Single nucleotide polymorphism marker related to Chinese horse short stature trait and use thereof
11542562 · 2023-01-03
Assignee
Inventors
- Yuehui Ma (Beijing, CN)
- Lin JIANG (Beijing, CN)
- Xuexue Liu (Beijing, CN)
- Yabin Pu (Beijing, CN)
- Yanli Zhang (Beijing, CN)
Cpc classification
C12Q1/6876
CHEMISTRY; METALLURGY
C12Q2600/124
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to a single nucleotide polymorphism (SNP) marker related to a Chinese horse short stature trait. The SNP molecular marker is located at the 501.sup.th position of a sequence shown in SEQ ID NO.1, polymorphism is G/A, and the SNP marker corresponds to base pair 18,205,998 on chromosome 8 in a horse. The SNP marker related to the Chinese horse short stature trait and use thereof provided by the present invention have the following advantages that: (1) the molecular marker is not restricted by the age, sex and the like of Chinese horses, is used in early breeding of the Chinese horses, performs accurate screening immediately at birth, and significantly promotes the breeding process of dominant pony varieties of the Chinese horse; (2) a method for detecting SNP of a Chinese horse TBX3 gene is accurate, reliable, and easy to operate.
Claims
1. A specific primer combination for detecting a single nucleotide polymorphism (SNP) marker related to a Chinese horse short stature trait, comprising: TABLE-US-00005 (SEQ ID NO: 2) primer 1: CCGAGTCTGGGAGGTCAGTCG; (SEQ ID NO: 3) primer 2: CCGAGTCTGGGAGGTCAGTCA; and (SEQ ID NO: 4) primer 3: GTCTGCAAACTTCCGCCAATTA; wherein the SNP marker is located at the 501.sup.st position of SEQ ID NO: 1, wherein the polymorphism is G/A, and wherein SEQ ID NOS: 2-3 are each labeled with fluorophores of different colors.
2. A kit or reagent comprising the specific primer combination according to claim 1.
3. A method for identifying pony varieties of Chinese horse comprising a step of detecting a single nucleotide polymorphism (SNP) marker related to a Chinese horse short stature trait using a specific primer combination consisting of SEQ ID NOS: 2-4 and identifying pony varieties of Chinese horse from the single nucleotide polymorphism (SNP) marker.
4. The method according to claim 3, wherein the method for identifying pony varieties of Chinese horse comprises the following steps: 1) extracting genomic DNA from a test horse; 2) using the genomic DNA of the test horse as a template to conduct polymerase chain reaction (PCR) amplification with the specific primer combination comprising SEQ ID NOS: 2-4, to obtain amplified products; and 3) analyzing the amplified products to determine what type of a base is located at 501.sup.st position of the amplified product having the nucleotide sequence consisting SEQ ID NO: 1 and wherein: if the base is A, then the test horse is determined to have a short stature trait; if the base is G, the test horse is determined to have a tall stature trait; wherein an idiotype with fluorescence of primer 1 labeled groups is AA, and wherein an idiotype with fluorescence of primer 2 labeled groups is GG; wherein SEQ ID NOS: 2-3 are each labeled with fluorophores of different colors.
5. The method according to claim 4 wherein, in step 2), wherein PCR conditions are as follows: step 1): 94° C. for 15 min; after which step (2) is performed; step 2): 10 cycles involving 94° C. for 20 s followed by an annealing for 1 min per each cycle, wherein the annealing temperature over 10 cycles is from 61-55° C., and the annealing temperature is reduced by a 0.6° C. decrease with each cycle; and following the completion of step (2), step (3) is performed; wherein step 3): includes 26 cycles of denaturing and annealing at 94° C. for 20 s and 55° C. for 1 min per each cycle.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
DETAILED DESCRIPTION
(2) The present invention will be described in detail below in combination with examples.
(3) The following examples intend to illustrate the invention but not to limit the scope of the invention. Unless otherwise specified, technical means used in the examples are well known to those skilled in the art, and all raw materials used are commercially available.
Example 1 Identification of Loci of TBX3 Gene Polymorphism in Chinese Horses
(4) 1. Extraction of Genomic DNAs from Blood of Test Chinese Horses
(5) Blood samples were collected from 210 ponies from Southwest China (including 19 from Debao, 34 from Bose, 35 from Wenshan, 20 from Yunnan, 15 from Lichuan, 32 from Jinjiang, 30 from Jianchang, and 25 from Guizhou), 308 horses with normal height (including 145 from Northwest China, 128 from Inner Mongolia, 24 from Northeast China, and 11 thoroughbred horses), and 11 Przewalski's horses. There were a total of 529 individuals from 21 populations. Genomic DNAs were extracted from the blood using a conventional method.
(6) TABLE-US-00003 TABLE 1 Sample collection Abbre- Sample Variety viation Sampling site size Type Barkol horse BLK Barkol Kazakh 26 Ordinary Autonomous County, type Xinjiang Heihe horse HeHe Huma County, 24 Ordinary Heilongjiang type Kazakh horse HSK Xinyuan County, 16 Ordinary Xinjiang type Mongolian MoGo Hulunbuir City, 30 Ordinary horse Inner Mongolia type Sanhe horse SaHe Hulunbuir City, 29 Ordinary Inner Mongolia type Abaga dark SeSe Xilin Gol League, 34 Ordinary horse Inner Mongolia type Thoroughbred ThB The UK 11 Ordinary horse type Wushen horse WUS Uxin Qi, Inner 27 Ordinary Mongolia type Ujimqin horse WuZh Hulunbuir City, 36 Ordinary Inner Mongolia type Xinihe horse XNH Hulunbuir City, 35 Ordinary Inner Mongolia type Yili horse YiLi Zhaosu County, 7 Ordinary Xinjiang type Yanqi horse YaQi Yanqi County, 33 Ordinary Xinjiang type Yunnan pony YuNa Honghe Hani and 20 Short Yi Autonomous stature Prefecture, Yunnan type Lichuan horse LCH Lichuan City, Hubei 15 Short stature type Jinjiang horse JiJi Jinjiang County, 32 Short Fujian stature type Baise horse BaSe Tianlin County, 34 Short Guizhou stature type Guizhou horse GuZh Bijie County, 25 Short Guizhou stature type Debao pony DeBa Debao County, 19 Short Guangxi stature type Jianchang horse JiCh Butuo County, 30 Short Sichuan stature type Wenshan horse WeSh Wenshan County, 35 Short Yunnan stature type Prewalski's PrZ Qitai County, 11 Wild horse Xinjiang horse
(7) 2. Amplification of Nucleotide Fragments Containing SNP Locus
(8) Primers were designed according to a sequence of TBX3 locus (gi 194246389:18100500-18101500 Equus caballus isolate Twilight breed thoroughbred chromosome 8, EquCab2.0, whole genome shotgun sequence) included in the National Center of Biotechnology Information (NCBI) database, including: primer 1: CCGAGTCTGGGAGGTCAGTCG (SEQ ID NO. 2), primer 2: CCGAGTCTGGGAGGTCAGTCA (SEQ ID NO. 3), and primer 3: GTCTGCAAACTTCCGCCAATTA (SEQ ID NO. 4).
(9) A nucleotide fragment where the SNP to be detected was located was amplified with the genomic DNA in step 1.1 as a template, as shown in SEQ ID NO. 1. The SNP locus was located at 501 bp of a PCR amplified fragment, where bases were A or G.
(10) Herein, an amplification system used in the PCR (in 5 μl) includes: 2.43 μl of 50-100 ng/μl template DNA, 2.50 μl of 2×KASP Master Mix, and 0.07 μl of KASP Assay Mix (mixed primer working solution).
(11) Herein, in step 2), PCR conditions were as follows: step 1): 94° C. for 15 min; step 2): 10 cycles of 94° C. for 20 s and 61-55° C. for 1 min, with a 0.6° C. decrease in each cycle; and step 3): 26 cycles of 94° C. for 20 s and 55° C. for 1 min.
(12) 3. Detection of the PCR Amplified Fragment to Obtain an SNP Marker
(13) A PCR product obtained in step 1.2 was sequenced. If a base at 501 bp of a sequence of the amplified product is A, then test Chinese horses belong to dominant pony varieties.
(14) 4. Genotyping
(15) Test Chinese horses were genotyped by TOF-MS; genotypes of SNP loci in the test populations were determined according to TOF-MS results. Genotypes were divided into AA type, GG type, and AG type according to signal distribution positions of samples. Genotyping results of the three genotypes are shown in
Example 2 Use in the Analysis and Detection of Associations Between Different Genotypes and Height Sizes of Chinese Horses
(16) A great deal of research on association between genotype and height phenotype in Chinese horse varieties from different regions was carried out in the present invention, and it was found that the SNP locus (which is located at the 501.sup.th position of a sequence shown in SEQ ID NO.1, has a polymorphism of G/A, and corresponds to base pair 18,205,998 on chromosome 8 in a horse) provided by the present invention is significantly associated with horse height (chi-square test, P<2.2e-16). Allele A had a frequency of 64.07% in ponies, while allele G had a frequency of 82.14% in ordinary horses. AA genotype had a frequency of 65.95% in ponies and 17.85% in ordinary horses; the average height of horses with AA genotype was significantly shorter than those with GG genotype (chi-square test, P<2.2e-16). This was of great significance to genotyping and screening Chinese horses with short stature trait. When the genotype of a Chinese horse was AA, the horse was determined to have a short stature trait; when the genotype of a Chinese horse was GG, the horse was determined to have a tall stature trait. This increased the accuracy and efficiency of horse height screening.
Example 3
(17) An expanded population analysis was conducted on loci of TBX3 gene polymorphism in 529 Chinese horses. In the SNP locus (which is located at the 501.sup.th position of a sequence shown in SEQ ID NO.1, has a polymorphism of G/A, and corresponds to base pair 18,205,998 on chromosome 8 in a horse), the frequency of allele A was significantly higher in ponies than in other horses with ordinary height (not ponies) (P<2.2e-16). This further verified the association between the allele A at the SNP locus and Chinese horse short stature trait (as shown in Table 2).
(18) TABLE-US-00004 TABLE 2 Numbers of genotypes at the SNP locus in Chinese ponies and ordinary horses Genotype AA (horse) AG (horse) GG (horse) Pony 88 101 21 Ordinary horse 12 86 210
(19) The present invention has been described in detail above with reference to general descriptions and particular embodiments, but it will be apparent to those skilled in the art that various modifications or variations can be made based on the present invention. Therefore, all these modifications or variations made without departing from the spirit of the invention fall within the scope of the invention.