Method for increasing efficiency of homologous recombination-based gene editing in plant

Abstract

A method for increasing the efficiency of homologous recombination-based gene editing in a plant according to an embodiment of the present invention includes optimizing temperature and photoperiod conditions during tissue culture of plant cells, expressing factors required for homology-directed DNA repair (HDR) and factors for increasing the HDR efficiency by using a multiple replicon, or regulating the HDR pathway or non-homologous end joining (NHEJ) pathway.

Claims

1. A method for increasing efficiency of homologous recombination-based gene editing in gene editing of a plant, the method comprising: transforming a plant cell with a vector comprising: a coding sequence of at least one nuclease selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Franciselia 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) and a functional homolog thereof; a coding sequence of a guide RNA capable of inducing the at least one nuclease to a target genome site to be edited; and a geminivirus-based multiple replicon; and tissue-culturing the transformed plant cell, wherein the tissue-culturing comprises a first cultivation at 31 to 33° C. for the first 4 to 6 days, followed her a second cultivation at 26 to 30° C. for the next 4 to 6 days.

2. The method of claim 1, wherein the tissue-culturing comprises short day conditions consisting of a light period for 6 to 10 hours and a dark period of 14 to 18 hours.

3. The method of claim 1, wherein the geminivirus-based multiple replicon has three large intergenic regions (LIRs) and three small intergenic regions (SIRs).

4. The method of claim 1, further comprising: activating homology-directed DNA repair (HDR) pathway by regulating expression of one or more selected from the group consisting of RPA1A (replication protein A), RPA1B, RPA1C, RPA1D, RAD51B (RAD51 paralog B), RAD51C, RAD51D, RAD51, DMC1 (DNA Meiotic Recombinase 1), RAD52-1, RAD52-2, RAD54, XRCC1 (X-Ray Repair Cross Complementing 1), XRCC2, XRCC3, ATM (ATM Serine/Threonine Kinase), XRS2/NBS (MRN/X), Mre1 1 (MRN/X), rad50 (MRN/X), Brca1 (BRCA1, DNA repair associated), Brca2A, Brca2B, CtlP/Com1/Sae2 or exo1, or by a treatment with an activator of the HDR pathway.

5. The method of claim 1, further comprising: inhibiting a non-homologous end joining (NHEJ) pathway by regulating expression of one or more selected from the group consisting of KU70 (XRCC6), KU80 (XRCC5) and LIG4 or by a treatment with an inhibitor of the NHEJ pathway.

6. The method of claim 1, wherein AtTrp1 (Arabidopsis thaliana telomeric repeat-binding protein) intron consisting of the nucleotide sequence of SEQ ID NO. 1 is inserted in coding sequence of the at least one nuclease.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 illustrates (A) result showing the HDR efficiency depending on various temperature conditions of a treatment, (B) diagram of the reporter construct used for measurement of the HDR efficiency, (C) result showing that the efficiency of HDR-based gene editing has increased in accordance with a treatment with SCR7 pyrazine, which inhibits the NHEJ pathway, and (D) image of tomato plant which overexpresses anthocyanin due to HDR.

(2) FIG. 2 is a diagram illustrating the strategy of the present invention for increasing, from the low HDR efficiency of initial plant somatic cells, the HDR efficiency in which the strategy of increasing the HDR efficiency is based on breaking double strands, increasing the copy number of HDR template, enhancing the activity of transformation/CRISPR gene scissors or HDR pathway, blocking the NHEJ pathway, enhancing the activity by expressing the enzymes of HDR pathway, and use of a multiple replicon or the like.

(3) FIG. 3 is a diagram summarizing the result of determining the culture conditions for increasing the HDR efficiency using a tomato. Seed germination: treatment at 25° C. for 3 to 4 days at dark conditions and 3 to 4 days at light conditions; precultivation: 25° C. at dark conditions for 1 day; main cultivation: 25° C. at dark conditions for 2 days; subsequent cultivation: after removing Agrobacterium by washing 2 times with timentin or cefotaxime and drying over sterile Whatman paper, cultivation for 5 days, in the same selection medium at 25-31° C., light/dark period conditions followed by subsequent cultivation with an interval of 10 to 12 days.

(4) FIG. 4 shows an image of tomato plant overexpressing anthocyanin, which is obtained by HDR-based gene editing resulting from initial search. HR ex 6-light/-dark means cultivation of serial number (i.e., 6.sup.th) of the HR experiment under light or dark conditions for 10 days.

(5) FIG. 5 illustrates the simplest structure of CRISPR/Cpf1-based HDR construct.

(6) FIG. 6 shows dCRISPR/Cpf1-based HDR upgrade construct and control construct.

(7) FIG. 7 shows a result exhibiting the HDR efficiency per cell with CRISPR construct at different temperature conditions. In the figure, *: p<0.05, ns: no significantly different.

(8) FIG. 8 shows the result exhibiting the HDR efficiency per cell with CRISPR construct under different photoperiod.

(9) FIG. 9 shows an image of a plant with HDR event in which CRISPR/Cpf1-based construct has been used.

(10) FIG. 10 shows a change in the HDR efficiency according to a treatment with NHEJ inhibitor (SCR7 pyrazine).

(11) FIG. 11 shows CRISPR/Cpf1 and dCas9-sun constructs which can induce overexpression of a HDR pathway factor.

(12) FIG. 12 is a diagram illustrating the structure of BeYDV-derived replicon.

(13) FIG. 13 shows the DNA constitution within ANT1 HDR template.

(14) FIG. 14 shows the result of PCR analysis for determining the release of each virus vector in the genomic DNA which has been separated after different cultivation period from the cotyledon transformed with Agrobacterium containing BeYDV vector pLSL.R.GGFP, in which the analysis was made by using a specific primer for amplifying the junction part of LIR region.

(15) FIG. 15 shows the result of PCR analysis for determining the release of each virus vector in the genomic DNA which has been separated after different cultivation period from the cotyledon transformed with Agrobacterium containing BeYDV vector pLSL.GFP.R, in which the analysis was made by using a specific primer for amplifying the junction part of LIR region.

(16) FIG. 16 shows the result of the kinetic analysis of the release pattern of virus copies of BeYDV vector pLSL.R.GGFP and pLSL.GFP.R.

(17) FIG. 17 shows the multiple replicon system and the replicon separated from the system. Three replicons are formed of three LIRs and three SIRs. Various HDR promoting factors in which the HDR template is formed of a single replicon to contain genomic DNA and Cpf1 expressing construct are expressed in other replicons.

DETAILED DESCRIPTION

(18) To achieve the above-described object of the present invention, the present invention provides a method for increasing efficiency of homologous recombination-based gene editing in gene editing of a plant using a gene scissors system, including optimizing temperature and photoperiod conditions during tissue culture of plant cells, using a multiple replicon, or regulating homology-directed DNA repair (HDR) pathway or non-homologous end joining (NHEJ) pathway.

(19) According to the method of one embodiment of the present invention, a method for increasing the efficiency of homologous recombination-based gene editing in a plant, in which the method includes optimizing temperature and photoperiod conditions during tissue culture of plant cells, using a multiple replicon, and regulating the HDR pathway or NHEJ pathway by using a multiple replicon, is provided.

(20) In the method according to one embodiment of the present invention, the optimized temperature conditions of the tissue culture may be cultivation at 29 to 33° C. for the first 4 to 6 days after cocultivation of plant tissues followed by cultivation at 26 to 30° C. for the next 4 to 6 days, and preferably cultivation at 31° C. for the first 5 days followed by cultivation at 28° C. for the next 5 days, but not limited thereto. The optimized photoperiod conditions of the tissue culture may be short day conditions consisting of a light period for 6 to 10 hours and a dark period of 14 to 18 hours, and preferably a light period for 8 hours and a dark period of 16 hours, but not limited thereto. The optimized photoperiod conditions may vary depending on a type of a plant.

(21) In the method according to one embodiment of the present invention, the replicon is a geminivirus-based replicon, and the geminivirus-based replicon according to the present invention may be BeYDV (Bean Yellow Dwarf virus), but not limited thereto.

(22) The method according to one embodiment of the present invention is characterized in that, by constructing a multiple replicon system having HDR template, gRNA, and expression gene with three LIRs (large intergenic region) and three SIRs (small intergenic region), which are related to the regulation of HDR pathway, copy number of the HDR template is maximized and also various factors are expressed simultaneously at high level (FIG. 17). More specifically, the replicon according to the present invention may consist of the nucleotide sequence of SEQ ID NO. 28, but it is not limited thereto.

(23) In the method according to one embodiment of the present invention, the regulation of HDR pathway may be activation of the HDR pathway by regulating the expression (i.e., induction or inhibition) of RPA1A (replication protein A), RPA1B, RPA1C, RPA1D, RAD51B (RAD51 paralog B), RAD51C, RAD51D, RAD51, DMC1 (DNA Meiotic Recombinase 1), RAD52-1, RAD52-2, RAD54, XRCC1 (X-Ray Repair Cross Complementing 1), XRCC2, XRCC3, ATM (ATM Serine/Threonine Kinase), XRS2/NBS (MRN/X), Mre11 (MRN/X), rad50 (MRN/X), Brca1 (BRCA1, DNA repair associated), Brca2A, Brca2B, CtlP/Com1/Sae2 or exo1, or activation of the HDR pathway by a treatment with an activator of the HDR pathway. The regulation of NHEJ pathway may be inhibition of the NHEJ pathway by inhibiting the expression of one or more selected from the group consisting of KU70 (XRCC6), KU80 (XRCC5) and LIG4 or by a treatment with an inhibitor therefor.

(24) In the method according to one embodiment of the present invention, the gene scissors system may contain, as an effective component, one or more nuclease selected from the group consisting of Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease), and a functional homolog thereof, and a guide RNA capable of inducing the nuclease to a target genome site to be edited, but it is not limited thereto.

(25) In the method according to one embodiment of the present invention, the nuclease is characterized in that AtTrp1 (Arabidopsis thaliana telomeric repeat-binding protein) intron consisting of the nucleotide sequence of SEQ ID NO. 1 is inserted to 3′ of the coding sequence of the nuclease. More specifically, when the nuclease is SpCas9 (Streptococcus pyogenes Cas9), AtTrp1 intron sequence may be inserted to the 117 nt nucleotide position from the A of ATG of the coding sequence of SpCas9, and, when the nuclease is LbCpf1 (Lachnospiraceae bacterium ND2006 Cpf1), AtTrp1 intron sequence may be inserted to the 138 nt nucleotide position from the A of ATG of the coding sequence of LbCpf1.

(26) The HDR efficiency currently achieved in a plant system is extremely low, and thus industrial use of HDR as a gene editing technique is inappropriate. Problems to be solved for increasing the HDR efficiency are as described below: 1) To achieve stable expression of nuclease like Cas9 and Cpf1 for effectively inducing DNA double strand break at a target gene site, since the double strand break is known to increase the HDR efficiency 2) To achieve stable replication of virus replicon, since HDR is dependent on copy number of HDR template 3) To optimize the transformation to have efficient delivery of the parts of gene scissors to inside of plant cells using Agrobacterium 4) To have high activity of Cas9 and Cpf1 when they are operating in a plant system 5) To achieve expression optimization based on cloning assembly optimization of several bioparts that are used for HDR. 6) To establish a genetic and chemical environment for achieving expression optimization of factors which participate in HDR.

(27) To solve the problems that are described above, the present invention provides an optimization strategy and technique for each different stage.

(28) I. HDR Effect According to DNA Double Stand Break

(29) DNA double strand break is one of the critical elements for increasing the HDR efficiency. In the present invention, to have double strand break at a target site, human codon-optimized SpCas9 (SEQ ID NO. 30) or LbCpf1 (SEQ ID NO. 31) was used. By introducing AtTrp1 (Arabidopsis thaliana telomeric repeat-binding protein) intron (SEQ ID NO. 1) having an enhancer activity to CDS of SpCas9 and LbCpf1, stability of the gene expression and RNA to be expressed was achieved. Both SpCas9 and LbCpf1 CDS worked well for inducing tomato HDR, and the working efficiency thereof varied sensitively depending on a choice of the gRNA. According to one experiment in which LbCpf1 is used, two gRNAs having a separation distance of 50 nt or so exhibited better HDR effect than the double strand break using single gRNA. Furthermore, in order to achieve the stable expression of SpCas9 or LbCpf1, AtUBQ1 (Arabidopsis thaliana ubiquitin extension protein 1) number 1 intron (SEQ ID NO. 2) having an enhancer activity was added to the 5′UTR of 35S promoter, and stable expression was obtained accordingly.

(30) II. Preparation of Replicon for Increasing HDR Efficiency

(31) As HDR is dependent on copy number of HDR template, to have stable replication optimization of bean dwarf mosaic virus replicon, Kozak consensus sequence (SEQ ID NO. 3) was inserted in front of the initiation codon of Rep gene, and the translation efficiency of Rep was obtained accordingly.

(32) III. Separate Preparation of Replicon-T-DNA for Increasing HDR Efficiency

(33) Bean dwarf mosaic virus replicon was housed within T-DNA and introduced to plant cells by using Agrobacterium. It is known that, as the size of the replicon increases, the replicon would have inferior stability, transformability, or the like, and less copy number in plant cells. If the replicon size is excessively large as expression of various factors is required, it is possible to infect the same plant cells simultaneously by using two independent Agrobacteria, each containing different replicon T-DNA. However, as this method has poorer efficiency compared to the single Agrobacterium method, the inventors of the present invention used a multiple replicon system. According to transformation with single T-DNA having multiple replicon housed therein and separation into 2 or more replicons for working within cells, it can contribute to increasing the HDR efficiency. As the multiple replicon system of the present invention has 3 LIRs and 3 SIRs, it has a characteristic of being separated into 3 replicons at maximum when injected to cells (FIG. 17).

(34) IV. Optimization of Culture Conditions for Plant Cells after Transformation Using Agrobacterium

(35) Unlike animal cells, plants cells have a thick cell wall. As such, for the gene delivery using Agrobacterium, efficient delivery of parts of gene scissors to inside of plant cells using Agrobacterium is generally required, and also optimization of the forming and replication of a replicon from delivered T-DNA, expression of various tools of gene scissors, or the like is need.

(36) To achieve those described in the above, the medium conditions for culturing plant cells like hormones for optimizing the transformation of plant cells using Agrobacterium have to be optimized. In addition, temperature and photoperiod (light treatment) conditions need to be optimized. In the present invention, temperature conditions of 19, 25, 28 and 31° C. were tested. As the temperature increases, the HDR efficiency has increased in all systems in which SpCas9 or LbCpf1 is used. However, at the higher concentrations, the long-time treatment increased the HDR events but the regeneration rate into a plant with an occurrence of HDR event was low. Thus, the optimum time was determined for 28° C. and 31° C. treatment, and, in the present invention, a 28° C./31° C. treatment for 5 days/5 days was selected. Furthermore, as a result of examining the HDR efficiency under dark conditions and dark/light period conditions like short-day treatment and long-day treatment, it was found that, in terms of the HDR efficiency, there is a no significant difference in SpCas9 systems at different photoperiod conditions. However, LbCpf1 system showed higher HDR efficiency from the photoperiod treatment compared to the dark period treatment. In addition, the short-day treatment exhibited higher HDR efficiency compared to the long-day treatment.

(37) V. Necessity of Arrangement Optimization of Cassette Having Various Bioparts within Replicon

(38) In Order to Achieve the HDR with High Efficiency, it is Necessary to Optimize the expression through cloning assembly optimization of various bioparts that are used for HDR. Gene expression or copy number of the replicon may be affected by location, direction, or the like of a promoter or a terminator. In particular, a caution should be taken in examining the type of a promoter included in DNA, which is used as HDR template, so as to avoid forming of an RNA double strand.
VI. Genetic Optimization of HDR Pathway

(39) For having genetic regulation of expression to achieve the optimized expression of factors which participate in HDR, genes of the HDR pathway present in tomato were examined first. According to the analysis of expression of the factors relating to the HDR pathway (RPA1A (replication protein A), RPA1B, RPA1C, RPA1D, RAD51B (RAD51 paralog B), RAD51C, RAD51D, RAD51, DMC1 (DNA Meiotic Recombinase 1), RAD52-1, RAD52-2, RAD54, XRCC1 (X-Ray Repair Cross Complementing 1), XRCC2, XRCC3, ATM (ATM Serine/Threonine Kinase), XRS2/NBS (MRN/X), Mre11 (MRN/X), rad50 (MRN/X), Brca1 (BRCA1, DNA repair associated), and Brca2A, Brca2B, CtlP/Com1/Sae2, exo1), S1MRE11, RAD51D, XRRC2, BRCA2, RAD54, ATM, RAD51, RAD52-1, and RAD51B genes were selected as a target gene. Then, one or two gRNA recognizing the promoter site were designed such that they can be expressed with use of a U6 promoter, and, at the same time, dCas9-sun tag//scAb-VP64 was expressed by using 35S promoter-5′ UTR UBQ1 intron. In this case, dCas9-sun tag binds to the promoter via gRNA, and sun tag promotes the transcription via its binding to scAb (single chain Antibody)-VP64 activation effector. As an alternative mode, it is possible that a binding motif of pumilio protein or other RNA binding protein is linked to gRNA so that activation effector including VP64 can be directly collected by pumilio, or an amplification system of pumilio-sun tag//scAb-VP64 type can be used. In this case, the pumilio protein can be replaced with an RNA binding protein like MS2 (MS2 bacteriophage capsid RNA-binding protein) and dCsy4 (catalytically inactive Csy4), and VP64 can be also replaced with various activation effectors.

(40) TABLE-US-00001 TABLE 1 gRNA of HDR pathway-related factors gRNA1HDR (SEQ ID NO.) Strand gRNA2HDR Strand 1 S1MRE11 ATCAAGTTAACGTTTA m ATTAGAGATTAT m TCTT (SEQ ID NO. 4) AAATTTAA (SEQ ID NO. 5) 2 RAD51D tttacaataatatatagtaa p aagttgttagctagagtttc p (SEQ ID NO. 6) (SEQ ID NO. 7) 3 XRRC2 TTTTAAAAGAAAAAAT m atacatatttatgtttgtta p TAAA (SEQ ID NO. 8) (SEQ ID NO. 9) 4 BRCA2 tgcccaactaacgctcaaaa p tgataataacaaaaatgacg p (SEQ ID NO. 10) (SEQ ID NO. 11) 5 RAD54 AAAAAAATTTGTATGT m tattattttatgttattga p TGTT (SEQ ID NO. 12) (SEQ ID NO. 13) 6 ATM tagcatatgaccaaaataaa p taacaaaacagaaaaagaa p (SEQ ID NO. 14) g (SEQ ID NO. 15) 7 RAD51 atgtgacccaatactttaag p tatacccttaaactatattc p (SEQ ID NO. 16) (SEQ ID NO. 17) 8 RAD52-1 TTCTATGCATAAATAA m gagagaaagaagcctcctc p TTAA (SEQ ID NO. 18) a (SEQ ID NO. 19) 9 RAD51B AGCTCTAAATGATAAA m GTTG (SEQ ID NO. 20) *m: minus strand; p: plus strand
VII. Chemical and Genetic Optimization of HDR Pathway

(41) As a method which can be used either simultaneously or separately from the approaching method of above VI, there is a method of activating HDR pathway-regulating proteins by using chemical factors. In this regard, as a result of using RS-1 which works as an activators of RAD51, it was found that the HDR efficiency has increased by approximately 3 times.

(42) VIII. HDR Optimization Via Genetic Regulation of Factors Inhibiting HDR or NHEJ Pathway in Competitive Relationship with HDR Pathway

(43) As a well-known protein of the NHEJ pathway, which is in competitive relationship with the HDR pathway, there are KU70 (XRCC6), KU80 (XRCC5), LIG4 and the like. In addition, various genes such as SMC6B, AtMMS21 (SMC5/6 component), ABO4, FAS1, RFC1, INO80, RecQ4a, FANCM, RecQ4b, RTEL1, or the like of which genetic mutation is known to promote HDR are present.

(44) In the present invention, a method of increasing the HDR efficiency according to blocking of the NHEJ pathway by using Scr7 pyrazine chemical compound, which is an inhibitor of ligase IV of the NHEJ pathway in competitive relationship with the HDR pathway, was employed. As a result, when Scr7 pyrazine is used, the HDR efficiency had increased by 4 times compared to the comparative control group.

(45) Hereinbelow, the present invention is explained in detail in view of the examples. However, the following examples are given only for exemplification of the present invention, and it is evident that the scope of the present invention is not limited by the examples.

(46) Materials and Methods

1. Experimental Materials

(47) The materials and reagents that are used in the present invention are as described in the following Table 2.

(48) TABLE-US-00002 TABLE 2 Materials and reagents used in the present invention Source Source Plant materials Reagents Tomato variety Cultivar Local Plant hormones; Sigma, USA; Hong-Kwang company Acetosyringone; DUCHEFA Bacteria Hydrocarbon; β-D Biochemie B.V., The Escherichia coli 10-beta NEB, USA Glucuronide (X- Netherlands Gluc); Chemicals for Agrobacterium GNU. plant tissue culture; tumefaciens Korea MS salts and GV3101::pMP90 vitamins; MS salts DNA vectors and B5 vitamins, pTC147 Addgene, PhytoAgar, Maltose. pTC217 USA Golden Gate tool kit MoClo Tool kit Reagents dNTPs Fermentas, H.sub.2O Treated with Lithuania Millipore system (USA) Phusion TaqDNA Kits polymerase PfuDNA polymerase RevertAid ™ H Fermentas, Lithuania minus reverse transcriptase (1.sup.stcDNAstrandsynthesis) T4 DNA ligase NEB, USA FirstChoice ® RLM- Invitrogene (Life RACE (5 RACE) Technology) Restriction enzymes (BpiI, CloneJE ™ PCR Fermentas, Lithuania BsaI and others) cloning T7E1 endonuclease Plasmid DNA BIOFACT, Korea; isolation kit (mini Qiagen, Germany and midi); DNA extraction kit Total genomic DNA Qiagen, Germany isolation kit (mini preps); Total RNA extraction kit

2. DNA Amplification Using PCR

(49) Composition of the PCR reactant and PCR amplification conditions used in the present invention are as described in the following Tables 3 and 4.

(50) TABLE-US-00003 TABLE 3 Composition of PCR reactant Component Concentration Use amount (μl) Reaction buffer 10X 2 dNTPs 2.5 mM 2 Forward primer 10 μM 1 Reverse primer 10 μM 1 Template DNA 1-10 ng 1 Taq polymerase 1 U/μl 1 Distilled water — up to 20

(51) TABLE-US-00004 TABLE 4 Conditions of PCR reaction Temperature Number Step (° C.) Time of cycle 1 94-95 4-5 min 1 Predenaturation 2 94-95 20-60 seconds 20-40 Denaturation 3 primer Tm 20-60 seconds Annealing 4 72 to 1 min/kb Extension 5 72 1-10 min 1 Final extension 6  4-15 ∞ — Storage

3. Agro-Infiltration

(52) Agrobacterium tumefaciens GV3101::pMP90 strain was transformed with each HDR vector. Agrobacterium-mediated transient expression in tomato leaves was carried out by a pressure infiltration method. The Agrobacterium culture was cultured until the absorbance at 600 nm reaches 1.0, and, one hour before the infiltration, the culture was subjected to a treatment with 20004 acetosyringone.

4. Tomato Transformation and Virus Infection

(53) Cotyledon explants of a tomato derived from Hong-Kwang variety, which has been cultivated in vitro conditions, were transformed by using Agrobacterium containing the HDR construct. Sterile seeds of Hong-Kwang variety were cultured in ½ MS medium (pH 5.8) containing 30 g/1 sucrose at a temperature condition of 25±2° C. under light conditions for 16 hours/and dark conditions for 8 hours. The 7-day old shoots were collected and the cotyledons were finely chopped to a size of 0.2 to 0.3 cm. The finely-chopped pieces (i.e., explants) were placed in a plate containing the precultivation medium (MS basal salts, Gamborg B5 vitamins, 2.0 mg/l of Zeatin trans-isomer, 0.1 mg/l of indolyl acetic acid (IAA), 1 mM of putrescine, 30 g/l of glucose, pH 5.8) to have a pre-treatment for 1 day. The precultivated explants were poked with a sharp subject, and then transformed with Agrobacterium tumefaciens GV3101::pMP90 which contains the HDR construct. After that, the explants were transferred to a cocultivation medium and cultivated for 2 days at 25° C. under dark conditions. Then, the explants were transferred to a non-selective medium and cultivated for 5 days followed by subculture using a selective medium. The subculture was carried out with an interval of 10 days to obtain the maximum regeneration efficiency. When the stem has grown to a sufficient level (i.e., 1.5 to 3.0 cm), transfer to a rooting medium was made to have a fully grown plant. The plant grown from the rooting medium was acclimated by transfer to a vermiculite pot, and then transferred again to soil of a greenhouse which is maintained at temperature conditions of 26±2° C. and photoperiod of light for 16 hours/dark for 8 hours.

5. PCR-Based Detection of Release of BeYDV Replicon

(54) To analyze the kinetic tendency of release of BeYDV circular replicon, single-constitution single-constitution BeYDV vector pLSL.GFP.R, pLSL.R.GGFP and non-viral vector pAGM4723 were used.

(55) TABLE-US-00005 TABLE 5 Main vectors used in the present invention Construct name Application pLSL.GFP.R Virus Circularization detection (Cermak et. al. 2015) pLSL.R.GGFP Virus Circularization detection pAGM4723 Non-viral vector, replicon detection control pTC147 35S:ANT1 expressing, non-replicating (Cermak et. al. 2015) T-DNA transformation efficiency control pTC217 BeYDV ANT1-GT T-DNA vector with (Cermak et. al. 2015) Cas9/gRNA1b in the replicon

(56) Tomato cotyledon was transformed with Agrobacterium containing each vector described above. On day 2, day 5, day 9, day 12, day 16, and day 30 after the transformation, two cotyledons were collected from each group, washed with 400 mg/l timentin, and stored at −80° C. After that, genomic DNA was extracted from each sample by using CTAB (cetyl trimethyl ammonium bromide) method, and PCR was carried out using primers of the following Table 6. PCR product was loaded on a 1% (w/v) agarose gel, and band intensity was calculated by using Image J program (imagej.nih.gov/ij/) and standardized using GAPDH (glyceraldehyde 3-phosphate dehydrogenase).

(57) TABLE-US-00006 TABLE 6 Primers for investigating replicon forming Sequence information (5′.fwdarw.3′) Product Primer (SEQ ID NO.) size Application GR-F1 TTGAGATGAGCACTTGGGATAG  545 bp virus (SEQ ID NO. 21) circularization 35S-R5 CGTAAGCCTCTCTAACCATCTG detection in (SEQ ID NO. 22) pLSL.GFP.R GR-F1 TTGAGATGAGCACTTGGGATAG  537 bp virus (SEQ ID NO. 21) circularization tOCS-R1 GTTCTGTCAGTTCCAAACGTAAA detection in (SEQ ID NO. 23) pLSL.R.GGFP pVS1-F1 ATCTCGCGGTACATCCAATC  521 bp To detect vector (SEQ ID NO. 24) Backbone from pVS1-R1 TTCGTTCCGATGCTCTATGAC Agrobacterium in (SEQ ID NO. 25) tomato GADPH-F CCATAACCTAATTTCTCTCTC 1208 bp internal control (SEQ ID NO. 26) GADPH-R GTCATGAGACCCTCAACAAT (SEQ ID NO. 27)

6. Measurement of HDR Frequency

(58) In order to measure the HDR frequency of Cas9, 21 days after the Agrobacterium infection, purple spots were counted from the cotyledon which has been infected with pTC217 (BeYDV with Cas9/gRNA1b) virus replicon and also from the cotyledon which has been transformed with pTC147 (35S:ANT1 T-DNA) control vector. By dividing the total number of purple spots that has been counted from callus generated with pTC217 by the total number of purple spots that has been counted from callus generated with pTC147, the HDR frequency rate was estimated.

Example 1. Analysis of Homologous Recombination Efficiency Using Anthocyanin Marker

(59) To examine the efficiency of HDR-based gene scissors in tomato, to the upstream promoter site of the transcription initiation site of ANT1 gene, which is a transcription factor regulating the anthocyanin synthesis, 35S promoter was inserted via HDR so that forming of purple-colored callus was induced based on anthocyanin overexpression resulting from the activation of ANT1 gene.

(60) HDR template (SEQ ID NO. 29) was designed such that 35S promoter nucleotide sequence and pNos-NPTII-OCSt are inserted, at the upstream of the promoter, to have kanamycin resistance at the time of HDR event. In this case, the upper nucleotide sequence was 1,043 bp and the lower nucleotide sequence was 592 bp, in which the both nucleotides have sequence homology. In addition, two TALEN binding sites or dSaCas9 (D10A, N580A)/gRNA sites were added to the upstream region. For DNA double strand break, SpCas9 (Streptococcus pyogenes Cas9)/gRNA, LbCpf1 (Lachnospiraceae bacterium ND2006 Cpf1)/gRNA1, LbCpf1/gRNA1/gRNA2, or the like was used, and the design was made such that, in the HDR template, gRNA (guide RNA) complementary base sequence does not undergo any breakage with Cas9 or Cpf1, in accordance with site-specific mutation. Gene scissors replicon in the simplest form consists of SpCas9/LbCpf1, 1 or 2 gRNA, and ANT1 HR template, and dCas9 (dead Cas9)-based transcription activation system and dCas9-based HDR template accumulation system were additionally constituted. When HDR has occurred successfully, purple color was shown from the callus or plant due to the overaccumulation of anthocyanin. The HDR efficiency obtained until now was HDR event efficiency of about 20%, which is a divided value based on 35S-ANT1 vector, and one HDR plant was successfully obtained from 30 or so cotyledons.

(61) Furthermore, in order to increase the HR efficiency, temperature and light conditions were modified in many different ways.

(62) TABLE-US-00007 TABLE 7 Determination of initial temperature and light conditions for increasing HDR efficiency using tomato Hong-Kwang F.sub.1 HDR ex5 HDR ex5 HDR ex3 HDR ex3 (30 dpt, (30 dpt, No Construct 25° C. 32° C. light, 28° C.) dark, 28° C.) 1 pTC147 289/29* 282/32 413/54 411/52 2 pTC217  5/31  13/33  10/69  28/60 *Number of purple callus/cotyledon number pTC147 indicates the number of callus per cotyledon, in which anthocyanin is formed in the callus as a result of T-DNA transformation, and pTC217 indicates the number of callus by HDR per cotyledon.

(63) TABLE-US-00008 TABLE 8 Determination of HDR efficiency at other temperature conditions (results on Day 21 after cultivation) Temperature Total No (° C.) Construct explant* TPS.sup.1 HRE.sup.2 HRC.sup.3 1 19 pTC147 111 2164 pTC217 157 19 11.97 ± 6.39  0.54 ± 0.25 2 25 pTC147 131 2008 pTC217 149 30 22.08 ± 8.86  1.57 ± 0.71 3 28 pTC147 113 1714 pTC217 150 60 47.62 ± 31.40 2.72 ± 1.59 4 31 pTC147 116 1428 pTC217 141 57 44.85 ± 15.54 3.84 ± 1.10 [*Test was repeated 4 times at the same conditions, TPS; total number of purple spots, HRE; average HDR efficiency (%) relative to total explants, HRC; average HDR efficiency standardized against total number of purple spots in pTC147 as control]

(64) As shown in Table 8 above, higher HDR efficiency is obtained as the treatment is carried out at higher temperatures. Furthermore, the high standard deviations are believed to be caused by a confusion with the real gene editing, which results from the production of anthocyanin in immature tomato stem 21 days after the transformation.

(65) Furthermore, analysis was made on the HDR efficiency for a case in which CRISPR/Cpf1 system or its upgrade system have been used. As a result, it was found that the HDR event was successfully shown from the initial construct version in which CRISPR/Cpf1 system has been used. 7711-1 and 7721-1 are both a control which does not contain Rep and gRNA, respectively (Table 9). Furthermore, with CRISPR/Cpf1 upgrade version, as the directionality was optimized at the time of preparing goldengate assembly level 2 to minimize the RNAi effect which results from the construct itself of the initial version, an improved effect was obtained compared to CRISPR/Cpf1-based construct of the existing initial version, and also more enhanced HR effect than CRISPR/Cas9-based construct, which has been suggested by other research groups, was shown (Table 10).

(66) TABLE-US-00009 TABLE 9 Measurement of HDR efficiency using CRISPR/Cpf1 system No Construct Total explant TPS HRE HRC 1 7711-1 320 1 0.48 ± 0.48 0.03 ± 0.03 2 7721-1 233 1 0.46 ± 0.46 0.03 ± 0.03 3 7731-1 315 58 17.67 ± 7.86  1.01 ± 0.44

(67) TABLE-US-00010 TABLE 10 Measurement of HDR efficiency using CRISPR/Cpf1 upgrade system Temperature Total No. Construct phase* explant TPS HRE HRC 1 pTC147 5.31-5.25 63 1073 5.31-5.28 63 1154 10.31 65 1084 2 pTC217 5.31-5.25 43 23 53.46 ± 1.09 3.58 ± 0.74 5.31-5.28 69 37 54.80 ± 6.19 3.16 ± 0.64 10.31 70 47  67.80 ± 14.29 3.92 ± 0.75 3 8161-1 5.31-5.25 71 58  76.12 ± 18.96 4.51 ± 0.74 5.31-5.28 68 52 77.55 ± 5.84 4.43 ± 0.64 10.31 59 45 75.40 ± 3.97 4.44 ± 0.75 4 7731-1 5.31-5.25 70 28 40.78 ± 3.21 2.62 ± 0.55 5.31-5.28 75 25 32.25 ± 2.71 1.82 ± 0.27 10.31 75 22 29.32 ± 4.80 1.68 ± 0.09 5 82611-2 5.31-5.25 24 1 4.17 0.34 5.31-5.28 28 3 10.71  0.67 10.31 23 1 4.35 0.26 6 8131-4 5.31-5.25 67 14 21.03 ± 6.22 1.35 ± 0.44 5.31-5.28 76 11 14.27 ± 6.40 0.81 ± 0.41 10.31 52 7  12.97 ± 12.97 0.77 ± 0.77 7 8141-2 5.31-5.25 66 6 10.50 ± 4.76 0.76 ± 0.45 5.31-5.28 73 4  6.35 ± 2.72 0.37 ± 0.18 10.31 77 4  4.53 ± 2.27 0.27 ± 0.14 8 8151-1 5.31-5.25 68 10  14.0 ± 5.60 0.81 ± 0.25 5.31-5.28 66 5  8.99 ± 4.50 0.48 ± 0.25 10.31 68 3  3.33 ± 3.33 0.16 ± 0.16 [*5.31-5.25, after cocultivation, explants were treated for 5 days at 31° C., and then treated for 5 days at 25° C.; 5.31-5.28, after cocultivation, explants were treated for 5 days at 31° C., and then treated for 5 days at 28° C.; 10.31, after cocultivation, explants were treated for 10 days at 31° C.]

(68) Furthermore, the result of analyzing the HDR efficiency using CRISPR/Cpf1 upgrade version depending on photoperiod after the transformation is described in the following Table 11. It was found as shown in the following table that, in case of CRISPR/Cpf1-based construct, the efficiency has increased by almost 2 times at L/D conditions, in particular short day conditions, compared to DD conditions.

(69) TABLE-US-00011 TABLE 11 Comparison of HDR efficiency depending on photoperiod employed after transformation Total No. Construct Photoperiod explant TPS HRE HRC 1 pTC147 DD 55 1147 8L/16D 56 1116 16L/8D  62 1260 2 pTC217 DD 33 20 60.61 2.90 8L/16D 41 32 78.05 3.61 16L/8D  34 20 58.82 2.68 3 8161-1 DD 57 54 102.78 ± 30.56 4.94 ± 1.49 8L/16D 59 124 206.82 ± 11.59 9.44 ± 0.66 16L/8D  58 100 171.88 ± 3.88  7.91 ± 0.10 4 8253-2 DD 52 33  57.42 ± 39.25 2.75 ± 1.87 8L/16D 73 46  58.84 ± 33.84 2.70 ± 1.58 16L/8D  63 10 14.30 ± 4.30 0.66 ± 0.19 5 82611-2 DD 23 7 30.43 1.47 8L/16D 12 5 41.67 1.87 16L/8D  22 3 13.64 0.63 [DD: after cocultivation, explants were treated for 10 days at 31° C., dark conditions; 8L/16D: after cocultivation, explants were treated for 10 days at 31° C. with light period for 8 hours/dark period for 16 hours; 16L/8D: after cocultivation, explants were cultivated for 10 days at 31° C. with light period for 16 hours/dark period for 8 hours]

Example 2. Increased Plant Homologous Recombination Frequency According to SCR7 Pyrazine Treatment

(70) DNA repair is mostly achieved by NHEJ pathway, and HDR-based repair occurs very limitedly. According to previous studies made on mammals, it was reported that HDR efficiency can be increased by blocking the NHEJ pathway. It is reported that SCR7 pyrazine, which is an inhibitor of mammalian ligase IV, can increase HDR as much as about 19 times in mouse, or 5 times in human cell line. With regard to a plant, Nishizawa-Yokoi et. al. suggested that ligase IV plays an important role in NHEJ pathway in rice (2016, Plant Physiol. 170 (2): 653-666). However, no report has been made regarding the influence of SCR7 pyrazine on plant HDR. Accordingly, the effect of a treatment with different cultivation period (0, 1, 2 or 3 days) or different SCR7 pyrazine concentration (0, 1, 10 μM) was examined by the inventors of the present invention by using Cas9 structure pTC217 (BeYDV having Cas9/gRNA1b). As a result, it was found that the HDR frequency increases in accordance with an increase in the treatment time (period) and concentration of SCR7 pyrazine (Table 12 to Table 14).

(71) TABLE-US-00012 TABLE 12 Change in HDR efficiency depending on treatment with NHEJ inhibitor (tomato cv. Tom-Heart, 21 dpi) Construct NHEJ pTC147 (T-DNA) pTC217 inhibitor- Purple Purple SCR7 (2nd Number spot/ Purple spot/ Purple treatment) of total cotyledon spots cotyledon spots Editing concentration Conditions Temperature cotyledons (Avg.) (Total) (Avg.) (Total) efficiency* 0 16L/8D 25° C. 52 27.1 1409 0.88 46 3.2 1 μM 16L/8D 25° C. 52 22.2 1154 1 52 4.5 10 μM 16L/8D 25° C. 52 21.8 1137 2.61 136 11.9

(72) [Editing efficiency: total purple spots (pTC217)/total purple spots (pTC147)×100]

(73) TABLE-US-00013 TABLE 13 Change 1 in HDR efficiency depending on treatment period with NHEJ inhibitor (tomato cv. Hong-Kwang, 21 dpi) pTC147 (T-DNA) pTC217 Construct Purple Purple SCR7 SCR7 Number spot/ Purple spot/ Purple treatment treatment Photoperiod of total cotyledon spots cotyledon spots Editing concentration period conditions* Temperature cotyledons (Avg.) (Total) (Avg.) (Total) efficiency* 0 DD.fwdarw. 28° C. 35 23.9 839 0.32 11 1.31 16L/8D 1 μM 1 day DD.fwdarw. 28° C. 35 28.7 1005 0.55 19 1.89 16L/8D 2 days DD.fwdarw. 28° C. 35 26.9 942 0.93 32 3.39 16L/8D 3 days DD.fwdarw. 28° C. 35 23.2 813 1.8 63 7.74 16L/8D 10 μM 1 day DD.fwdarw. 28° C. 35 20.1 703 0.68 24 3.41 16L/8D 2 days DD.fwdarw. 28° C. 35 18.8 658 1.75 61 9.27 16L/8D 3 days DD.fwdarw. 28° C. 35 14.2 497 3.26 114 22.93 16L/8D

(74) [Photoperiod conditions: after dark treatment (DD) for 10 days, light treatment for 16 hours/dark treatment for 8 hours]

(75) TABLE-US-00014 TABLE 14 Change 2 in HDR efficiency depending on treatment period with NHEJ inhibitor (tomato cv. Hong-Kwang, 21 dpi) pTC147 (T-DNA) pTC217 Construct Purple Purple SCR7 SCR7 Number spot/ Purple spot/ Purple treatment treatment Photoperiod of total cotyledon spots cotyledon spots Editing concentration period conditions* Temperature cotyledons (Avg.) (Total) (Avg.) (Total) efficiency* 0 DD.fwdarw. 28° C. 35 20.9 732 0.90 31 4.23 16L/8D 1 μM 1 day DD.fwdarw. 28° C. 35 26.0 912 1.96 68 7.45 16L/8D 2 days DD.fwdarw. 28° C. 35 17.9 627 1.29 45 7.17 16L/8D 3 days DD.fwdarw. 28° C. 35 18.9 663 1.44 50 7.54 16L/8D 10 μM 1 day DD.fwdarw. 28° C. 35 22.9 802 2.60 91 11.34 16L/8D 2 days DD.fwdarw. 28° C. 35 21.5 754 2.91 102 13.52 16L/8D 3 days DD.fwdarw. 28° C. 35 18.8 660 2.85 100 15.15 16L/8D

Example 3. Kinetic Pattern of Release of BeYDV Replication Replicon

(76) The inventors of the present invention found the optimum time point of the maximum release of circular BeYDV replicon in Agrobacterium-infected tomato cotyledon system. Virus replicon tends to get expressed in circular form from a liner T-DNA which is delivered to a nucleus of plant cell, and, according to rolling circle replication, it is amplified to several hundred to several thousand copies per cell. Kinetic information about the maximum replicon release may provide information regarding the optimum time point for applying small molecules to a tissue culture system. To study the kinetic pattern of replicon release, cotyledon was transfected with Agrobacterium containing BeYDV vector pLSL.GFP.R (Cermak et. al., 2015) and pLSL.R.GGFP and non-virus vector pAGM4723. Circular virus was detected from the infected cotyledon, in which the detection is made by PCR analysis using specific primers which can amplify the junction part of two LIR regions in the separated genomic DNA. Stable presence of BeYDV replicon for 2 weeks to 8 weeks was reported previously for pLSL.GFP.R which contains Agrobacterium-infected tomato cotyledon. However, the maximum time of the release of virus copies has not been reported. By using samples of Day 2 to Day 30, the inventors of the present invention found from each analysis point that pLSL.GFP.R and pLSL.R.GGFP in BeLSV circular form are stably present. Two days after the infection, the circular replicon was at very low level in the vector system, but, after 5 days, it has suddenly increased to the maximum level in pLSL.R.GGFP vector system. In pLSL.GFP.R vector system, the maximum value gradually started to increase 9 days after the infection, while the replicon has decreased slowly but was maintained at stable level in the analysis sample during 30 days after the infection. No replicon was found from the non-virus vector sample (FIG. 14 to FIG. 16).

(77) A sequence listing electronically submitted with the present application on Jul. 22, 2020 as an ASCII text file named 20200722_Q35620GR09_TU_SEQ, created on Jul. 20, 2020 and having a size of 26,000 bytes, is incorporated herein by reference in its entirety.