer and clean up reaction using an illustra S-200 microspin HR column (GE Healthcare) to eliminate unligated oligonucleotides and reagents. [0310] 2) Add 40 l of sodium acetate pH5.2 and 2.5 volumes (1 ml) of 100% ethanol. Mix and put at 20 C. for at least 1 hour and then pellet DNA by centrifugation at 15,000 rpm for 15 minutes at 4 C. [0311] 3) Remove supernatant and wash with 1 ml of 70% ethanol and spin for 5 minutes, repeat the wash and then air dry the pellet [0312] 4) Resuspend the pellet in 25 l of nuclease free water

5) Attaching the Compound to the Beads

[0313] 1) To above compound add 50 l of generic attachment beads with NHC.sub.12-GGGTTAATGGCTAATATCGCG oligonucleotide (as described in Example 3, section 2).

6) Phenotypic Screening

[0314] As described in Example 1, section 6.

7) Sequencing Targets to Identify Hit Compounds

[0315] As described in Example 1, section 7.

EXAMPLE 4SPLIT-POOL METHOD FOR TAGLESS DECL SYNTHESIS

[0316] The widely-used split-and-pool strategy (see e.g. Mannocci et al. (2011) Chem. Commun., 47: 12747-12753; Mannocci et al. (2008) Proc. Natl. Acad. Sci. 105: 17670-17675) can be used to generate a single-pharmacophore DECL for use according to the invention based on the stepwise split-&-pool combinatorial assembly of multiple sets of chemical substructures and corresponding DNA-coding fragments involving iterative chemical synthesis and DNA encoding steps, as described below.

1) Overview

[0317] Referring now to FIG. 1, guide oligonucleotide is first attached to functionalised agarose beads, each bead containing at least 10.sup.11 functional groups for oligonucleotide attachment. A tagged substructure (which may be referred to herein as a pharmacore) is linked via a cleavable linker to an oligonucleotide complementary to the guide oligonucleotide and then attached to the guide oligonucleotide by ligation. This serves as the primary pharmacore which is then decorated with further pharmacores (secondary, tertiary, etc pharmacores), as explained below).

[0318] Consecutive rounds of synthesis are then carried out to decorate the primary pharmacore substructure by reaction with further substructures/pharmacores. A coding oligonucleotide for each reaction and building block is also added to the guide oligonucleotide by ligation. The library is constructed using a split and pool technique with alternative rounds of chemical synthesis and coding ligation. After library generation, each bead is decorated with multiple copies of a single compound.

[0319] Referring now to FIG. 2, the library beads are then encapsulated inside microdroplets with indicator cells (a protein target could also be used). The compound is released by addition of enzymes that cleave the cleavable linker within the droplet releasing the compound into the aqueous interior. The droplets are then incubated for a predetermined period and the phenotypic effect of the compound determined using FACS. Droplets in which the cells show the desired phenotypes are sorted and collected. The oligonucleotide that encodes the library member synthesis is therefore spatially, but not physically linked to the phenotypic effect it causes.

[0320] Compound identification is carried out by cleaving the guide oligonucleotide by restriction digestion from the bead followed by sequencing. The coding sequence of oligonucleotide describes the synthetic steps that pharmacore was exposed to and the structure of the compound responsible for the phenotypic effect observed by FACS. PCR amplification of the guide oligonucleotide is not needed as >10.sup.10 oligonucleotide molecules are present, although PCR can be used to amplify if required.

[0321] This tagged library synthesis retains the key advantages of DNA encoding (barcodIng) and scale of synthesis, yet allows the synthesis of molecule libraries using small number of relatively expensive tagged chemical substructures. It also reduces any scar to that arising from a single cleavage event. The split and pool method therefore allows diverse pharmacore addition utilising known chemistry, since there is no need for all the pharmacore substructure units to be tagged.

2) Functionalisation of Agarose Amine Beads

[0322] A 2 mL aliquot of a 50% suspension of amine functionalised agarose beads (Cube Bioscience) was spun down at 500g for 10 mins and washed 3 with RO water, then suspended in 5 mL of 100 mM MES+150 mM NaCl coupling buffer, pH 5.5. In separate tubes, an azide functionalisation mix was prepared. 2.5 mL of a 20 mM solution of N-hydroxysucciminde (NHS, Sigma Aldrich) and 2.5 mL of a 20 mM solution of N-(3-Dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC, Sigma Aldrich), both in coupling buffer, were mixed. 2-Azidoacetic acid (5 Carbosynth) was added, and this mix was left to react for 20 mins at room temperature. After 20 mins, the amine beads were spun down and resuspended in 5 mL of the azide functionalisation mix. The tube was placed on a rotator for one hour at room temperature, then spun down and resuspened in 5 mL of fresh azide functionalisation mixture. This was placed on a rotator and allowed to react overnight. The beads were then washed with 35 mL of 1PBS, pH 7.4, then resuspended in 5 mL of 100 mM sodium hydrogen carbonate pH 7.5 and stored at 4 C. until needed.

3) Attachment of Capture Oligonucleotide to Functionalised Azide-Agarose Beads

[0323] 1 mL of the azide bead stock was spun down and washed with 3 with 1 mL of 100 mM MOPS, pH 7.0. The beads were then suspended in 785 L of MOPS buffer. 100 uL of capture oligonucleotide (5-GAAGGGTCGACTAAG ATTATACTGCATAGCTAGGGGAATGGATCCCGCC TTTTTTT(Int 5-Octadiynyl Du)TTTTTTTTT GGCGGGATCC-3, ADTbio, 48.92 M) was added, followed by 10 L of a 50 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, Sigma Aldrich), 5 L of a 20 mM solution of copper (II) sulphate (Sigma Aldrich) and 100 L of a 10 mM solution of sodium ascorbate (Sigma Aldrich). The beads were placed on a rotator and left to react overnight, then the mix was spun down and washed with 1 mL 100 mM MOPS buffer, then resuspended in 758 L MOPS buffer, 100 L of 10 mM Propargyl alcohol (Sigma Aldrich), followed by 10 L of a 50 mM THPTA, 5 L of a 20 mM solution of copper (II) sulphate and 100 L of a 10 mM solution of sodium ascorbate. After one hour, the beads were washed with 31 mL of MOPS buffer, then resuspended in 100 mM sodium hydrogen carbonate buffer, pH 7.5.

4) Ligation of Cleavable Oligonucleotide with Primary Pharmacore

[0324] 1 ml of the azide agarose beads+capture oligonucleotide was spun down and washed 3 with 500 L of nuclease free water (NFW) before being resuspended in 475 L of NFW and 500 uL 2 Quick Ligase Buffer (NEB). 15 L of the payload oligonucleotide was added (5ATTCCCCTAGCTATGCAAGTrGrArGRrArArGrUX3, Where X=hexynyl hydrodroxyprolinol, ADTbio, 81.53 M) with 10 L Quick Ligase. The beads were incubated with rotation at 37 C., then washed 3 with 100 mM sodium hydrogen carbonate buffer, pH 7.5 and stored at 4 C. until needed.

5) Tagging

[0325] Tagging by ligation of encoding oligonucleotides to the capture oligonucleotide on beads was performed by washing the beads into water (centrifuge beads at 5000 g, 5 minutes, resuspend in 5 bead volumes of nuclease free water (NFW) repeat wash for a total of 2 times. The beads then resuspended in 5 bead volume of ligation mixture which has a final concentration of 1 Quick ligase buffer (New England Biolabs), 250 nM Splint oligonucleotide, 250 nM encoding oligonucleotide, 20 U/l T4 DNA ligase (New England Biolabs) and then nuclease free water to 5 bead volume).

[0326] To test ligation efficiency and maximise efficiency of ligation, the samples split into two. One sample was heated to 95 C. for 2 minutes then cooled to 4 C. in thermal cycler at 0.2 C./second. The other was sample was not heat treated and left at room temperature. T4 DNA ligase (20 U/l) was added after the heat step.

[0327] Both reactions were incubated for 1 h at 37 C. to allow ligation to proceed. Once incubated the ligase was heat inactivated by heating to 95 C. for 20 minutes then the oligonucleotide was cut from the beads using 20 U/l BamHI (NEB) and incubated for 1 h further at 37 C. Beads were pelleted by centrifugation (5000 g, 5 minutes) and then supernatant taken off. This DNA cute from the beads was precipitated for examination by adding 0.1 volume of 3M Sodium acetate at pH5.2 and 2.5 volumes of 100% ethanol. This was then incubated on ice for 1 h and the precipitated material pelleted by centrifugation 17,000 g 20 minutes, decant supernatant and wash 2 with 500 l 70% ethanol. The pellet was then air dried and resuspended in 100 l of nuclease free water. 25 l of this was then mixed 1:1 with denaturing loading dye (95% formamide, 0.1% xylene cyanol, 0.1% Bromphenol Blue, 20 mM Tris-HCl pH 7.5) samples were boiled 95 C. 2 minutes then to 4 C. at 4 C./s cooling rate. The precipitated samples were then loaded onto a denaturing TBE-gel (12.5% polyacrylamide, 7M UREA). Run at 150V, 45 minutes at room temperature. Once run the gel was washed 2 in milliQ grade water to remove urea, then stained with 1SyBr gold (thermoscientific) DNA stain in 1TBE for 20 minutes before washing again 2 with water to remove staining solution.

[0328] The gels were then imaged using a Syngene InGenius3 gel doc system (FIG. 3). It can be seen that when all reagents are present ligation occurs, but this is more efficient when using a heat stepalthough this is not required for ligation to occur at reasonable levels as we have multiple copies of each DNA on a synthesis vesicle.

6) Release of Chemical Structure from Encoding Tag

[0329] The encoding oligonucleotide tag is removed by cleaving payload from the oligonucleotide.

[0330] Referring now to FIG. 4, to show cleavage of the linker and release of the pharmacore oligonucleotides were made which incorporated a fluorophore (FITC, shown as F in FIG. 4) 5 to the cleavable linker within the sequence of the cleavable oligonucleotide. A quencher molecule, BHQ-1, was then attached to the cleavable linker. This can be released by cleavage in the same manner as any chemical structure used in library generation. Light up of the oligonucleotide is seen when the quencher is removed from the cleavable linker.

[0331] Three different enzymes have been identified which cleave their associated linkers in a scarless manner (RNase A, RNase T1 A and RNase 1 A; labelled as enzymes A, B and C respectively in FIG. 4). All 3 were tested with their compatriot linkers. In each case 10 l reactions were set up; 10 mM Tris-HCl, 1 mM EDTA, 150 nM cleavable oligonucleotide 0.1 l of stock enzyme (RNase A=10 mg/ml, RNase T1=10 mg/ml RNase 1=1.5 mg/ml) then to 10 l with nuclease free water. Samples were incubated for 15 minutes at 37 C. and then 104, denaturing loading dye added (95% formamide, 0.1% xylene cyanol, 0.1% Bromphenol Blue, 20 mM Tris-HCl pH 7.5). Samples were boiled for 2 minutes at 95 C. and then rapidly cooled to 4 C. at 4 C./s. These samples were then loaded onto a denaturing TBE-gel (12.5% polyacrylamide, 7M Urea). The gel was run at 150V for 75 minutes and the imaged using a Syngene Ingenius3 system exciting the FITC. Release of the quencher means the fluorophore can be seen and imaged as light up. This is seen as appearance of yellow DNA band in the presence of enzyme. By staining with SyBr gold (Thermo) DNA can be seen and this is again quenched when quencher is present but the size shift corresponding to the change in mass can be seen as well as increased signal (grey scale image below fluorophore, FIG. 4). In both cases we can see release only occurs in the presence of the enzymes and is rapid (<15 minutes). Additionally the enzymes are very active 10-fold serial dilutions of the enzymes were performed in 10 mM Tris-HCl pH 7.5, 1 mM EDTA and the reactions set up in the same manner. After dilution of the enzyme from 10.sup.2 to 10.sup.5, we can see activity at 10.sup.4 for RNase A and 10.sup.3 for RNase T1 and RNase 1. This means there is a large window of enzyme activity and that the process can occur in less than 30 minutes at 10.sup.4 dilutions for multiple enzymes.

[0332] We also confirmed that the enzymes function in the droplet environment (see FIG. 5). Results are shown for RNase A. 1 ml of aqueous phase was set up using 10 mM Tris-HCl, 1 mM EDTA, 150 nM cleavable oligonucleotide 10 l of stock RNase A (10 mg/ml) then to lml with nuclease free water. Droplets of 100 M mean diameter were made using a 100 m etch depth chip with the aqueous phase as described above and the oil phase comprising of PSF-2 cST oil (Clearco Products Inc.) with 2% w/v Gransurf G67 (Grant Industries Inc.) Droplets were incubated with and without enzyme at 37 C. for 15 minutes and them imaged under a Floid fluorescence microscope illuminating at 482/18 nm and emission filters of 532/59 nm. It can be seen that light up occurs in droplets in the presence of enzyme and that the reaction is not affected by droplet environment.

7) Functionalisation of a Cleavable Chemical Structure Payload Using Huisgen 1,3-Dipolar Cycloaddition and Thiourethane Formation

[0333] Two 100 L portions of the beads functionalised with cleavable linker and core payload (hexynyl hydrodroxyprolinol) were washed three times with 100 mM MOPS pH 7.0 and resuspened in 100 L of the same. To both portions 2 uL of a 10 mM stock of 5-FAM-azide (Jena Bioscience) in DMSO was added. One portion was kept as an unreacted negative control, to the other portion was added 5 L of a 50 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, Sigma Aldrich), 2.5 L of a 20 mM solution of copper (II) sulphate (Sigma Aldrich) and 100 L of a 10 mM solution of sodium ascorbate (Sigma Aldrich). A further sample containing beads functionalised with only the capture oligonucleotide (no cleavable linker or functional core) was also treated in the same way. The beads were placed on a rotator and left to react overnight, then the mix was spun down and washed with 1 mL 100 mM MOPS buffer pH 7.0.

[0334] In order to confirm functionalisation, the functionalised payload was cleaved off the bead samples by suspending in 30 L of NEB buffer 3.1, 10 L BamH1 with 260 L of nuclease free water. After incubation at 37 C. for one hour, the sample was split into 2150 portions. 5 L of RNase A was added, and the sample was incubated for a further one hour at 37 C., then the beads were pelleted. The supernatant was transferred to a clean tube and 15 of 3M sodium acetate at pH 5.2 and 375 L of 100% ethanol were added. The sample was left to precipitate overnight at 20 C., then pelleted, washed with 500 uL of 70% ethanol and air dried for 20 mins. The pellet was resuspened in 20 uL of nuclease free water, 20 L of denaturing loading dye was added (95% formamide, 0.1% xylene cyanol, 0.1% Bromphenol Blue, 20 mM Tris-HCl pH 7.5). The sample was heated for five minutes at 95 C. then cooled to 4 C. The samples were loaded onto a TBE urea gel and ran at 100 V for 75 mins.

[0335] As shown in FIG. 6, a free dyed component is visible in the sample treated with both the ligated cleavable linker, functional core and dye, indicating a functionalised and released core rather than the presence of free 5-FAM azide, which would be present in the unligated sample.

[0336] Separately, two further 100 L portions of the functionalised beads were washed three times with dry acetonitrile (MeCN, Sigma Aldrich). One portion was suspended in 1 mM fluorescein isothiocyanate isomer 1 (Sigma Aldrich) in MeCN, along with 0.6 L of a 10 mg/mL solution of triethylene diamine (Sigma Aldrich) in MeCN. After rotating overnight at 37 C., the beads were washed 3 with MeCN, then 3 with 100 mM sodium hydrogen carbonate buffer, pH 7.5 In order to confirm functionalisation, the samples were cleaved enzymatically as described above and run on a TBE gel. The gel was imaged using a Syngene InGenius3 gel doc system to observe the fluorophore, then stained with 50 L of 1Sybr gold in TBE. A second image was then recorded.

[0337] As shown in FIG. 7, an intense signal is seen in the digested sample treated with RNase A compared to the no dye control, indicating functionalisation of the cleaved compound.

8) Construction of a Functional Library of 100 Members on Beads with Tagging Using a Split and Pool Methodology

[0338] A stock of azide functionalised beads was functionalised with capture oligo as described in section 3, example 4. This stock of beads was then ligated with a cleavable oligo bearing a cleavable payload (5ATTCCCCTAGCTATGCAAGTrGrArGRrArArGrUX3, where X=3-(O-Propargyl)-adenosine) (ADTBio), using the same technique as described in Example 4 (section 4). The number of beads was measured to be 5.610.sup.6 beads/mL by haemocytometer. 200 L of this stock was added to ten separate wells of a deep 96 well plate (Fisher). In the following description, all stock solutions were made up in 100 mM MOPS pH 7.0, unless otherwise stated. The plate was centrifuged and 140 L of 100 mM MOPS pH 7.0, 100 mM, was added to each occupied well, followed by 20 L of a 50 mM stock of Tris(3-hydroxypropyltriazolylmethyl)amine (Sigma-Aldrich) and 10 L of a 20 mM stock of 20 mM copper (II) sulfate (Sigma-Aldrich).

[0339] One of ten individually selected azides (10 L of a 50 mM DMSO, Enamine) was added to each separate occupied well. 20 L of a 100 mM stock of sodium ascorbate (Sigma-Aldrich) was added and the plate was sealed using a peaceable sealing cap (Fisher). The plate was incubated at room temperature with shaking for 18 hours. The plate was then centrifuged and each occupied well was washed with 31 mL of nuclease free water (NFW, Fisher), then resuspended in 250 L of Quick Ligase Buffer 2 (NEB).

[0340] 200 L of a 50 mM stock of a coding oligo comprising the sequence GAAGGGTCGACTCCGXXXXXXXXXXGATGGGCATCATCCT, where XXXXXXXXX=represents a random sequence of nucleotides (A, C G or T) chosen from a selection of 20 unique coding oligos, each from Integrated DNA Technologies (IDT) was added to each well. 50 L of a 100 uM splinting oligo (CTT AGT CGA CCC GGC AGG ATG ATG CCC AT/3ddC/, /3ddC=dideoxycytidine, IDT) was added along with 2.5 L of Quick Ligase (NEB). The plate was sealed and incubated with shaking at 37 C.

[0341] Each individual population of beads across 10 wells was now encoded with a unique DNA sequence associated with a specific azide, enabling the building blocks used to be tracked after screening to determine the structure of any compound. After two hours incubation, each well was washed with 31 mL of NFW and resuspended in 200 L of 200 mM sodium acetate, pH 5.5. The contents of each well was then combined together as a 2 mL mixed pool in a 15 mL centrifuge tube and thoroughly mixed by vortexing, before being split in 200 portions in 10 separate wells on a new deep 96 well plate. The plate was centrifuged and the beads resuspened in 190 L of 200 mM sodium acetate pH 5.5. A stock of one of ten individually selected aldehydes (83 L of 50 mM DMSO stock, Enamine) was added to the individual wells. 26 L of a 10 mg/mL stock of sodium cyanoborohydride in 200 mM sodium acetate pH 5.5 (sigma Aldrich) was then added to each occupied well. The plate was sealed and incubated with shaking for 18 hours at room temperature. All wells were washed 31 mL with nuclease free water, then resuspened in 250 L of quick ligase buffer, and each well was ligated with a unique coding oligo using the same process as previous described for the azide block. Each well was then washed with 31 mL of NFW and resuspened in 200 L nuclease free water, before being pooled into a 2 mL stock in a 15 mL centrifuge tube. The beads were pelleted and resuspened in 200 L 2 Quick Ligase buffer. 200 L of a 100 uM stock of oligo with the sequence CGGGTCGACTTCGGTTAGACTTTCGGACCTGATGGGCATCATCCT was added, along with 10 uL of Quick Ligase (New England Biolabs). The beads were then incubated at 37 C. for two hours with rotation, then washed 3 with 1 mL of 10 mM Tris HCl+1 mM EDTA pH 7.5. The beads were resuspened in 1 mL of the Tris buffer then stored at 4 C. until needed.

EQUIVALENTS

[0342] The foregoing description details presently preferred embodiments of the present invention. Numerous modifications and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these descriptions. Those modifications and variations are intended to be encompassed within the claims appended hereto.