Combined use of a vector encoding a modified receptor and its exogenous agonist in the treatment of seizures

10391145 ยท 2019-08-27

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides methods and materials for treating a seizure disorder such as epilepsy in a patient which employ a vector encoding a modified receptor, the so-called DREADD receptor being characterised by (i) a decreased responsiveness to its endogenous activating ligand (ii) a retained or enhanced responsiveness to an exogenous agonist. The modified receptor is expressed in neurons of a seizure focus in brain of the patient, and an exogenous agonist is administered which activates the modified receptor to reversibly alters the excitability of the neurons in the seizure focus leading to synaptic silencing or other inhibition.

Claims

1. A method of treating a seizure disorder, which is focal epilepsy, in a patient suffering from said disorder, wherein either (a) said patient has previously been administered a vector encoding a modified receptor, wherein the modified receptor is a human muscarinic acetylcholine receptor M4, which is a Gi protein-coupled receptor (GPCR), coupled via a Gi-protein to a G protein-coupled inwardly rectifying potassium channel (GIRK), and wherein the modified receptor is characterised by (i) a decreased responsiveness to its endogenous activating ligand and/or (ii) a retained or enhanced responsiveness to an exogenous agonist, or (b) administering to the patient said vector, wherein the modified receptor is encoded by a nucleic acid operably linked to a neuronal cell type-specific promoter such that said modified receptor is expressed in excitatory neurons of a seizure focus in brain of the patient; which method comprises subsequently administering to said patient an exogenous agonist selected from clozapine, clozapine-N-oxide and perlapine, whereby the presence of said agonist in the brain of the patient activates said modified receptor, whereby activation of said modified receptor reversibly inhibits the excitability of, and neurotransmission by, the excitatory neurons in the seizure focus.

2. The method of claim 1, wherein the exogenous agonist is administered automatically either (i) by a device that is either coupled to an automated seizure detection mechanism, or (ii) in response to a predicted seizure by EEG analysis.

3. The method of claim 1, wherein the promoter is the CaMk2A promoter.

4. The method of claim 1, wherein the exogenous agonist is clozapine-N-oxide, which is optionally administered as clozapine.

5. The method of claim 1, wherein the exogenous agonist is perlapine.

6. The method of claim 1, wherein the exogenous agonist is administered prior to the patient having an epileptic seizure or during an epileptic seizure.

7. The method of claim 6, wherein the exogenous agonist is administered within 30 minutes before or 24 hours after the human has an epileptic seizure.

8. The method of claim 1, wherein the modified GPCR includes at least modifications at positions 113 and\or 204.

9. The method of claim 8, wherein the modifications are Y113C and/or A230G.

10. The method of claim 1, wherein the vector is a viral vector.

11. The method of claim 10, wherein the viral vector is selected from the group consisting of: an adenovirus vector, an adeno-associated vector, a herpes virus vector, a retrovirus vector and a lentivirus vector.

Description

FIGURES (FROM REF. 26)

(1) FIG. 1. Chemical-genetic silencing of pilocarpine-induced seizures. (a) Morlet-wavelet EEG spectra from a rat administered intracortical pilocarpine (time 0), with either intraperitoneal vehicle (top) or CNO (bottom). (b) EEG segment from (a, top), showing simple spikes (SS), complex spikes (CS) and runs of intermediate frequency (IF) activity (expanded below). (c) Behavioural seizures correlated with EEG. SS activity was associated with no motor seizures (severity score 0) or twitching of limb, head or body (score 1), while IF was associated with repetitive head or body shaking (score 2) or rearing, retrograde locomotion and generalized convulsions (3). Six hundred consecutive 4-s-intervals per rat were assessed in three rats (numbered 1-3). (d) Detection of Intermediate Frequency (IF)-activity by Fourier transformation: Fourier transform (right) of EEG segments in one rat showing either SS (black) or IF (red) activity (two 5-s periods shown to the left) induced by pilocarpine. The IF Fourier transform shows a peak around 7 Hz (and a harmonic at 14 Hz). (e) Temporal evolution of spike frequency (left), 4-14 Hz power (middle), and number of IF runs (right), in vehicle (red) and CNO (blue) trials (consecutive 10-min-intervals before (10-0 min) and after pilocarpine and vehicle/CNO injection). N=6 rats (10 pairs of trials, averaged within rat where repeated, data are shown as means.e.m.). (f) Same data as in e, but plotted as cumulative electrographic seizure metrics (frequency, power, number of IF events), comparing vehicle versus CNO for each animal (indicated by colour). Symbols indicate consecutive cumulative metrics at 10-min-intervals. The 45-degree line (grey) indicates equivalence of CNO and vehicle.

(2) FIG. 2. Chemical-genetic silencing of picrotoxin-induced seizures. (a) Morlet-wavelet power spectra of EEG in an animal injected with picrotoxin at time 0 (1 mm below pia, 10 mM, 300 nl), together with intraperitoneal vehicle (top) or 1 mg ml-1 CNO in vehicle (bottom) on consecutive days. (b) EEG activity. Bottom, expanded sections from times indicated (2-s-duration) showing SS, CS and IF activity. (c) Motor seizures were more severe in association with IF activity than with SS activity, and intermediate with CS activity (severity scale as in FIG. 2c). Six hundred consecutive 4-s-intervals per rat were assessed in three rats (numbered 1-3). (d) Fourier transform (right) of 5-s-traces displayed (left, middle) containing SS (black) and IF (4-14 Hz, peak around 11.5 Hz; red) activity induced by picrotoxin. (e) Temporal evolution of spike frequency (left), 4-14 Hz power (middle), and number of IF runs (right), in vehicle (red) and CNO (blue) trials (consecutive 10-min-intervals before (10-0 min) and after picrotoxin and vehicle/CNO injection). N=5 rats (12 pairs of trials, averaged within rat where repeated, means.e.m.). (f) Same data as in e, but plotted as cumulative electrographic seizure metrics for each animal as in FIG. 2e.

(3) FIG. 3. Chemical-genetic silencing of focal neocortical epilepsy induced by tetanus toxin. (a) Sample EEG traces from a tetanus toxin injected animal, showing background activity (1) and four types of epileptiform activity: long events of low amplitude (2), short events of high amplitude (3), long event of high amplitude (4), and high amplitude plus intermittent spikes (5). (b-d) Pair-wise comparison of the frequency of epileptiform events (b), coastline (c) and high-frequency power (d) between vehicle and CNO trials. N=6 rats; 15 pairs of trials, averaged within animal where repeated. Orange bars indicate the decrease (%, right axis), where significant (Wilcoxon test; P<0.05).

(4) FIG. 4. |Expression and tolerability of HA-hM4D.sub.i-mCitrine. (a) Expression of HA-hM4Di-mCitrine in deeper layers of right primary motor cortex (M1), visualized with anti-HA antibody. Scale, 100 m. (b) Colocalization of CamKII-HA-hM4Di-mCitrine, visualized with anti-HA (left) and anti-CamKII (middle), and both (right) antibodies. Scale, 20 m. (c) Motor coordination with (right) and without (left) intraperitoneal CNO in rats receiving sham injection (left hand bar) or HA-hM4Di-mCitrine in right M1 (middle and right hand bars). Foot faults for the left forelimb (contralateral to HA-hM4Di-mCitrine) were compared with the right (ipsilateral) forelimb (paired t-test) and with foot faults of the left forelimb of sham-injected animals (unpaired t-test; means.e.m., n=5 sham-operated and 7 hM4-injected rats). NS: P>0.05.

(5) FIG. 5. Map of viral (AAV) vector in (plasmid: 5421-8155 bp) used to deliver hM4Di, as explained in the Examples below.

EXAMPLES

Example 1

Demonstration of Chemical-genetic Therapy in a Model of Epilepsy

(6) Introduction and Overview

(7) We have demonstrated a combined chemical-genetic approach to achieve localized suppression of neuronal excitability in a seizure focus, using viral expression of a DREADD (Designer Receptors Exclusively Activated by Designer Drugs). Neurons transduced with a DREADD are in principle unaffected in the absence of the selective ligand, and untransduced neurons are only affected when the ligand is present, thereby avoiding permanent alteration of their properties (10).

(8) We chose the engineered Gi-coupled human muscarinic receptor hM4Di, which has been made sensitive to the orally bioavailable and normally inert metabolite of clozapine, clozapine-N-oxide (CNO) (11, 12). Importantly, hM4Di is relatively insensitive to acetylcholine, the endogenous agonist of the parent receptor. hM4Di activation leads to the opening of G-protein gated inwardly rectifying potassium channels, resulting in membrane hyperpolarization and neuronal inhibition (11).

(9) Systemic administration of CNO suppressed focal seizures evoked by two different chemoconvulsants, pilocarpine and picrotoxin. CNO also had a robust anti-seizure effect in a chronic model of focal neocortical epilepsy. Chemical-genetic seizure attenuation provides a novel approach to treat intractable focal epilepsy whilst minimizing disruption of normal circuit function in untransduced brain regions or in the absence of the specific ligand.

(10) Materials and Methods

(11) Adeno-associated virus of serotype 5 containing a Camk2-HA-hM4D(Gi)-IRES-mCitrine cassette provided by Dr. Bryan Roth (University of North Carolina) were obtained from UNC Vector Core at a concentration of 810.sup.12 infectious units (IU)/ml. For control experiments a similar virus was injected expressing the optogenetic silencer ArchT instead of the chemical-genetic silencer hM4Di (AAV5-Camk2-ArchT-GFP).

(12) Stereotactic surgery. Animal experiments were conducted in accordance with the Animals (Scientific Procedures) Act 1986. Male Sprague-Dawley rats (6-12 weeks old, 263-325 g) were anesthetized using isoflurane and placed in a sterotaxic frame (Kopf, Calif.). 1.5 l hM4Diexpressing AAV5-virus was injected at a speed of 100 nl/min into layer 5 of the forelimb area of right primary motor cortex (coordinates, 2.2-2.4 mm lateral and 1.0 mm anterior of bregma at a depth of 1.0 mm from pia; in some rats half of the volume each was deposited at 1.1 and at 0.7 mm from pia). An EEG transmitter (A3019D, Open Source Instruments (13)) was implanted subcutaneously with a subdural intracranial recording electrode positioned above the injection site. A reference electrode was implanted in the contralateral skull. For sequential injections of chemoconvulsants a Teflon cannula guide (C313GT/SP, PlasticsOne) was implanted above the injection site. For chronic epilepsy experiments, 12-16 ng of tetanus toxin (gift of Dr G. Schiavo) was injected together with hM4Di-expressing AAV5 virus in a final volume of 1.6-1.8 l. Animals were housed separately in Faraday cages and EEG recorded continuously for up to 8 weeks post-surgery.

(13) Seizure models. Pilocarpine (5 M in sterile saline) or picrotoxin (10 mM in 10% DMSO/sterile saline) were injected through the previously implanted Teflon cannula guide 17-52 days after hM4Di AAV injection. The volume injected was adjusted between 200 and 900 nl for pilocarpine and 100-600 nl for picrotoxin, guided by the severity of the resulting seizures in each animal, and were kept constant between matched CNO and vehicle trials. CNO (1 mg/kg, diluted 1 mg/ml in 1% DMSO/saline vehicle) or vehicle alone were injected intraperitoneally immediately after convulsant infusion. Spike-waves developed within 5 minutes of chemoconvulsant injection.

(14) Epilepsy model. TeTx (12-16 ng) injected in a suspension with the hM4Di-expressing virus (see above), evoked high-frequency (70-160 Hz) events typically lasting less than 1 second, starting within 4 days. Such events occurred for at least 8 weeks after injection, but their frequency varied from day to day, and also depending on the time of day. Therefore, pairs of CNO-/vehicle trials were matched according to time of day, and we set a criterion that at least 2 events per hour had to occur on average over the 4 hours before the first CNO or vehicle injections for the trial to be included in the dataset. The order of CNO and matched vehicle trials was randomized. Vehicle (1% DMSO/saline) or CNO (1 mg/kg in DMSO/saline) was injected twice at 2-hour intervals, and periods lasting 3.5 hours after the first injection were analyzed.

(15) EEG analysis. EEG was recorded and processed using the Neuroarchiver tool (Open Source Instruments) and IgorPro (Wavemetrics, Inc). The trace was centered around 0 V by subtraction of the average. Short (<100 ms), high-amplitude artifacts (glitches) detected by threshold and periods with failed transmission were removed. The Igor script UnipolarPeakAreas.ipf was used to detect individual negative deflections (spike-waves), and custom-written scripts in Igor extracted their frequency as well as the coastline and power of the trace. The coastline was determined as the sum of the absolute difference between successive points. EEG epochs were also exported into Labview (National Instruments) to compute Morlet wavelet power spectra.

(16) To establish a correlation between different types of EEG-patterns and behavior, we compared continuous video recordings with EEG traces. Simple or complex spike-waves were counted individually (by deflection), but episodes of continuous and coherent intermediate frequency activity were counted as one event per episode. We graded motor seizures on a severity scale as follows: 0 (no obvious motor seizure), 1 (contralateral forelimb twitches), 2 (repetitive shaking of forelimb, head or body), 3 (whole body shaking, arching and rearing sometimes accompanied by walking backwards).

(17) Automated epileptiform event counting. For tetanus toxin-induced epileptic events, event sorting is explained in ref. (7). A more complete description of the seizure detection algorithm with source code is available at:

(18) http://www.opensourceinstruments.com/Electronics/A3018/Seizure_Detection.html#Similarity% 20of%20Events.

(19) Intermediate-frequency (IF) oscillations evoked by picrotoxin or pilocarpine were detected by using the fast-Fourier transform of 3-second EEG segments in the range 5-14 Hz (see also FIG. 1d). The 3-second window was moved along the trace in 1-second steps. IF events were defined as periods where the peak magnitude between 5-14 Hz exceeded a threshold of 20-45 mV, depending on the overall intensity of activity. Thresholds were kept constant within each matched pair of CNO/vehicle trials.

(20) Statistical analysis Paired t-tests or Wlcoxon tests were performed as appropriate using SPSS 20 (IBM). For seizure models, experimental time was divided up into 10-minute periods including the 10 minutes before injection as well as seven consecutive 10-minute periods after injection.

(21) Fluorescence and immunohistochemical analysis. Brains were removed and left in 4% PFA/PBS for 3-7 days at 4 C. and then washed in PBS. Coronal slices (50 and 100 m thickness) were cut on a vibrating slicer and examined for native mCitrine-expression right after slicing for each rat contributing to the data-set. Some of the 50 m slices were processed further: They were permeabilized in PBS, 0.15% Triton X-100 for 20 minutes, blocked with 10% horse serum (Vector Labs) for 1 hour on a shaker, and incubated for 2 days in primary antibodies against CaMKII (rabbit, 1:500, Epitomics/Abcam,) and hemagglutinin (HA; mouse, 1:1000, Covance). Following three further washes in PBS (10 min), the sections were incubated in secondary antibodies (1:500, Invitrogen, labeled with Alexa-488, and Alexa-546) overnight at 4 C., washed in PBS again (4 times, 10 min) and mounted in Vectashield (Vector Labs). Images were obtained with a confocal microscope at 25 magnification of the objective and 3 digital magnification.

(22) Results

(23) Chemical-genetic Silencing of Pilocarpine-Induced Acute Seizures

(24) To test the ability of the DREADD to modify seizure activity, we injected an adenoassociated virus encoding hM4Di under the Camk2a promoter (AAV5-CaMKII-HA-hM4D(GOIRES-mCitrine) into the forelimb area of primary motor cortex (M1) of 263-325 g rats under isoflurane anaesthesia. At the same time we implanted a Teflon cannula guide (Plastics1) above the injection site to allow administration of chemoconvulsants, and a subcutaneous transmitter (Open Source Instruments, Inc.) with the active lead overlying M1 for wireless EEG recording. The transmitter samples the EEG at 512 Hz continuously for several weeks (13). Expression of hM4Di (FIG. 4) had no noticeable effects on behavior or limb use, and was confirmed by fluorescence microscopy for all rats sacrificed after 3-20 weeks.

(25) We first examined seizures acutely evoked by chemoconvulsant injection into layer 5 of the motor cortex 17-52 days after hM4Di AAV injection. Pilocarpine (200-900 nl, 5 M) injected via the implanted cannula guide (1.6 -2.0 mm from pia) elicited large-amplitude spike-wave deflections at a frequency between 0.5 and 2 Hz, starting within 5 minutes of injection and lasting between 45 and 90 minutes (FIG. 1a,b). Spike-wave complexes either had a single negative peak (simple spikes, SS) or featured one or more shoulders (polyspike-waves or complex spikes, CS; FIG. 1b). They were interspersed with runs of intermediate frequency (IF) discharges (5-12 Hz) lasting 0.2-12 seconds, which typically had a smaller amplitude (FIG. 1b). IF discharges correlated with motor seizures at the higher end of a severity scale. This ranged from brief motor convulsions (severity score 0), through twitching of head or body (score 1), repetitive head or body shaking (score 2), to rearing, retrograde locomotion and generalized convulsions (score 3) (FIG. 1c). We therefore used the EEG power in an overlapping frequency band (4-14 Hz) as a surrogate marker to assess the anti-seizure effect of hM4Diactivation.

(26) We randomly interleaved experiments on alternate days where either CNO (1 mg/kg in DMSO/saline vehicle) (12), or vehicle alone, was administered by intraperitoneal injection immediately after focal neocortical pilocarpine infusion. In CNO trials, both electrographic and motor convulsions were substantially reduced (14 pairs of trials in 6 rats). Paired t-tests comparing either the mean frequency of negative deflections in the EEG, the mean 4-14 Hz power, or the number of IF runs that correlate with severe motor seizures (FIG. 1c), revealed a significant decrease for a majority of the consecutive 10-min bins used to analyze data (FIG. 1e, f).

(27) Chemical-genetic Silencing of Picrotoxin-induced Acute Seizures

(28) CNO thus profoundly suppressed pilocarpine-triggered seizures. However, the interpretation of this anti-seizure effect is potentially confounded by an overlap of downstream signaling cascades of pilocarpine acting on muscarinic receptors and CNO acting on hM4Di (14). We therefore tested a second chemoconvulsant, the GABAA receptor blocker picrotoxin. Picrotoxin injection into the primary motor cortex (100-600 nl, 10 mM) also elicited electrographic and motor seizures. Those were similar in overall duration, composition of spike-wave and IF complexes, and behavioral correlates (FIG. 2a-c) to seizures caused by pilocarpine. Among minor differences, electrographic bursting switched on and off more abruptly and complex spikes could feature multiple (2-6) spikes succeeding at high frequency (FIG. 2b). When CNO was administered by intraperitoneal injection immediately after focal picrotoxin the electrographic discharges were again attenuated (FIG. 2e, f; 12 pairs of trials in 5 rats). This was especially marked for IF activity (FIG. 2f), which correlated with more severe motor seizures (FIG. 2c).

(29) We asked whether off-target effects of CNO independent of hM4Di could account for its anti-seizure effect. Rats injected with an analogous virus expressing the optogenetic actuator ArchT instead of hM4Di underwent the same experimental protocol as described above, using local intracortical injection of either pilocarpine (12 pairs of trials, 6 rats) or picrotoxin (9 pairs of trials, 5 rats). We observed no significant differences between vehicle and CNO trials in any of the three measures of seizure severity.

(30) Chemical-genetic Silencing of Focal Neocortical Epilepsy Induced by Tetanus Toxin

(31) hM4Di activation with CNO is thus effective in two chemoconvulsant models. Does it also suppress spontaneous seizures in established epilepsy? We turned to the tetanus toxin model of chronic epilepsy (15, 16), which responds poorly to antiepileptic drugs and resembles human epilepsia partialis continua (17). This model is characterized by several EEG features, including increased high-frequency (120-160 Hz) power, increased coastline (cumulative difference between successive points on the EEG), and the occurrence of brief bursts of high-frequency EEG activity that can be detected by an automated event classifier (7) (FIG. 3a). (We limited the tetanus toxin dose for animal welfare considerations, and so motor seizures rarely occurred during the acute experiment.)

(32) Although the half-life of CNO in rats has not been measured systematically it affects neurons transduced with hM4Di or its excitatory analog hM4Dq for at least 90 minutes (12, 18, 19), and is fully cleared within 12 hours of administration of its precursor clozapine (20). We therefore assessed electrographic markers of epilepsy during a 3.5 hour window starting with the first of two intraperitoneal injections of either CNO or vehicle, with the second injection at 2 hours. The assessment was then repeated 24 hours later, switching vehicle and CNO, to allow for washout of the agonist, and to control for diurnal variability in seizure frequency (FIG. 3b-d, 15 pairs of trials in 6 rats). All three measures of epilepsy (frequency of epileptiform bursts, coastline, and high-frequency power) were significantly attenuated by CNO when compared with vehicle (P=0.028, Wilcoxon test; n=6).

(33) Discussion

(34) This study shows that chemical-genetics can be used to attenuate seizures on demand. Transduction with hM4Di has no effect on neuronal excitability in the absence of its specific ligand CNO (10-12), and so this approach avoids the theoretical risk of gene therapies designed around permanent overexpression of ion channels, neurotransmitter receptors or neuropeptides. Its temporal specificity does not match that of optogenetics (refs (7-9)) because the duration of effect is dictated by the half-life of CNO, which has been estimated in humans at 7-8 hours (21). However, chemical-genetics avoids the need for invasive and biocompatible devices to deliver light to the transduced brain area close to the seizure focus. Moreover, a relatively large area may be targeted, which is not limited by absorption of light. Instead, CNO can be administered systemically.

(35) We observed a significant reduction in seizure severity within 10 minutes of CNO administration (FIG. 1e, 2e), well below the 30-minute time-point that usually defines status epilepticus. Many patients with drug-resistant epilepsy have seizures that are preceded by premonitory auras, cluster or occur during predictable times (e.g. catamenial epilepsy), and hence might benefit from such chemical-genetic silencing.

(36) A further potential application of chemical-genetics to epilepsy is to test the hypothesis that continued alteration of neuronal excitability for a fixed period might reset epileptogenic circuits in some circumstances, bringing about a persistent reduction in seizures that outlasts the administration of the ligand. The reversibility, together with the regional and cell-type specificity of chemical genetics, distinguishes this approach from available small molecules or gene therapies based on expression of ion channels or other signalling molecules.

(37) In conclusion, we have shown that chemical-genetics can achieve region-and cell-type specific attenuation of neuronal excitability in order to suppress seizures.

(38) TABLE-US-00001 SequenceAnnex Genebankfilecorrespondingto Figure5(mapofviral(AAV)vectorin(plasmid:5421-8155bp) usedtodeliverhM4Di): LOCUSpAAV_CaMKIIa_HA_8157bpds-DNAcircular28- COMMENTApEinfo:methylated:1 FEATURES Location/Qualifiers misc_feature 4286...4873 /vntifkey=21 /label=WPRE misc_feature 4902...5380 /vntifkey=21 /label=hGH\PolyA misc_feature 156...1448 /vntifkey=21 /label=CAMKIIa\(3.1) misc_feature 1...141 /vntifkey=21 /label=L-ITR misc_feature 5420...5560 /vntifkey=21 /label=R-ITR misc_feature 5652...5958 /vntifkey=21 /label=F1\Origin misc_feature 6477...7334 /vntifkey=21 /label=AmpR misc_feature 7485...8155 /vntifkey=21 /label=pUC\Ori misc_feature 1469...4259 /vntifkey=21 /label=HA-hM4D-IRES-mCitrine ORIGIN 1cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc 61gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggcca 121actccatcactaggggttcctgcggccgcacgcgtttaacattatggccttaggtcactt 181catctccatggggttcttcttctgattttctagaaaatgagatgggggtgcagagagctt 241cctcagtgacctgcccagggtcacatcagaaatgtcagagctagaacttgaactcagatt 301actaatcttaaattccatgccttgggggcatgcaagtacgatatacagaaggagtgaact 361cattagggcagatgaccaatgagtttaggaaagaagagtccagggcagggtacatctaca 421ccacccgcccagccctgggtgagtccagccacgttcacctcattatagttgcctctctcc 481agtcctaccttgacgggaagcacaagcagaaactgggacaggagccccaggagaccaaat 541cttcatggtccctctgggaggatgggtggggagagctgtggcagaggcctcaggaggggc 601cctgctgctcagtggtgacagataggggtgagaaagcagacagagtcattccgtcagcat 661tctgggtctgtttggtacttcttctcacgctaaggtggcggtgtgatatgcacaatggct 721aaaaagcagggagagctggaaagaaacaaggacagagacagaggccaagtcaaccagacc 781aattcccagaggaagcaaagaaaccattacagagactacaagggggaagggaaggagaga 841tgaattagcttcccctgtaaaccttagaacccagctgttgccagggcaacggggcaatac 901ctgtctcttcagaggagatgaagttgccagggtaactacatcctgtctttctcaaggacc 961atcccagaatgtggcacccactagccgttaccatagcaactgcctctttgccccacttaa 1021tcccatcccgtctgttaaaagggccctatagttggaggtgggggaggtaggaagagcgat 1081gatcacttgtggactaagtttgttcgcatccccttctccaaccccctcagtacatcaccc 1141tgggggaacagggtccacttgctcctgggcccacacagtcctgcagtattgtgtatataa 1201ggccagggcaaagaggagcaggttttaaagtgaaaggcaggcaggtgttggggaggcagt 1261taccggggcaacgggaacagggcgtttcggaggtggttgccatggggacctggatgctga 1321cgaaggctcgcgaggctgtgagcagccacagtgccctgctcagaagccccaagctcgtca 1381gtcaagccggttctccgtttgcactcaggagcacgggcaggcgagtggcccctagttctg 1441ggggcagctctagagcggtaccggatccgccaccatgtacccatacgatgttccagatta 1501cgctatggccaacttcacacctgtcaatggcagctcgggcaatcagtccgtgcgcctggt 1561cacgtcatcatcccacaatcgctatgagacggtggaaatggtcttcattgccacagtgac 1621aggctccctgagcctggtgactgtcgtgggcaacatcctggtgatgctgtccatcaaggt 1681caacaggcagctgcagacagtcaacaactacttcctcttcagcctggcgtgtgctgatct 1741catcataggcgccttctccatgaacctctacaccgtgtacatcatcaagggctactggcc 1801cctgggcgccgtggtctgcgacctgtggctggccctggactgcgtggtgagcaacgcctc 1861cgtcatgaaccttctcatcatcagctttgaccgctacttctgcgtcaccaagcctctcac 1921ctaccctgcccggcgcaccaccaagatggcaggcctcatgattgctgctgcctgggtact 1981gtccttcgtgctctgggcgcctgccatcttgttctggcagtttgtggtgggtaagcggac 2041ggtgcccgacaaccagtgcttcatccagttcctgtccaacccagcagtgacctttggcac 2101agccattgctggcttctacctgcctgtggtcatcatgacggtgctgtacatccacatctc 2161cctggccagtcgcagccgagtccacaagcaccggcccgagggcccgaaggagaagaaagc 2221caagacgctggccttcctcaagagcccactaatgaagcagagcgtcaagaagcccccgcc 2281cggggaggccgcccgggaggagctgcgcaatggcaagctggaggaggcccccccgccagc 2341gctgccaccgccaccgcgccccgtggctgataaggacacttccaatgagtccagctcagg 2401cagtgccacccagaacaccaaggaacgcccagccacagagctgtccaccacagaggccac 2461cacgcccgccatgcccgcccctcccctgcagccgcgggccctcaacccagcctccagatg 2521gtccaagatccagattgtgacgaagcagacaggcaatgagtgtgtgacagccattgagat 2581tgtgcctgccacgccggctggcatgcgccctgcggccaacgtggcccgcaagttcgccag 2641catcgctcgcaaccaggtgcgcaagaagcggcagatggcggcccgggagcgcaaagtgac 2701acgaacgatctttgccattctgcttgccttcatcctcacctggacgccctacaacgtcat 2761ggtcctggtgaacaccttctgccagagctgcatccctgacacggtgtggtccattggcta 2821ctggctctgctacgtcaacagcaccatcaaccctgcctgctatgctctgtgcaacgccac 2881ctttaaaaagaccttccggcacctgctgctgtgccagtatcggaacatcggcactgccag 2941gtaggcggccgcgatatcgcccctctccctcccccccccctaacgttactggccgaagcc 3001gcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtctt 3061ttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtc 3121tttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctc 3181tggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccc 3241cacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaagg 3301cggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctct 3361cctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggat 3421ctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtc 3481taggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataagccacca 3541tggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacg 3601gcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacg 3661gcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccc 3721tcgtgaccaccttcggctacggcctgatgtgcttcgcccgctaccccgaccacatgaagc 3781agcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttct 3841tcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctgg 3901tgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcaca 3961agctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacg 4021gcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccg 4081accactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccact 4141acctgagctaccagtccaaactgagcaaagaccccaacgagaagcgcgatcacatggtcc 4201tgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtgag 4261aattcgatatcaagcttatcgataatcaacctctggattacaaaatttgtgaaagattga 4321ctggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctt 4381tgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggt 4441tgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactg 4501tgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccg 4561ggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgccc 4621gctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaat 4681catcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtcct 4741tctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccgg 4801ctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttggg 4861ccgcctccccgcatcgataccgagcgctgctcgagagatctacgggtggcatccctgtga 4921cccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgt 4981cctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggg 5041gtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcgg 5101ggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgc 5161ctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatg 5221catgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggc 5281caggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgct 5341gggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccac 5401gtgcggaccgagcggccgcaggaacccctagtgatggagttggccactccctctctgcgc 5461gctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgg 5521gcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcggtatttt 5581ctccttacgcatctgtgcggtatttcacaccgcatacgtcaaagcaaccatagtacgcgc 5641cctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacac 5701ttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcg 5761ccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctt 5821tacggcacctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgc 5881cctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactct 5941tgttccaaactggaacaacactcaaccctatctcgggctattcttttgatttataaggga 6001ttttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcga 6061attttaacaaaatattaacgtttacaattttatggtgcactctcagtacaatctgctctg 6121atgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacggg 6181cttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgt 6241gtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcc 6301tatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttc 6361ggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatc 6421cgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatga 6481gtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgttt 6541ttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgag 6601tgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaag 6661aacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgta 6721ttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttg 6781agtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgca 6841gtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggag 6901gaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatc 6961gttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctg 7021tagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttccc 7081ggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcgg 7141cccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcg 7201gtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacga 7261cggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcac 7321tgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaa 7381aacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgacca 7441aaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaag 7501gatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccac 7561cgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaa 7621ctggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggcc 7681accacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccag 7741tggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttac 7801cggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagc 7861gaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttc 7921ccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgca 7981cgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacc 8041tctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacg 8101ccagcaacgcggcctttttacggttcctggccttttgctggccttttgct cacatgt //

REFERENCES

(39) 1 A. K. Ngugi, C. Bottomley, I. Kleinschmidt, J. W. Sander, C. R. Newton, Estimation of the burden of active and life-time epilepsy: a meta-analytic approach, Epilepsia 51, 883-890 (2010). 2 P. Kwan, S. C. Schachter, M. J. Brodie, Drug-resistant epilepsy, N. Engl. J. Med. 365, 919-926 (2011). 3 J. F. Annegers, W. A. Hauser, L. R. Elveback, Remission of seizures and relapse in patients with epilepsy, Epilepsia 20, 729-737 (1979). 4 F. Rosenow, H. Lders, Presurgical evaluation of epilepsy, Brain J. Neurol. 124, 1683-1700 (2001). 5 S. U. Schuele, H. O. Lders, Intractable epilepsy: management and therapeutic alternatives, Lancet Neurol. 7, 514-524 (2008). 6 J. de Tisi et al., The long-term outcome of adult epilepsy surgery, patterns of seizure remission, and relapse: a cohort study, Lancet 378, 1388-1395 (2011). 7 R. C. Wykes et al., Optogenetic and potassium channel gene therapy in a rodent model of focal neocortical epilepsy, Sci. Transl. Med. 4, 161 ra152 (2012). 8 J. T. Paz et al., Closed-loop optogenetic control of thalamus as a tool for interrupting seizures after cortical injury, Nat. Neurosci. 16, 64-70 (2013). 9 E. Krook-Magnuson, C. Armstrong, M. Oijala, I. Soltesz, On-demand optogenetic control of spontaneous seizures in temporal lobe epilepsy, Nat. Commun. 4, 1376 (2013). 10 Y. Pei, S. C. Rogan, F. Yan, B. L. Roth, Engineered GPCRs as tools to modulate signal transduction, Physiol. Bethesda Md 23, 313-321 (2008). 11 B. N. Armbruster, X. Li, M. H. Pausch, S. Herlitze, B. L. Roth, Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand, Proc. Natl. Acad. Sci. U.S.A. 104, 5163-5168 (2007). 12 S. M. Ferguson et al., Transient neuronal inhibition reveals opposing roles of indirect and direct pathways in sensitization, Nat. Neurosci. 14, 22-24 (2011). 13 P. Chang, K. S. Hashemi, M. C. Walker, A novel telemetry system for recording EEG in small animals, J. Neurosci. Methods 201, 106-115 (2011). 14 P. Wulff, B. R. Arenkiel, Chemical genetics: receptor-ligand pairs for rapid manipulation of neuronal activity, Curr. Opin. NeurobioL 22, 54-60 (2012). 15 E. D. Louis, P. D. Williamson, T. M. Darcey, Chronic focal epilepsy induced by microinjection of tetanus toxin into the cat motor cortex, Electroencephalogr. Clin. Neurophysiol. 75, 548-557 (1990). 16 K. E. Nilsen, M. C. Walker, H. R. Cock, Characterization of the tetanus toxin model of refractory focal neocortical epilepsy in the rat, Epilepsia 46, 179-187 (2005). 17 O. C. Cockerell, J. Rothwell, P. D. Thompson, C. D. Marsden, S. D. Shorvon, Clinical and physiological features of epilepsia partialis continua. Cases ascertained in the UK, Brain J. Neurol. 119 (Pt 2), 393-407 (1996). 18 A. R. Garner et al., Generation of a synthetic memory trace, Science 335, 1513-1516 (2012). 19 G. M. Alexander et al., Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors, Neuron 63, 27-39 (2009). 20 R. J. Baldessarini et al., Tissue Concentrations of Clozapine and its Metabolites in the Rat, Neuropsychopharmacology 9, 117-124 (1993). 21 C. Guitton, M. Abbar, J. M. Kinowski, P. Chabrand, F. Bressolle, Multiple-dose pharmacokinetics of clozapine in patients with chronic schizophrenia, J. Clin. Psychopharmacol. 18, 470-476 (1998). 22 M. J. Cook et al., Prediction of seizure likelihood with a long-term, implanted seizure advisory system in patients with drug-resistant epilepsy: a first-in-man study, Lancet Neurol. 12, 563-571 (2013). 23 R. Hovorka, Closed-loop insulin delivery: from bench to clinical practice, Nat. Rev. Endocrinol. 7, 385-395 (2011). 24 Majeed Z R, Nichols C D, Cooper R L. 5-HT stimulation of heart rate in Drosophila does not act through cAMP as revealed by pharmacogenetics. J Appl Physiol. December; 115(11):1656-65 (2013). 25 Shah V N, Shoskes A, Tawfik B, Garg S K. Closed-loop system in the management of diabetes: past, present, and future. Diabetes Technol Ther. August; 16(8):477-90 (2014). 26 Ktzel D, Nicholson E, Schorge S, Walker M C, Kullmann D M. Chemical-genetic attenuation of focal neocortical seizures. Nat Commun. May 27;5:3847. doi: 10.1038/ncomms4847 (2014). 27 Chen et al The First Structure-Activity Relationship Studies for Designer Receptors Exclusively Activated by Designer Drugs. ACS Chem Neurosci. 2015 Jan. 27