Fc-binding protein having improved antibody separation ability, and method for separating antibody using same

11542301 · 2023-01-03

Assignee

Inventors

Cpc classification

International classification

Abstract

The present application addresses the problem of providing an Fc-binding protein having an improved antibody separation ability. The present application also addresses the problem of providing a high-accuracy antibody separation method using an insoluble carrier having the protein immobilized thereon. The problems can be solved by: an Fc-binding protein in which at least an amino acid substitution at a specific position therein occurs and which has reduced affinity for an antibody; and an antibody separation method including allowing an equilibration buffer solution to pass through a column in which an insoluble carrier having the protein immobilized thereon is filled to equilibrate the column, adding a solution containing an antibody to cause the adsorption of the antibody onto the carrier, and eluting the antibody adsorbed on the carrier using an elution solution.

Claims

1. An Fc-binding protein comprising amino acid residues at positions 33 to 208 of the amino acid sequence set forth in SEQ ID NO: 9.

2. A method for separating an antibody, comprising: adding an equilibration solution to a column which is filled with an insoluble carrier having the Fc-binding protein according to claim 1 immobilized thereon so as to equilibrate the column; adding a solution containing an antibody to cause the antibody to be adsorbed on the carrier; and eluting the antibody adsorbed on the carrier using an elution solution.

3. The separation method according to claim 2, further comprising isolating a fraction containing the eluted antibody.

4. The separation method according to claim 2, wherein the equilibration solution is a buffer containing an inorganic salt at pH 4.5 to pH 5.8.

5. A method for monitoring culture progress of an antibody-producing cell and/or a produced antibody, comprising: obtaining an antibody-producing cell by transfecting a host cell with an antibody expression vector; culturing the antibody-producing cell; obtaining an antibody from the culture medium and/or cultured cells; and separating the obtained antibody by the method according to claim 2.

6. A method for monitoring time-dependent changes in a sugar chain structure pattern of an antibody, comprising: obtaining an antibody-producing cell by transfecting a host cell with an antibody expression vector; culturing the antibody-producing cell; obtaining an antibody from the culture medium and/or cultured cells; and separating the obtained antibody by the method according to claim 2.

7. A method for producing an antibody, comprising optimizing culture conditions for an antibody-producing cell based on the results of monitoring by the method according to claim 6 such that the cell produces an antibody having a desired sugar chain structure.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 schematically illustrates human FcγRIIIa. The numerals in FIG. 1 correspond to positions in the amino acid sequence set forth in SEQ ID NO: 1. In FIG. 1, S represents a signal sequence, EC represents an extracellular domain, TM represents a transmembrane domain, and C represents an intracellular domain.

(2) FIG. 2 depicts an elution pattern (chromatogram) when a monoclonal antibody was separated using a column filled with an insoluble carrier having the Fc-binding protein of the present invention (FcR9_F) immobilized thereon.

(3) FIG. 3 depicts an elution pattern (chromatogram) when a monoclonal antibody was separated using a column filled with an insoluble carrier having a conventional Fc-binding protein (FcR9) immobilized thereon.

(4) FIG. 4 depicts an elution pattern (chromatogram) when the pH of an equilibration buffer was set to 5.5 in Example 6.

(5) FIG. 5 depicts an elution pattern (chromatogram) when the pH of an equilibration buffer was set to 5.6 in Example 6.

(6) FIG. 6 depicts an elution pattern (chromatogram) when the pH of an equilibration buffer was set to 6.0 in Example 6.

(7) FIG. 7 is a graph indicating the results of measuring ADCC activity of a monoclonal antibody included in the isolated peaks in Example 7.

(8) FIG. 8 is a graph indicating temporal changes in the viable cell density by the number of days of culture of antibody-producing cells in Example 8.

(9) FIG. 9 is a graph indicating temporal changes in the cell viability by the number of days of culture of antibody-producing cells in Example 8.

(10) FIG. 10 is a graph indicating temporal changes in the antibody concentration (antibody production) by the number of days of culture of antibody-producing cells in Example 8.

(11) FIG. 11 is a chromatogram indicating the results of analysis of the culture solution containing an antibody using the FcR9_F column in Example 8.

(12) FIG. 12 is an enlarged view of the region between 10 minutes to 30 minutes of elution time (retention time) in the chromatogram in FIG. 11.

(13) FIG. 13 depicts chromatograms (elution time (retention time): region between 10 minutes to 30 minutes) indicating the results of analysis of the culture solution containing an antibody on different days of culture using the FcR9_F column in Example 8, the chromatograms having different peak forms by the number of days of culture.

(14) FIG. 14 depicts chromatograms (elution time (retention time): region between 5 minutes to 20 minutes) indicating the results of analysis of an antibody obtained from the culture solution on different days of culture using the FcR9_F column in Example 9, the chromatograms having different peak forms by the number of days of culture.

(15) FIG. 15 is a graph indicating temporal changes in the antibody concentration (open bar) and viable cell concentration (filled diamond) by the number of days of culture of the antibody-producing cells cultured in Example 9.

(16) FIG. 16 is a graph indicating proportions of constituents in the sugar chain structure of the antibody obtained by the number of days of culture in Example 9.

EXAMPLES

(17) Hereinafter, the present invention will be described in more detail with reference to the Examples below, but the present invention is not limited to these Examples.

Example 1 Preparation of FcR9 Amino Acid Substitution Product

(18) An amino acid substitution was introduced into an Fc-binding protein FcR9 (SEQ ID NO: 5) prepared in accordance with the method disclosed in WO2015/199154 as described below in order to confirm usefulness of a substitution of valine at position 192 (corresponding to valine at position 176 in wildtype human FcγRIIIa consisting of the amino acid sequence set forth in SEQ ID NO: 1) by a different amino acid. Specifically, an amino acid substitution was introduced into plasmid pET-FcR9 (WO2015/199154) including a polynucleotide (SEQ ID NO: 6) encoding FcR9 by PCR, thereby producing an Fc-binding protein having a substitution of valine at position 192 in FcR9 (SEQ ID NO: 5) by a different amino acid. FcR9 (SEQ ID NO: 5) is an Fc-binding protein including the wild-type FcγRIII extracellular domain set forth in SEQ ID NO: 4, which has an amino acid substitution of Val at position 43 by Glu (corresponding to position 27 of SEQ ID NO: 1), an amino acid substitution of Phe at position 45 by Ile (corresponding to position 29 of SEQ ID NO: 1), an amino acid substitution of Tyr at position 51 by Asn (corresponding to position 35 of SEQ ID NO: 1), an amino acid substitution of Gln at position 64 by Arg (corresponding to position 48 of SEQ ID NO: 1), an amino acid substitution of Phe at position 91 by Leu (corresponding to position 75 of SEQ ID NO: 1), an amino acid substitution of Asn at position 108 by Ser (corresponding to position 92 of SEQ ID NO: 1), an amino acid substitution of Val at position 133 by Glu (corresponding to position 117 of SEQ ID NO: 1), an amino acid substitution of Glu at position 137 by Gly (corresponding to position 121 of SEQ ID NO: 1), and an amino acid substitution of Phe at position 187 by Ser (corresponding to position 171 of SEQ ID NO: 1).

(19) Hereinafter, a method for producing the following Fc-binding proteins will be described in detail.

(20) (1) In order to confirm usefulness of a substitution of valine at position 192 (corresponding to position 176 in SEQ ID NO: 1) in the Fc-binding protein FcR9 (SEQ ID NO: 5) by a different amino acid, a reaction solution having the composition in Table 1 was prepared using plasmid pET-FcR9 (disclosed in WO2015/199154) including the polynucleotide (SEQ ID NO: 6) encoding FcR9 (SEQ ID NO: 5) produced by the method disclosed in WO2015/199154 as a template and oligoprimers consisting of the sequences set forth in SEQ ID NO: 2 (5′-TAATACGACTCACTATAGGG-3′) and SEQ ID NO: 7 (5′-CATTTTTGCTGCCMNNCAGCCCACGGCAGG-3′). Subsequently, the reaction solution was heat-treated at 95° C. for 2 minutes, and PCR was performed by a reaction of 30 cycles of a first step at 95° C. for 30 seconds, a second step at 50° C. for 30 seconds, and a third step at 72° C. for 90 seconds, followed by heat treatment at 72° C. for 7 minutes. The obtained PCR product was designated as V192p1.

(21) TABLE-US-00001 TABLE 1 Composition Volume Template DNA 2 μL 10 μM Forward primer 1 μL 10 μM Reverse primer 1 μL 5 × PrimeSTAR ® buffer 4 μL (manufactured by Takara Bio) 2.5 mM dNTPs 2 μL 2.5 U/μL PrimeSTAR ® HS 0.5 μL (manufactured by Takara Bio) H.sub.2O up to 20 μL

(22) (2) A reaction solution having the composition in Table 1 was prepared using plasmid pET-FcR9 (disclosed in WO2015/199154) including the polynucleotide (SEQ ID NO: 6) encoding FcR9 (SEQ ID NO: 5) produced by the method disclosed in WO2015/199154 as a template and oligoprimers consisting of the sequences set forth in SEQ ID NO: 3 (5′-TATGCTAGTTATTGCTCAG-3′) and SEQ ID NO: 8 (5′-CCTGCCGTGGGCTGNNKGGCAGCAAAAATG-3′). Subsequently, the reaction solution was heat-treated at 95° C. for 2 minutes, and PCR was performed by a reaction of 30 cycles of a first step at 95° C. for 30 seconds, a second step at 50° C. for 30 seconds, and a third step at 72° C. for 90 seconds, followed by heat treatment at 72° C. for 7 minutes. The obtained PCR product was designated as V192p2.

(23) (3) The two types of PCR products (V192p1, V192p2) obtained in (1) and (2) were mixed, thereby preparing a reaction solution having the composition in Table 2. The reaction solution was heat-treated at 98° C. for 5 minutes, and PCR was performed by a reaction of 5 cycles of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute, thereby obtaining a PCR product V192p in which V192p1 and V192p2 were joined to each other.

(24) TABLE-US-00002 TABLE 2 Composition Concentration/Volume PCR product 2 μL each 2.5 U/μL PrimeSTAR ® HS 0.5 μL (manufactured by Takara Bio) 5 × PrimeSTAR ® buffer 4 μL (manufactured by Takara Bio) 2.5 mM dNTPs 2 μL H.sub.2O up to 20 μL

(25) (4) PCR was performed using the PCR product V192p obtained in (3) as a template and oligonucleotides consisting of the sequences set forth in SEQ ID NOs: 2 and 3 as PCR primers. A reaction solution having the composition in Table 3 was prepared. Subsequently, the reaction solution was heat-treated at 98° C. for 5 minutes, and a reaction of 30 cycles of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute was performed. Accordingly, a polynucleotide encoding an Fc-binding protein having a substitution of an amino acid at position 192 in the Fc-binding protein (FcR9) by an optional amino acid was obtained. The obtained polynucleotide was designated as V192p3.

(26) TABLE-US-00003 TABLE 3 Composition Volume PCR product 2 μL 10 μM Forward primer 2 μL 10 μM Reverse primer 2 μL 5 × PrimeSTAR ® buffer 10 μL (manufactured by Takara Bio) 2.5 mM dNTPs 4 μL 2.5 U/μL PrimeSTAR ® HS 1 μL (manufactured by Takara Bio) H.sub.2O up to 50 μL

(27) (5) The polynucleotide obtained in (4) was purified, digested with restriction enzymes NcoI and HindIII, and ligated to an expression vector pETMalE (Japanese Unexamined Patent Publication (Kokai) No. 2011-206046) which was preliminarily digested with restriction enzymes NcoI and HindIII, and the resulting product was used for transforming E. coli strain BL21 (DE3).

(28) (6) The obtained transformant was cultured in an LB medium supplemented with 50 μg/mL kanamycin. Plasmids were extracted from the collected bacterial cells (transformants).

(29) (7) Regarding the polynucleotide encoding the Fc-binding protein and its surrounding region in each obtained plasmid, a cycle sequence reaction was performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (manufactured by Life Technologies Corporation) based on the chain terminator method, and the nucleotide sequence was analyzed by a fully automated DNA sequencer (Applied Biosystems 3130 Genetic Analyzer (manufactured by Life Technologies Corporation)). An oligonucleotide consisting of the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 3 was used as a sequencing primer upon the analysis. As a result of sequence analysis, transformants expressing Fc-binding proteins each having a substitution of Val at position 192 (position 176 of SEQ ID NO: 1) in the Fc-binding protein FcR9 (SEQ ID NO: 5) by one of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, and Tyr were obtained.

Example 2 Evaluation of IgG1-Binding Ability of Fc-Binding Protein

(30) (1) The each transformant expressing Fc-binding protein produced in Example 1 was inoculated in a 20 mL of a 2YT liquid medium supplemented with 50 μg/mL kanamycin and aerobically cultured with shaking overnight at 37° C., thereby performing preculture, respectively.

(31) (2) Each preculture solution in a volume of 10 mL was inoculated in 1000 mL of a 2YT liquid medium (peptone at 16 g/L, yeast extract at 10 g/L, sodium chloride at 5 g/L) supplemented with 50 μg/mL kanamycin and aerobically cultured with shaking at 37° C.

(32) (3) The culture temperature was changed to 20° C. 1.5 hours after the start of culture, followed by shaking culture for 30 minutes. Thereafter, isopropyl-β-thiogalactopyranoside (IPTG) was added to yield a final concentration of 0.01 mM, and shaking culture was continued aerobically overnight at 20° C.

(33) (4) After the end of culture, cells were collected by centrifugation, suspended in a buffer (20 mM Tris-HCL buffer containing 150 mM NaCl (pH 7.4)), and ultrasonically disrupted. Thereafter, the supernatant was collected by centrifugation.

(34) (5) The collected supernatant was allowed to pass through a column filled with Ni Sepharose® 6 Fast Flow (manufactured by GE Healthcare) and washed with a sufficient amount of a washing buffer (20 mM Tris-HCL buffer containing 150 mM NaCl (pH 7.4)), followed by elution with an elution buffer (20 mM Tris-HCl buffer containing 150 mM NaCl and 500 mM imidazole (pH 7.4)). Then, the elution fraction was collected.

(35) (6) The elution fraction collected in (5) was allowed to pass through a column filled with IgG Sepharose® 6 Fast Flow (manufactured by GE Healthcare) and washed with a sufficient amount of a washing buffer (20 mM Tris-HCl buffer containing 150 mM NaCl (pH 7.4)), followed by elution with an elution buffer (100 mM glycine buffer (pH 3.0)). Then, the elution fraction was collected.

(36) (7) IgG1-binding ability of each Fc-binding protein collected as the elution fraction in (6) was evaluated using the surface plasmon resonance method. Upon measurement of the binding ability using the surface plasmon resonance method, Biacore™ T100 (manufactured by GE Healthcare) was used as a measurement system, Sensor Chip CM5 (manufactured by GE Healthcare) was used as a sensor chip, and Biacore™ T100 Evaluation Software (manufactured by GE Healthcare) was used as analysis software.

(37) (8) A solution prepared by diluting IgG1 (manufactured by Sigma-Aldrich) with HBS-EP (manufactured by GE Healthcare) was supplied to a sensor chip on which each Fc-binding protein was separately immobilized using an Amine Coupling Kit (manufactured by GE Healthcare), thereby obtaining a sensorgram. Curve fitting was performed based on the sensorgram so as to calculate IgG1-binding ability.

(38) Here, it is generally known that when affinity between an Fc-binding protein and an antibody decreases, the ability of the Fc-binding protein to retain the antibody is weakened, and the capacity for adsorption is reduced. Meanwhile, in a column filled with an insoluble carrier (resin) having an Fc-binding protein immobilized thereon, when binding ability between the Fc-binding protein and an antibody is reduced, ability to retain the antibody when adding the antibody for elution is weakened. This allows elution while the binding force is lowered, thereby facilitating separation. As a result of calculation of affinity to the IgG1 antibody by the above-described method, it was found that among the produced Fc-binding proteins, a protein having an amino acid substitution of Val at position 192 of SEQ ID NO: 5 (corresponding to position 176 of SEQ ID NO: 1) by Phe (hereinafter referred to as “FcR9_F”) has lower antibody affinity than FcR9 (SEQ ID NO: 5) serving as a reference.

(39) The amino acid sequence of FcR9_F to which a signal sequence and a polyhistidine tag were added is set forth in SEQ ID NO: 9, and the polynucleotide sequence encoding the FcR9_F is set forth in SEQ ID NO: 10. In SEQ ID NO: 9, a MalE signal peptide ranges from methionine (Met) at position 1 to alanine (Ala) at position 26, a linker sequence ranges from lysine (Lys) at position 27 to methionine (Met) at position 32, the amino acid sequence of FcR9_F (corresponding to a region from position 17 to position 192 of SEQ ID NO: 1) ranges from glycine at position 33 (Gly) to glutamine at position 208 (Gln), a linker sequence ranges from glycine (Gly) at position 209 to glycine (Gly) at position 210, and a tag sequence ranges from histidine (His) at position 211 to histidine (His) at position 216. In addition, phenylalanine of Val192Phe is located at position 192 of SEQ ID NO: 9.

(40) Table 4 lists the results of calculating affinity to IgG1. In Table 4, the lower the KD value (dissociation constant) means the higher the affinity. It is understood that FcR9_F (SEQ ID NO: 9), which is an Fc-binding protein having an amino acid substitution of Val192Phe, has a higher dissociation constant, i.e., lower affinity to an antibody, compared to FcR9 (SEQ ID NO: 5) lacking the substitution. Accordingly, it is suggested that when an antibody is separated by a method including a step of adding a solution containing an antibody to a column filled with an insoluble carrier having the Fc-binding protein immobilized thereon so as to allow the carrier to adsorb the antibody and a step of eluting the antibody adsorbed by the carrier using an elution solution, the antibody can be separated with a high degree of separation and high efficiency using, as the Fc-binding protein, a protein having at least an amino acid substitution of Val192Phe in the Fc-binding protein FcR9 (SEQ ID NO: 5) disclosed in WO2015/199154 because affinity to the antibody is lowered as compared to when using FcR9.

(41) TABLE-US-00004 TABLE 4 Fc-binding protein Association Dissociation Dissociation Substitution rate constant rate constant constant Name position ka [1/Ms] kd [1/s] K.sub.D [M] FcR9 (Reference) 4.05 × 10.sup.5 3.13 × 10.sup.−2 7.73 × 10.sup.−8 FcR9_F Val192Phe 9.02 × 10.sup.4 3.01 × 10.sup.−1 3.28 × 10.sup.−6

Example 3 Production of Fc-Binding Protein of Invention (FcR9_F_Cys) Having Cysteine Tag Added

(42) (1) PCR was performed using an expression vector pET-FcR9_F including the polynucleotide set forth in SEQ ID NO: 10 encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9 produced in Example 2 as a template. Primers used in the PCR were oligonucleotides consisting of the sequences set forth in SEQ ID NO: 11 (5′-TAGCCATGGGCATGCGTACCGAAGATCTGCCGAAAGC-3′) and SEQ ID NO: 12 (5′-CCCAAGCTTATCCGCAGGTATCGTTGCGGCACCCTTGGGTAATGGTAATATTCACGG TCTCGCTGC-3′). A reaction solution having the composition in Table 3 was prepared. Subsequently, the reaction solution was heat-treated at 98° C. for 5 minutes, and PCR was performed by a reaction of 30 cycles of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute.

(43) (2) The polynucleotide obtained in (1) was purified and digested with restriction enzymes NcoI and HindIII, and ligated to an expression vector pTrc-PelBV3 produced by the method disclosed in WO2015/199154, which was preliminarily digested with restriction enzymes NcoI and HindIII. E. coli strain W3110 was transformed using the ligation product.

(44) (3) After the obtained transformant was cultured in an LB medium containing 100 μg/mL carbenicillin, an expression vector pTrc-FcR9_F_Cys was obtained using a QIAprep Spin Miniprep kit (manufactured by QIAGEN).

(45) (4) The nucleotide sequence of pTrc-FcR9_F_Cys was analyzed in the same manner as in Example 1 (7) except that an oligonucleotide consisting of the sequence set forth in SEQ ID NO: 13 (5′-TGTGGTATGGCTGTGCAGG-3′) or SEQ ID NO: 14 (5′-TCGGCATGGGGTCAGGTG-3′) was used as a sequencing primer.

(46) The amino acid sequence of a polypeptide expressed in the vector pTrc-FcR9_F_Cys is set forth in SEQ ID NO: 15, and the sequence of a polynucleotide encoding the polypeptide is set forth in SEQ ID NO: 16. In SEQ ID NO: 15, an improved PelB signal peptide ranges from methionine (Met) at position 1 to alanine (Ala) at position 22, the amino acid sequence of the Fc-binding protein FcR9_F (corresponding to a region from position 33 to position 208 of SEQ ID NO: 9) ranges from glycine (Gly) at position 24 to glutamine (Gln) at position 199, and a cysteine tag sequence ranges from glycine (Gly) at position 200 to glycine (Gly) at position 207.

Example 4 Preparation of FcR9_F_Cys

(47) (1) The transformant expressing FcR9_F_Cys produced in Example 3 was inoculated in 400 mL of a 2YT liquid medium (peptone at 16 g/L, yeast extract at 10 g/L, sodium chloride at 5 g/L) containing 100 μg/mL carbenicillin in a 2-L baffled flask and aerobically cultured with shaking overnight at 37° C., thereby performing preculture.

(48) (2) The culture solution of (1) in a volume of 180 mL was inoculated in 1.8 L of a liquid medium containing glucose at 10 g/L, yeast extract at 20 g/L, phosphate trisodium dodecahydrate at 3 g/L, hydrogen phosphate disodium dodecahydrate at 9 g/L, ammonium chloride at 1 g/L, and carbenicillin at 100 mg/L, and main culture was performed using a 3-L fermenter (manufactured by Biott Corporation). Main culture was initiated under conditions set as follows: 30° C., pH 6.9 to 7.1, an airflow rate of 1 VVM, and a saturated dissolved oxygen concentration of 30%. For pH control, 50% phosphoric acid was used as an acid, and 14% ammonia water was used as an alkali, dissolved oxygen was controlled by changing the stirring rate, and the lower and upper limits of the number of rotations of stirring were set to 500 rpm and 1000 rpm, respectively. At a time point when the glucose concentration became unmeasurable after the start of culture, a feed medium (glucose at 248.9 g/L, yeast extract at 83.3 g/L, magnesium sulfate heptahydrate at 7.2 g/L) was added while controlling dissolved oxygen (DO).

(49) (3) When the 600-nm optical density (OD 600 nm) serving as an indicator of the amount of bacterial cells reached about 150, the culture temperature was decreased to 25° C., and it was confirmed that the temperature reached the preset temperature. Subsequently, IPTG was added to yield a final concentration of 0.5 mM, and culture was continued at 25° C.

(50) (4) Culture was terminated about 48 hours after the start of culture, and the culture solution was centrifuged at 4° C. and 8000 rpm for 20 minutes, thereby collecting bacterial cells.

(51) (5) The collected bacterial cells were suspended in a 20 mM Tris-HCl buffer (pH 7.0) to yield a concentration of 5 mL/1 g (of bacterial cells), and the bacterial cells were disrupted using an ultrasonicator (Insonator 201M (trade name), manufactured by KUBOTA Corporation co., ltd.) at 4° C. and an output power of about 150 W for about 10 minutes. A solution of the disrupted bacterial cells was centrifuged twice at 4° C. and 8000 rpm for 20 minutes, thereby collecting the supernatant.

(52) (6) The supernatant obtained in (5) was applied to VL 32×250 Column (manufactured by MERCK MILLIPORE) filled with 140 mL of TOYOPEARL CM-650M (manufactured by Tosoh Corporation) which was preliminarily equilibrated with a 20 mM phosphate buffer (8 mM sodium dihydrogen phosphate, 12 mM disodium hydrogen phosphate) (pH 7.0) at a flow rate of 5 mL/min. After washing with the buffer used for equilibration, elution was performed using 20 mM phosphate buffer (pH 7.0) containing 0.5 M sodium chloride.

(53) (7) The eluate obtained in (6) was applied to an XK 26/20 Column (manufactured by GE Healthcare) filled with 90 mL of IgG Sepharose® (manufactured by GE Healthcare) which was preliminarily equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride. After washing with the buffer used for equilibration, elution was performed using 0.1 M glycine-HCl buffer (pH 3.0). The pH of the eluate was adjusted to a neutral range with the addition of 1 M Tris-HCl buffer (pH 8.0) in an amount one-fourth the amount of the eluate.

(54) As a result of the purification, about 20 mg of high-purity FcR9_F_Cys was obtained.

Example 5 Preparation of Fc-Binding Protein (FcR9_F)-Immobilized Gel and Antibody Separation

(55) (1) After activation of hydroxyl groups on the surface of a hydrophilic vinyl polymer for a separating resin (manufactured by Tosoh Corporation: TOYOPEARL) in a volume of 2 mL with iodoacetyl groups, 4 mg of FcR9_F_Cys prepared in Example 4 was reacted therewith, thereby obtaining FcR9_F-immobilized gel.

(56) (2) A stainless-steel column having a size of φ4.6 mm×75 mm was filled with 1.2 mL of the FcR9_F-immobilized gel prepared in (1), thereby preparing an FcR9_F column.

(57) (3) The FcR9_F column prepared in (2) was connected to a high performance liquid chromatography system (manufactured by Tosoh Corporation) and equilibrated with 20 mM acetate buffer (pH 5.0) containing 50 mM sodium chloride.

(58) (4) Five microliters of a monoclonal antibody (RITUXAN, manufactured by Zenyaku Kogyo Co., Ltd.), which was diluted with phosphate buffered saline (PBS) (pH 7.4) to yield a concentration of 1.0 mg/mL, was added at a flow rate of 0.6 mL/min.

(59) (5) Washing was performed with the equilibration buffer for 2 minutes while the flow rate was maintained at 0.6 mL/min. Subsequently, a monoclonal antibody adsorbed was eluted with a pH gradient of 10 mM glycine-HCl buffer (pH 3.0) (i.e., a gradient in which 10 mM glycine-HCl buffer (pH 3.0) accounts for 100% in 28 minutes).

(60) FIG. 2 depicts the results (elution pattern). The monoclonal antibody was separated into a plurality of peaks, but not a single peak as in the case of gel filtration chromatography, because it interacted with the Fc-binding protein.

(61) (6) Each of Peaks 1 to 3 in the elution pattern depicted in FIG. 2 was separately collected into a container so as to obtain an isolation fraction of each peak.

Comparative Example 1 Preparation of Fc-Binding Protein (FcR9)-Immobilized Gel and Antibody Separation

(62) Antibody separation was carried out by preparing Fc-binding protein (FcR9)-immobilized gel in the same manner as in Examples 3 to 5 except that the Fc-binding protein FcR9 (SEQ ID NO: 5) disclosed in WO2015/199154 was used as an Fc-binding protein to be immobilized on an insoluble carrier.

(63) FIG. 3 depicts the results (elution pattern). It is understood that elution peaks are close to each other and the resolution is low, compared to the elution pattern in Example 5 (FIG. 2). In other words, it was found that antibody separation ability is improved with the use of gel having the Fc-binding protein of the present invention having an amino acid substitution of Val192Phe (FcR9_F) immobilized thereon, compared to when using gel having the Fc-binding protein lacking the amino acid substitution (FcR9) immobilized thereon.

Example 6 Examination of Equilibration Buffer

(64) Example 6 was carried out in the same manner as in Example 5 except that the equilibration buffer used in Example 5 (3) was changed to any of the following (a) to (c). (a) 20 mM acetate buffer containing 50 mM sodium chloride (pH 5.5) (b) 20 mM acetate buffer containing 50 mM sodium chloride (pH 5.6) (c) 20 mM MES buffer containing 50 mM sodium chloride (pH 6.0)

(65) The obtained elution patterns are depicted in FIG. 4 (equilibration buffer (a)), FIG. 5 (equilibration buffer (b)), and FIG. 6 (equilibration buffer (c)). In addition, among the elution patterns obtained in this Example, Example 5 (FIG. 2), and Comparative Example 1 (FIG. 3), peaks corresponding to the monoclonal antibody were designated as Peak 1, Peak 2, and Peak 3 in the ascending order of elution time, and the resolution between Peak 1 and Peak 2 and the resolution between Peak 2 and Peak 3 were calculated using the following formula. Table 5 lists the results.
Resolution (Rs value)=1.18×(Elution time of late elution time peak−Elution time of early elution time peak)/(Half width of early elution time peak+Half width of late elution time peak)

(66) The higher the resolution (Rs value), the better the separation performance.

(67) The inventors previously revealed that antibodies obtained by isolating elution fractions based on the Peak 1, Peak 2, and Peak 3 have different levels of antibody dependent cellular cytotoxicity (ADCC (Japanese Unexamined Patent Publication (Kokai) No. 2016-23152). Therefore, by isolating an antibody using the separation method with high resolution in Example 5, it is possible to separate, for example, antibodies having different levels of ADCC with good accuracy.

(68) TABLE-US-00005 TABLE 5 Separation condition Fc-binding Equilibration Resolution Rs value protein buffer pH Peaks 1-2 Peaks 2-3 Example 5 FcR9_F 5.0 0.95 1.10 Comparative FcR9 5.0 0.85 0.74 Example 1 Example 6 (a) FcR9_F 5.5 1.22 1.11 Example 6 (b) FcR9_F 5.6 1.18 1.13 Example 6 (c) FcR9_F 6.0 0.05 0.09

(69) As a result of comparison between the results of Comparative Example 1 (FcR9) and the results of Example 5 (FcR9_F) in Table 5, it is understood that the resolution Rs value and the antibody separation ability are higher in Example 5. In other words, it is also understood from the resolution values obtained by calculation that when using gel having the Fc-binding protein having an amino acid substitution of Val192Phe in FcR9 immobilized thereon, antibody separation ability is improved, compared to when using gel having FcR9 immobilized thereon.

(70) In addition, it is understood from the results of Examples 5 and 6 that when the pH of equilibration buffer was 5.5 or 5.6 (Example 6 of (a) and (b)) rather than 5.0 (Example 5), the resolution (Rs value) increased, while the resolution remarkably decreased at pH 6.0 (Example 6 (c)) indicating that separation was substantially unsuccessful. It can be said from these results that the pH of equilibration buffer is favorably from 4.5 to 5.8, and when the pH is from 5.2 to 5.7, it is preferable in that antibody separation ability is further improved.

Example 7 Measurement of Antibody Dependent Cellular Cytotoxicity (ADCC) of Separated Antibody

(71) (1) The regions of Peaks 1 and 3 in the chromatogram depicted in FIG. 2, which were separated in Example 5, were isolated. Isolation was repeated, the buffer was changed to PBS (10 mM disodium hydrogen phosphate, 1.76 mM potassium dihydrogen phosphate, 137 mM sodium chloride, 2.7 mM Potassium chloride) (pH 7.4) while pooled Peaks 1 and 3 were concentrated via an ultrafiltration membrane (manufactured by MERCK MILLIPORE). Thereafter, the concentrations of the monoclonal antibody in Peak 1 and the monoclonal antibody in Peak 3 after concentration and buffer exchange and the concentration of the monoclonal antibody before separation were measured at an absorbance at 280 nm.

(72) (2) ADCC Activity Measurement ADCC activity of the monoclonal antibody included in each peak and that of the monoclonal antibody before separation were measured in accordance with the manual of an ADCC Reporter Bioassay Kit (manufactured by Promega Corporation) by the following method.

(73) (2-1) ADCC assay buffer was prepared by mixing 1.4 mL of Low IgG Serum and 33.6 mL of an RPMI 1640 medium. This ADCC assay buffer was used for creating an eight-step dilution series for each of the monoclonal antibody in Peak 1, the monoclonal antibody in Peak 3, and the monoclonal antibody before separation by three-fold dilution at each step starting from 3 μg/mL.

(74) (2-2) Raji cells were adjusted to have a concentration of about 5×10.sup.5 cells/mL with the ADCC assay buffer and added to a 96-well plate (3917: manufactured by Corning Incorporated) at 25 μL/well. The dilution series of each of the monoclonal antibody in Peak 1, the monoclonal antibody in Peak 3, and the monoclonal antibody before separation created in (2-1), and the ADCC assay buffer alone as a blank were separately added to wells containing Raji cells at 25 μL/well.

(75) (2-3) Effector cells (manufactured by Promega Corporation) were adjusted to have a concentration of about 3.0×10.sup.5 cells/mL with the ADCC assay buffer and added to wells containing Raji cells and the antibody at 25 μL/well. Thereafter, the 96-well plate was left to stand still in a CO.sub.2 incubator (5% CO.sub.2, 37° C.) for 6 hours.

(76) (2-4) The 96-well plate was left to stand still at room temperature for 5 to 30 minutes, and then, a Luciferase Assay Reagent (manufactured by Promega Corporation) was added at 75 μL/well. Reaction was caused to proceed at room temperature for 30 minutes, followed by luminescence measurement by a GloMax® Multi Detection System (manufactured by Promega Corporation).

(77) (3) FIG. 7 depicts the results of comparing the luminescence intensities of the monoclonal antibody of Peak 1 and the monoclonal antibody of Peak 3, each peak being separated in Example 5, and the luminescence intensity of the monoclonal antibody before separation, which were calculated by subtracting the blank luminescence intensity from the measured luminescence intensity. The results indicate that the higher the luminescence intensity, the higher the ADCC activity. Although the ADCC activity of Peak 1 was lower than that before separation, the luminescence intensity of Peak 3 was about 1.5 times higher than before separation. It is understood from the results that the monoclonal antibody contained in Peak 3 has higher ADCC activity than that of the monoclonal antibody before separation and that of the monoclonal antibody contained in Peak 1. Accordingly, it was found that an antibody with higher ADCC activity is the one obtained by late elution from the FcR9_F column prepared in Example 5 (long retention time in the column), and it was confirmed that a monoclonal antibody can be separated based on ADCC activity using the present invention gel.

Example 8 Analysis of Antibody Contained in Culture Solution and Separation Pattern (1)

(78) (1) Construction of Antibody-Producing Cells

(79) (1-1) A polynucleotide obtained by adding a polynucleotide (heavy chain signal peptide nucleotide sequence: SEQ ID NO: 27; light chain signal peptide nucleotide sequence: SEQ ID NO: 28) encoding an antibody-derived signal peptide for secretion expression (heavy chain signal peptide amino acid sequence: SEQ ID NO: 25; light chain signal peptide amino acid sequence: SEQ ID NO: 26) to the 5′ end of a polynucleotide (rituximab heavy chain nucleotide sequence: SEQ ID NO: 21; rituximab light chain nucleotide sequence: SEQ ID NO: 22; bevacizumab heavy chain nucleotide sequence: SEQ ID NO: 23; bevacizumab light chain nucleotide sequence: SEQ ID NO: 24) encoding rituximab (heavy chain amino acid sequence: SEQ ID NO: 17; light chain amino acid sequence: SEQ ID NO: 18) or bevacizumab (heavy chain amino acid sequence: SEQ ID NO: 19; light chain amino acid sequence: SEQ ID NO: 20) was introduced into a commercially available vector (pCAG-Neo, manufactured by Wako Pure Chemical Industries, Ltd.) by an ordinary method.

(80) (1-2) CHO cells (strain DG44) were transfected using the constructed antibody expression vector by the Lipofectamine method, and antibody-producing cells were obtained by selection using antibiotics.

(81) (1-3) A high-expression strain was selected by single cloning from the group of the obtained antibody-producing cells, thereby establishing high-expression antibody-producing cells.

(82) (2) Culture of Antibody-Producing Cells

(83) (2-1) Antibody-producing cells were seeded in an 125 mL Erlenmeyer flask (manufactured by Corning Incorporated) containing 20 mL of CD OptiCHO™ medium (manufactured by Thermo Fisher Scientific) to which a glutamine solution (manufactured by Thermo Fisher Scientific) and antibiotic G418 (manufactured by Thermo Fisher Scientific) were added to yield a concentration of 5×10.sup.5 cells/mL so as to perform shaking culture at 37° C. and 125 rpm in the presence of 8% CO.sub.2.

(84) (2-2) The viable cell density and cell viability were determined by a commercially available automated cell counter (manufactured by Thermo Fisher Scientific) once every other day.

(85) (2-3) The culture scale was successively expanded by an ordinary method, and eventually, main culture in 1 L of the medium was initiated. The viable cell density and cell viability were determined in the same manner as in (2-2), and culture was continued by adding the medium described in (2-1) as appropriate.

(86) (3) Sampling of Culture Solution and Analysis by FcR9_F Column

(87) (3-1) The culture solution was sampled by the number of days of culture and the viable cell density and cell viability were determined. In addition, the sampled culture solution was used for determining the antibody production by the HPLC method using an affinity chromatography column for antibody quantification (TSKgel® Protein A-5PW, manufactured by Tosoh Corporation).

(88) (3-2) The culture solution sampled by the number of days of culture was analyzed using the FcR9_F column prepared in Example 5 by the same method as in Example 6 (b), thereby obtaining a pattern of separation of the antibody contained in the culture solution.

(89) FIGS. 8 to 10 depict the results of the viable cell density, cell viability, and antibody concentration (antibody production) obtained by the number of days of culture, respectively. In addition, FIG. 11 depicts the results (chromatogram) obtained by analyzing the culture solution on Day 3 of culture using the FcR9_F column. Contaminants accounting for the majority of the culture solution could be observed as a pass-through fraction at a peak around 1 to 5 minutes of elution time (retention time). Meanwhile, when the region of 10 to 30 minutes of elution time was enlarged (FIG. 12), a plurality of peaks derived from the antibody contained in the culture solution were confirmed. It is understood from the above results that by analyzing an antibody contained in the culture solution during culture using the FcR9_F column of the present invention, it is possible to separate the antibody contained in the culture solution during culture based on its sugar chain structure.

(90) Further, the culture solution was analyzed in the same manner using the FcR9_F column on Days 4, 6, 8, 10, 12, and 14 during culture. FIG. 13 is an enlarged view of the region of 10 to 30 minutes of elution time in the analysis results (chromatogram), based on which the peak derived from the antibody can be confirmed. It was possible to recognize differences in the shape and height of a separation peak derived from the sugar chain structure of the antibody with the passage of days during culture and to monitor temporal changes in the sugar chain structure pattern of the antibody from FIG. 13. The above results suggest that step analysis for monitoring culture progress can be readily performed by analyzing the culture solution during culture using the FcR9_F column of the present invention over time. In addition, it is suggested based on the analysis results that examination of culture conditions optimal for production of antibody drugs and prediction of the sugar chain structure of an antibody can be readily carried out.

Example 9 Analysis of Antibody Contained in Culture Solution and Analysis of Separation Pattern (2)

(91) (1) Vectors for expressing the heavy chain of the anti-interleukin 6 receptor (hereinafter “IL-6R”) antibody consisting of the amino acid sequence set forth in SEQ ID NO: 29 and the light chain of the anti-IL-6R antibody consisting of the amino acid sequence set forth in SEQ ID NO: 30 were constructed by the method described below.

(92) (1-1) Total synthesis was carried out by adding the restriction enzyme SacII recognition sequence (CCGCGG) to both the 5′ end and the 3′ end of the gene encoding dihydrofolate reductase (dhfr) and SV40 PolyA set forth in SEQ ID NO: 31 (consigned to Integrated DNA Technologies, Inc.), and the synthesized product was cloned into a plasmid.

(93) (1-2) E. coli strain JM 109 was transformed by the plasmid prepared in (1-1). The obtained transformant was cultured, and plasmids were extracted therefrom and digested with restriction enzyme SacII, thereby preparing a gene encoding dhfr-SV40 PolyA. The gene was named dhfr-SV40 PolyA-P1.

(94) (1-3) PCR was performed using a pIRES vector (manufactured by Clontech Laboratories, Inc.) as a template and oligonucleotide primers consisting of the sequences set forth in SEQ ID NO: 32 (5′-TCCCCGCGGGCGGGACTCTGGGGTTCGAAATGACCG-3′) and SEQ ID NO: 33 (5′-TCCCCGCGGGGTGGCTCTAGCCTTAAGTTCGAGACTG-3′). Specifically, a reaction solution having the composition in Table 6 was prepared. The reaction solution was heat-treated at 98° C. for 30 seconds, and PCR was performed by a reaction of 25 cycles of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 5 minutes. As a result of PCR, a region in the pIRES vector, from which the neomycin-resistant gene was removed, was amplified.

(95) TABLE-US-00006 TABLE 6 Composition Volume 10 ng/μL Template DNA 2 μL 10 μM Forward primer (SEQ ID NO: 32 or 34) 2 μL 10 μM Reverse primer (SEQ ID NO: 33 or 35) 2 μL 5 × PrimeSTAR ® buffer 10 μL (manufactured by Takara Bio) 2.5 mM dNTPs 4 μL 2.5 U/μL PrimeSTAR ® HS 0.5 μL (manufactured by Takara Bio) H.sub.2O up to 50 μL

(96) (1-4) The PCR product produced in (1-3) was purified, digested with restriction enzyme SacII, and ligated to dhfr-SV40 PolyA-P1 prepared in (1-2). E. coli strain JM109 was transformed with the ligation product, and plasmids were extracted from the cultured transformant, thereby obtaining the expression vector pIRES-dhfr including the dhfr gene.

(97) (2) PCR was performed using pIRES-dhfr prepared in (1) as a template and oligonucleotide primers consisting of the sequences set forth in SEQ ID NO: 34 (5′-ACGCGTCGACACTAGAAGCTTTATTGCGGTAGTTTATCAC-3′) and SEQ ID NO: 35 (5′-ACGCGTCGACAGATCTGTCGAGCCATGTGAGCAAAAGGCC-3′). Specifically, a reaction solution having the composition in Table 6 was prepared. The reaction solution was heat-treated at 98° C. for 5 minutes, and PCR was performed by a reaction of 30 cycles of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 7 minutes. As a result of PCR, a region in the pIRES-dhfr vector, from which the CMV promoter gene was removed, was amplified, and designated as pIRES-dhfr-P2.

(98) (3) PCR was performed using pIRES-dhfr-P2 prepared in (2) as a template and oligonucleotide primers consisting of the sequences set forth in SEQ ID NO: 36 (5′-TTTAAATCAGCGGCCGCGCAGCACCATGGCCTGAAATAACCTCTG-3′) and SEQ ID NO: 37 (5′-ACGGGCACCGGAGCGATCGTTTACCACATTTGTAGAGGTTTTACTTGC-3′). Specifically, a reaction solution having the composition in Table 7 was prepared. The reaction solution was heat-treated at 98° C. for 1 minute, and PCR was performed by a reaction of 30 cycles of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds, and a third step at 72° C. for 1 minute. The PCR product (i.e., a region including the SV40 promoter, dhfr, and SV40 PolyA) amplified as a result of PCR was designated as dhfr-P3 (SEQ ID NO: 38).

(99) TABLE-US-00007 TABLE 7 Composition Volume 50 ng/μLTemplate DNA 1 μL 10 μM Forward primer (SEQ ID NO: 36) 2 μL 10 μM Reverse primer (SEQ ID NO: 37) 2 μL 5 × PrimeSTAR ® buffer 10 μL (manufactured by Takara Bio) 2.5 mM dNTPs 4 μL 2.5 U/μL PrimeSTAR ® HS 0.5 μL (manufactured by Takara Bio) H.sub.2O up to 50 μL

(100) (4) pFUSEss-CHIg-hG1 including a human antibody heavy chain constant region (manufactured by InvivoGen) and dhfr-P3 prepared in (3) were digested with restriction enzymes NotI and PvuI, purified, and ligated to each other. E. coli strain JM109 was transformed with the ligation product, and plasmids were extracted from the cultured transformant, thereby obtaining pFUSEss-CHIg-hG1 including the SV40 promoter, dhfr, and SV40 PolyA. The plasmid in which the SV40 promoter, dhfr, and SV40 PolyA were incorporated into pFUSEss-CHIg-hG1 was designated as pFU-CHIg-dhfr.

(101) (5) Total synthesis of a polynucleotide encoding the anti-IL-6R antibody heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO: 39 with a polynucleotide (SEQ ID NO: 40) to which restriction enzymes EcoRI (GAATTC) and NheI recognition sequence (GCTAGC) were added was conducted (consigned to FASMAC). The synthesized product was cloned into plasmids, and each plasmid was used for transforming E. coli strain JM109. Each obtained transformant was cultured, and plasm ids were extracted, digested with restriction enzymes EcoRI and NheI and purified, thereby obtaining a gene encoding the anti-IL-6R antibody heavy chain including a signal peptide. The gene was designated as aIL6RH-P4.

(102) (6) pFU-CHIg-dhfr prepared in (4) was digested with restriction enzymes EcoRI and NheI and purified. The resulting product was ligated to aIL6RH-P4 prepared in (5), and E. coli JM109 was transformed with the ligation product. Plasmids were extracted from the culture solution of the transformant, thereby obtaining an expression vector pFU-aIL6RH for expressing the anti-IL-6R antibody heavy chain.

(103) (7) pFUSE2ss-CLIg-hk including a human antibody light chain constant region (manufactured by InvivoGen) and dhfr-P3 prepared in (3) were separately digested with restriction enzymes NotI and PvuI, purified, and ligated to each other. E. coli strain JM109 was transformed with the ligation product, and plasmids were extracted from the cultured transformant, thereby obtaining pFUSE2ss-CLIg-hk including the SV40 promoter, dhfr, and SV40 PolyA. The plasmid in which the SV40 promoter, dhfr, and SV40 PolyA were incorporated into pFUSE2ss-CLIg-hk was designated as pFU-CLIg-dhfr.

(104) (8) Total synthesis of a polynucleotide encoding the anti-IL-6R antibody light chain variable region consisting of the amino acid sequence set forth in SEQ ID NO: 41 with a polynucleotide (SEQ ID NO: 42) to which restriction enzyme EcoRI (GAATTC) and a BsiWI recognition sequence (CGTACG) were added was conducted (consigned to FASMAC). The synthesized product was cloned into plasmids, and the plasmids were used for transforming E. coli strain JM109. Each obtained transformant was cultured, plasmids were extracted and digested with restriction enzymes EcoRI and BsiWI and purified, thereby obtaining a gene encoding the anti-IL-6R antibody light chain including a signal peptide. The gene was designated as aIL6RL-P5.

(105) (9) pFU-CLIg-dhfr prepared in (7) was digested with restriction enzymes EcoRI and BsiWI and purified. The resulting product was ligated to aIL6RL-P5 prepared in (8), and E. coli JM109 was transformed with the ligation product. Plasmids were extracted from the culture solution of the transformant, thereby obtaining an expression vector pFU-aIL6RL for expressing the anti-IL-6R antibody light chain.

(106) (10) PFU-aIL6RH prepared in (6) and pFU-aIL6RL prepared in (9) were transfected into CHO cells (strain DG44) using Neon Transfection System (manufactured by Thermo Fisher Scientific). Thereafter, transformed cells were cultured on CD OptiCHO™ Medium (Thermo Fisher Scientific) and gene amplification was performed using 50 ng/mL methotrexate (MTX).

(107) (11) Single cloning was performed by the limiting dilution method, and highly productive cells capable of stably producing an anti-IL-6R antibody were selected by ELISA (Enzyme-Linked Immunosorbent Assay) as described below.

(108) (11-1) Soluble human IL-6R (manufactured by Wako Pure Chemical Industries, Ltd.) or anti-human Fab antibody (manufactured by Bethyl Laboratories) was immobilized at 1 μg/well in wells of a 96-well microplate (overnight at 4° C.). After the end of immobilization, blocking was performed with 20 mM Tris-HCl buffer (pH 7.4) containing 2% (w/v) of SKIM MILK (Becton, Dickinson and Company) and 150 mM sodium chloride.

(109) (11-2) After washing with washing buffer (20 mM Tris-HCl buffer (pH 7.4) containing 0.05% [w/v] Tween® 20 and 150 mM NaCl), the culture supernatant containing the antibody was added so that the antibody was allowed to react with the immobilized protein (1 hour at 30° C.).

(110) (11-3) After the end of the reaction, the reaction product was washed with the washing buffer, and a peroxidase-labeled anti-human Fc antibody (manufactured by Bethyl Laboratories) diluted to 100 ng/mL was added at 100 μL/well.

(111) (11-4) After the reaction at 30° C. for 1 hour, the reaction product was washed with the washing buffer, and TMB Peroxidase Substrate (manufactured by KPL) was added at 50 μL/well. Thereafter, color development was stopped by adding 1M phosphoric acid at 50 μL/well. The absorbance at 450 nm was measured using a microplate reader (manufactured by Tecan Group Ltd.), and a highly productive cell line capable of producing an anti-IL-6R antibody was selected.

(112) (12) A highly productive cell line capable of producing an anti-IL-6R antibody was obtained by repeatedly selecting clones by ELISA described in (11) by limiting dilution while increasing the MTX concentration in a stepwise manner until the MTX concentration reached 64 μg/mL.

(113) (13) The cell line obtained in (12) was scaled-up in a stepwise manner and cultured with shaking using 100 mL of CD OptiCHO™ Medium containing 50 μg/mL kanamycin and two 500-mL Erlenmeyer flasks in a CO.sub.2 incubator (37° C., 8% CO.sub.2). Thereafter, the cell line was inoculated in a jar fermenter (manufactured by Biott Corporation), and CD OptiCHO™ Medium containing 50 μg/mL kanamycin was added to yield a final volume of 1 L. Culture was performed at 80 rpm, pH 7.0, 37° C., and 5% CO.sub.2. The CO.sub.2 concentration was changed from 5% to 8% on Day 1 of culture, and the stirring speed was changed from 80 rpm to 100 rpm on Day 5 of culture. Culture was continued for 9 days. The culture solution was collected in a volume of 80 mL on Days 3, 5, 7, and 9 of culture.

(114) (14) Cells and impurities were removed from each culture solution obtained in (13). The obtained supernatant was applied to 0.5 mL of TOYOPEARL rProtein A HC-650F (manufactured by Tosoh Corporation) filling an open column which was preliminarily equilibrated with 20 mM Tris-HCl (pH 7.4) containing 150 mM sodium chloride. The column was washed with the buffer used for the equilibration, followed by elution with 4 mL of 100 mM glycine-HCl buffer (pH 3.0). The pH of the elution solution was adjusted to a neutral range with the addition of 1 mL of 1M Tris-HCl (pH 8.0), and the buffer was exchanged to 50 mM citrate buffer (pH 6.5) via an ultrafiltration membrane, thereby obtaining a high-purity soluble anti-IL-6R antibody on Days 3, 5, 7, and 9 of culture.

(115) (15) The purified anti-IL-6R antibodies obtained in (14) were analyzed by the method described below using the FcR9_F column prepared in Example 5 (2).

(116) (15-1) The FcR9_F column prepared in Example 5 (2) was connected to a high performance liquid chromatography system (manufactured by Tosoh Corporation), and equilibration was performed with an equilibration buffer of 50 mM citrate buffer (pH 6.5) at a flow rate of 1.0 mL/min.

(117) (15-2) The purified antibody obtained in (5) diluted with the 1.0 mg/mL equilibration buffer was added in a volume of 5 μL at a flow rate of 1.0 m L/m in.

(118) (15-3) Washing with the equilibration buffer was performed for 2 minutes while maintaining the flow rate at 1.0 mL/min, and then, the antibody adsorbed with a pH gradient of 50 mM citrate buffer (pH 4.5) (i.e., a gradient in which 50 mM citrate buffer (pH 4.5) accounts for 100% in 18 minutes) was eluted.

(119) (16) Structural analysis of the sugar chain of the purified anti-IL-6R antibody obtained in (14) was conducted by a method as described in Japanese Unexamined Patent Publication (Kokai) No. 2016-169197.

(120) Both FIG. 14 and Table 8 depict the summary results of the chromatogram (elution pattern) of each purified antibody obtained from the culture solution on a different day of culture and the area ratio of each peak calculated based on the chromatogram. In addition, FIG. 15 depicts the summary results of the viable cell concentration (viable cultured cell count) and the antibody concentration (antibody production) by the number of days of culture. Further, FIG. 16 and Table 9 depict the results of structural analysis of the sugar chain structure of the purified antibody. Others in Table 9 were specified as Man8, G0Fb−GN, G2, G1Fb−GN, G0Fa−GN, G1Fa−GN, G1F+SA, G2F+SA, G2F+SA2, and G1F+GN. Of these, G1F+SA was detected on Day 5 or later, and Man8 was detected on Day 7 or later.

(121) From the results in FIG. 14 and Table 8, as in the case of the results obtained using the culture solution (Example 8 and FIG. 13), it was possible to recognize differences in the shape and height (peak area ratio) of a separation peak derived from the sugar chain structure of the antibody with the passage of days of culture. In addition, from the results in FIG. 16 and Table 9, it was confirmed that differences in the shape and height (peak area ratio) of a separation peak are based on differences in the sugar chain structure bound to the antibody. The above results indicate that by analyzing the culture solution during culture using the FcR9_F column of the present invention in a time-dependent manner, it is possible to conduct analysis in a step of culturing antibody-producing cells and monitor the sugar chain structure pattern of an antibody produced from the cells in a time dependent manner. Further, based on the results of monitoring the sugar chain structure pattern, it is possible to optimize culture conditions for obtaining an antibody having a desired sugar chain structure (capable of, for example, exhibiting performance as an antibody drug) and monitor culture steps.

(122) TABLE-US-00008 TABLE 8 Elution time Number of days of culture Peak No. [min] Day 3 Day 5 Day 7 Day 9 Area ratio Peak 1 9.6 18.1 22.3 33.8 34.4 [%] Peak 2 11.7 36.7 38.1 35.6 35.4 Peak 3 13.7 45.2 39.6 30.6 30.2 Total 100 100 100 100

(123) TABLE-US-00009 TABLE 9 Sugar chain Number of days of culture structure Day 3 Day 5 Day 7 Day 9 Area G2F 15.24 12.58 10.35 10.14 ratio G1F 42.76 39.25 36.67 35.48 [%] G0F 23.03 24.06 31.06 32.76 G1 0.96 0.89 0.80 0.82 G0 2.11 2.00 2.07 1.95 Man5 0.92 1.83 3.10 3.33 others 14.98 19.39 15.95 15.52 Total 100 100 100 100

(124) The present invention is described above in detail with reference to specific embodiments. However, it will be obvious to those skilled in the art that various changes and modifications can be made without departing from the spirit and scope of the present invention.

(125) The entire contents of the specifications, sequence listings, claims, drawings, and abstracts of Japanese Patent Application No. 2017-028974 filed on Feb. 20, 2017, Japanese Patent Application No. 2017-074727 filed on Apr. 4, 2017, and Japanese Patent Application No. 2017-109681 filed on Jun. 2, 2017 are incorporated herein by reference and incorporated as the disclosure of the specification of the present invention.