NUCLEIC ACID AMPLIFICATION AND USE THEREOF
20190256901 ยท 2019-08-22
Inventors
Cpc classification
C12Q2545/107
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q2545/107
CHEMISTRY; METALLURGY
International classification
Abstract
The invention features compositions and methods that are useful for the measurement of the quantity of a nucleic acid target in a sample.
Claims
1. A method of amplifying a target nucleic acid molecule in the presence of a detectable nucleic acid probe and a reference nucleic acid molecule, the method comprising: amplifying the target nucleic acid molecule and the reference nucleic acid molecule in the presence of said detectable nucleic acid probe that is capable of hybridizing to the target nucleic acid molecule and the reference nucleic acid molecule, wherein the reference nucleic acid molecule is selected as having reduced or no secondary structure in the probe binding site.
2. The method of claim 1, wherein the probe binding site of the target nucleic acid molecule is selected as having reduced or no secondary structure.
3. The method of claim 1, wherein the probe binding site of the target nucleic molecule and the probe binding site of the reference nucleic acid molecule have no differences in secondary structure.
4. The method of claim 1, wherein the probe binding site of the target nucleic molecule and the probe binding site of the reference nucleic acid molecule have substantial sequence identity.
5. The method of claim 4, wherein said sequence identity is at least 90%.
6. The method of claim 1, wherein the secondary structure is a stem-loop structure or pseudoknot structure.
7. The method of claim 1, wherein the secondary structure is present at the melting temperature of the nucleic acid molecule.
8. The method of claim 1, wherein secondary structure is reduced in one or more primer binding sites of one or more of the target nucleic acid molecule and the reference nucleic acid molecule.
9. A method for detecting a target nucleic acid molecule in a sample, the method comprising the steps of: (a) amplifying the target nucleic acid molecule in the presence of a reference nucleic acid molecule and a detectable nucleic acid probe that is capable of hybridizing to the target nucleic acid molecule and the reference nucleic acid molecule; (b) identifying binding of the detectable nucleic acid probe to the target nucleic acid molecule and determining the melting temperature of the detectable nucleic acid probe to the target nucleic acid molecule; (c) identifying binding of the detectable nucleic acid probe to the reference nucleic acid molecule and determining the melting temperature of the detectable nucleic acid probe to the reference nucleic acid molecule; (d) reducing a difference in yield signal between the melting curves for the target nucleic acid molecule and the reference nucleic acid molecule; and (e) determining the quantity of the target nucleic acid molecule in the sample using the half maximal effective concentration of the reference nucleic acid molecule.
10.-18. (canceled)
19. The method of claim 1, wherein the amplifying is by polymerase chain reaction (PCR), competitive PCR, or real-time PCR.
20.-22. (canceled)
23. The method of claim 1, wherein the sample is a biological fluid or tissue sample derived from a patient.
24. The method of claim 23, wherein the sample is selected from the group consisting of blood, serum, urine, semen and saliva.
25. The method of claim 1, wherein said target nucleic acid is derived from a bacterium, a virus, a spore, a fungus, a parasite, a prokaryotic cell, or a eukaryotic cell.
26. (canceled)
27. The method of claim 1, wherein the sample is probed to identify a marker associated with a condition selected from the group consisting of neoplasia, inflammation, pathogen infection, immune response, sepsis, the presence of liver metabolites, and the presence of a genetically modified organism.
28. The method of claim 27, wherein marker identification diagnoses a neoplasia, identifies the tissue of origin of the neoplasia, monitors response of the neoplasia to treatment, or predicts the risk of developing a neoplasia.
29. The method of claim 28, wherein the neoplasia is chronic myelogenous leukemia (CML).
30. The method of claim 29, wherein the target nucleic acid is BCR-ABL.
31. The method of claim 1, wherein the target nucleic acid molecule is derived from a bacterial pathogen selected from the list consisting of Aerobacter, Aeromonas, Acinetobacter, Actinomyces israelli, Agrobacterium, Bacillus, Bacillus antracis, Bacteroides, Bartonella, Bordetella, Bortella, Borrelia, Brucella, Burkholderia, Calymmatobacterium, Campylobacter, Citrobacter, Clostridium, Clostridium perfringers, Clostridium tetani, Cornyebacterium, Corynebacterium diphtheriae, corynebacterium sp., Enterobacter, Enterobacter aerogenes, Enterococcus, Erysipelothrix rhusiopathiae, Escherichia, Francisella, Fusobacterium nucleatum, Gardnerella, Haemophilus, Hafnia, Helicobacter, Klebsiella, Klebsiella pneumoniae, Lactobacillus, Legionella, Leptospira, Listeria, Morganella, Moraxella, Mycobacterium, Neisseria, Pasteurella, Pasteurella multocida, Proteus, Providencia, Pseudomonas, Rickettsia, Salmonella, Serratia, Shigella, Staphylococcus, Stentorophomonas, Streptococcus, Streptobacillus moniliformis, Treponema, Treponema pallidium, Treponema pertenue, Xanthomonas, Vibrio, and Yersinia.
32. The method of claim 31, wherein the bacterial pathogen is antibiotic resistant.
33. The method of claim 1, wherein the target nucleic acid molecule is derived from a virus selected from the list consisting of hepatitis C virus, human immunodeficiency virus, Retrovirus, Picornavirus, polio virus, hepatitis A virus, Enterovirus, human Coxsackie virus, rhinovirus, echovirus, Calcivirus, Togavirus, equine encephalitis virus, rubella virus, Flavivirus, dengue virus, encephalitis virus, yellow fever virus, Coronavirus, Rhabdovirus, vesicular stomatitis virus, rabies virus, Filovirus, ebola virus, Paramyxovirus, parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus, Orthomyxovirus, influenza virus, Hantaan virus, bunga virus, phlebovirus, Nairo virus, Arena virus, hemorrhagic fever virus, reovirus, orbivirus, Rotavirus, Birnavirus, Hepadnavirus, hepatitis B virus, Parvovirus, Papovavirus, papilloma virus, polyoma virus, adenovirus, herpes simplex virus 1, herpes simplex virus 2, varicella zoster virus, cytomegalovirus, herpes virus, variola virus, vaccinia virus, pox virus, African swine fever virus, Norwalk virus, and astrovirus.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0066]
[0067]
[0068]
DETAILED DESCRIPTION OF THE INVENTION
[0069] As described below, the present invention features compositions and methods that provide for quantitative PCR that reduces the effect of yield difference between detection of the target nucleic acid molecule (i.e., native template; NT) and reference nucleic acid molecule (i.e., internal standard; IS) and enhances the accuracy of target nucleic acid quantitation in a sample (e.g., a biologic sample).
[0070] Advantageously, the present invention provides for the quantitative measurement of the amount of native template in a sample when the native template is amplified in the presence of a hybridization probe (e.g., a detectable probe in real-time PCR) and an internal standard, and minimizes the effect of a difference in signal yield between native template and internal standard. Detection and measurement of nucleic acid molecules in accordance with the methods of the invention arc useful for the diagnosis, monitoring, or characterization of virtually any disease characterized by an alteration in gene expression including, for example, neoplasia, inflammation, and a variety of infectious diseases.
[0071] The invention is based, at least in part, on the discovery that differences in fluorescent yield between native template and internal standard amplification products has the potential to decrease the accuracy of target nucleic acid quantitation in quantitative PCR (qPCR). Thus, adjusting for yield difference increases the accuracy of the quantitation of native template. It has been found that fluorescent yield is influenced in part by nucleic acid secondary structure (e.g., stem-loop structure) in one or more of the native template and internal standard nucleic acid molecules. Without being bound to a particular theory, secondary structure reduces binding of fluorescent probe to template during competitive PCR. Thus, it is an object of the present invention to provide a method that allows accurate quantitation where the signal yield between native template and internal standard differs.
[0072] The present invention provides a method for nucleic acid quantitation using a competitive amplification reaction that adjusts or reduces a difference in signal yield between native template and internal standard. Various means are provided for addressing this effect, without limitation. In one embodiment, probe binding sites or alternative probe binding sites are selected without secondary structure differences in one or more of the native template and internal standard. In an additional embodiment, an internal standard is selected or designed that reduces or eliminates existing secondary structure in the probe binding site of one or more of the native template and internal standard. This may be achieved by one or more nucleic acid base alterations in native template or internal standard nucleic acid molecules. It is preferable to avoid creating secondary structure with base pair changes in the internal standard. In another embodiment, one or more primer binding sites may be selected or designed to reduce or eliminate secondary structure in one or more of the native template and internal standard. In yet another embodiment, algorithms (e.g., a curve fitting algorithm) are used to scale the yield signal of the native template and internal standard amplification products and/or reduce the difference in yield signal between the native template and internal standard amplification products. Where a difference in yield signal results from the effects of secondary structure, the response curve bias may be corrected or adjusted using a curve fitting algorithm (e.g., a logistic curve fitting algorithm). Combinations of any of the above may be used to reduce the effect of a difference in yield signal between the native template and internal standard. With this approach, measurement is quantitative and instrument-to-instrument variation is minimized when measured at endpoint.
Assay System
[0073] In one aspect, the endpoint amplification product for a target nucleic acid is quantified relative to a known number of molecules of its respective internal standard within the standardized mixture of internal standards. For example, sample aliquots are added to a series of tubes (2, 3, 4, 5, 6, 7, 8, 9, 10) containing increasing numbers of copies of synthetic competitive template internal standard, and primers. Each primer pair coamplifies a native template and its respective competitive internal standard template with equal efficiency. Gene measurements are normalized to a coamplified reference gene that controls for known sources of variation, including inter-sample variation in loading due to pipetting, interfering substances such as PCR inhibitors, inter-gene variation in amplification efficiency, and false negatives. Recent reports have described the successful use of such a method to measure the gene expression of several promising biomarkers in samples of blood (Rots et al., Leukemia 2000 December; 14(12):2166-75; Peters et al., Clin Chem 2007 June; 53(6):1030-7) or other tissues. StaRT-PCR has been used successfully to identify patterns of gene expression associated with diagnosis of lung cancer (Warner et al., J Mol Diagn 2003 August; 5(3):176-83), risk of lung cancer (Crawford et al., Carcinogenesis 2007 December: 28(12):2552-9), pulmonary sarcoidosis (Allen et al., Am J Respir Cell Mol Biol 1999 December; 21(6):693-700), cystic fibrosis (Loitsch et al., Clin Chem 1999 May; 45(5):619-24), chemoresistance in lung cancer (Harr et al., Mol Cancer 2005; 4:23; Weaver et al., Mol Cancer 2005:4(1):18) childhood leukemias (Rots et al., Leukemia 2000 December; 14(12):2166-75), staging of bladder cancer (Mitra et al., BMC Cancer 2006; 6:159), and to develop databases of normal range of expression of inflammatory genes in peripheral blood samples (Peters et al., Clin Chem 2007 June; 53(6):1030-7).
[0074] Primers
[0075] The primers of the invention embrace oligonucleotides of sufficient length and appropriate sequence so as to provide specific initiation of polymerization on a significant number of nucleic acids in the polymorphic locus. Specifically, the term primer as used herein refers to a sequence comprising two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and most preferably more than 8, which sequence is capable of initiating synthesis of a primer extension product, which is substantially complementary to a polymorphic locus strand. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent for polymerization. The exact length of primer will depend on many factors, including temperature, buffer, and nucleotide composition. The oligonucleotide primer typically contains between 12 and 27 or more nucleotides, although it may contain fewer nucleotides. Primers of the invention are designed to be substantially complementary to each strand of the genomic locus to be amplified and include the appropriate G or C nucleotides as discussed above. This means that the primers must be sufficiently complementary to hybridize with their respective strands under conditions that allow the agent for polymerization to perform. In other words, the primers should have sufficient complementarity with the 5 and 3 flanking sequences to hybridize therewith and permit amplification of the genomic locus. In various embodiments, one or more primer binding sites may be selected or designed to reduce or eliminate secondary structure in one or more of the native template and internal standard. While exemplary primers are provided herein, it is understood that any primer that hybridizes with the target sequences of the invention are useful in the method of the invention for detecting a target nucleic acid.
[0076] The target nucleic acid may be present in a sample, e.g. clinical samples and biological samples. If high quality clinical samples are not used, amplification primers are designed to recognize shorter target sequences. Primer Tm is about 60+/1 C. Amplification primers are compared by homology against known sequences to ensure the binding specificity. Despite the use of DNAse in the RNA purification protocol, when possible, primers are designed to span RNA intron/exon splice junctions. Therefore, amplification of genomic contaminants will be inhibited by failure to produce full length products (typically >6 KB).
[0077] Internal Standard (IS)
[0078] For each target nucleic acid molecule or biomarker, the respective synthetic internal standard will match the native template in all but 1, 2, or 3 nucleotides within the probe binding sequence of the native nucleic acid molecule or biomarker. The probe sequence for the internal standard will be based on this rearrangement, and therefore is predicted to bind only to the internal standard sequence, but not the corresponding native template. Internal standards are formulated into a mixture that contains the internal standards at a defined concentration or number of molecule of the internal standards. For example, such internal standards are also referred to as a defined reference nucleic acid molecule, having a known concentration of the nucleic acid molecule or a known number of nucleic acid molecules.
[0079] Synthetic template oligo internal standards with mutations in the probe binding site that lower the IS binding Tm by 15 C.3 C. are designed. A sequence analysis program (e.g., DINMelt Server (Markham et al. Nucleic Acids Res 2005 (Web Server issue) 33:W577-W581)) is used to select the appropriate IS mutations. The metric for determining the successful probe and IS design is the signal-to-noise ratio (S/N) in the assay. The S/N of each assay is measured comparing the signals generated by four replicates of pure NT vs. pure IS samples.
[0080] It has been discovered that fluorescent yield is influenced in part by nucleic acid secondary structure (e.g., stem-loop structure) in one or more of the native template and internal standard nucleic acid molecules. Without being bound to a particular theory, secondary structure reduces binding of fluorescent probe to template during competitive PCR. According to the methods of the invention, secondary structure should be minimized or eliminated in the internal standard. Using single strand DNA folding prediction algorithms can be used to detect the stem loop. At Tm, a complete stem loop should have a predicted dG of >0.5, preferably >1.0, preferably >2.0. At Tm, a half stem loop (probe binding site contacts half of the stem loop), should have a dG>0.0, preferably >0.5, preferably >1.0.
[0081] In various embodiments, probe binding sites or alternative probe binding sites are selected without secondary structure differences in one or more of the native template and internal standard. In additional embodiments an internal standard is selected or designed that reduces or eliminates existing secondary structure in the probe binding site of one or more of the native template and internal standard. This may be achieved by one or more nucleic acid base alterations in native template or internal standard nucleic acid molecules. It is preferable to avoid creating secondary structure with base pair changes in the internal standard.
[0082] Probe
[0083] A PCR product (i.e., amplicon) or real-time PCR product is detected by probe binding. Probes (e.g., non hydrolyzable fluorescent) probes are designed to native template Tm. The metric for determining the successful probe and IS design is the signal-to-noise ratio (S/N) in the assay. The S/N of each assay is measured comparing the signals generated by four replicates of pure NT vs. pure IS samples.
[0084] In one embodiment, probe binding generates a fluorescent signal, for example, by coupling a fluorogenic dye molecule and a quencher moiety to the same or different oligonucleotide substrates (e.g., TaqMan (Applied Biosystems, Foster City, Calif., USA), Pleiades (Nanogen, Inc., Bothell, Wash., USA), Molecular Beacons (see, for example, Tyagi et al., Nature Biotechnology 14(3):303-8, 1996), Scorpions (Molecular Probes Inc., Eugene, Oreg., USA)). In another example, a PCR product is detected by the binding of a fluorogenic dye that emits a fluorescent signal upon binding (e.g., SYBR Green (Molecular Probes)). Such detection methods are useful for the detection of a target specific PCR product.
[0085] Quantitation
[0086] Following PCR, the concentration of the native template is calculated from the ratio (native template:internal standard template) versus known copies of internal standard included in the reaction. Gene measurements are normalized to a coamplified reference gene to control for known sources of variation, including inter-sample variation in loading due to pipetting, interfering substances, such as PCR inhibitors, inter-gene variation in amplification efficiency, and false negatives.
[0087] In various embodiments, algorithms (e.g., a curve fitting algorithm) are used to scale the yield signal of the native template and internal standard amplification products and/or reduce the difference in yield signal between the native template and internal standard amplification products. Where a difference in yield signal results from the effects of secondary structure, the response curve bias may be corrected or adjusted using a curve fitting algorithm (e.g., a logistic curve fitting algorithm). Combinations of any of the above may be used to reduce the effect of a difference in yield signal between the native template and internal standard.
[0088] In particular embodiments, target nucleic acid amplification further comprises a preamplification step. The use of the preamplification step markedly reduces the amounts of starting sample (e.g., cDNA) and reagents required for each PCR reaction. Measuring each gene relative to a known number of internal standard molecules within a standardized mixture of internal standards in each reaction controls for unpredictable inter-sample variation in the efficiency of pre-amplification caused by reagent consumption, PCR inhibitors, and/or product inhibition. A standardized mixture of internal standards controls for preferential amplification of one transcript over another due to differences in amplification efficiencies. The use of nanofluidic technology in combination with pre-amplification with multiple sets of primers and internal standards in the same reaction provides for the measurement of many genes (>100) using the RNA quantity normally required for six measurements. This allows for higher throughput that is virtually unrestricted by RNA input.
Polymerase Chain Reaction (PCR) and PCR Kinetics
[0089] The polymerase chain reaction (PCR) is a technique of amplifying or synthesizing large quantities of a target DNA segment. PCR is achieved by separating the DNA into its two complementary strands, binding a primer to each single strand at the end of the given DNA segment where synthesis starts, and adding a DNA polymerase to synthesize the complementary strand on each single strand having a primer bound thereto. The process is repeated until a sufficient number of copies of the selected DNA segment have been synthesized.
[0090] During a typical PCR reaction, double stranded DNA is separated into single strands by raising the temperature of the DNA containing sample to a denaturing temperature where the two DNA strands separate (i.e. the melting temperature of the DNA) and then the sample is cooled to a lower temperature that allows the specific primers to attach (anneal), and replication to occur (extend). In illustrated embodiments, a thermostable polymerase is utilized in the polymerase chain reaction, such as Taq DNA Polymerase and derivatives thereof, including the Stoffel fragment of Taq DNA polymerase and KlenTaq1 polymerase (a 5-exonuclease deficient variant of Taq polymerasesee U.S. Pat. No. 5,436,149); Pfu polymerase; Tth polymerase; and Vent polymerase.
[0091] PCR has a sensitivity five orders of magnitude better than the best blotting procedures. This sensitivity makes PCR desirable as a quantitative tool. However, the use of a system undergoing exponential amplification is not ideally suited to quantification. Small differences between sample sizes can become huge difference in results when they are amplified through 20-40 cycles.
[0092] A typical PCR reaction profile has three segments: an early lag phase, an exponential growth phase, and a plateau. The lag phase is mainly a reflection of the sensitivity of the instrument and the background signal of the probe system used to detect the PCR product. The exponential growth phase begins when sufficient product has accumulated to be detected by the instrument. During this log phase the amplification course is described by the equation T.sub.n=T.sub.o(E).sub.n, where Tn is the amount of target sequence at cycle n, T.sub.o is the initial amount of target, and E is the efficiency of amplification. Finally, in the plateau phase, the amplification efficiency drops off extremely rapidly. Product competes more and more effectively with primers for annealing and the amount of enzyme becomes limiting. The exponential equation no longer holds in the plateau phase.
[0093] Most of the quantitative information is found in the exponential cycles, but the exponential cycles typically comprise only 4 or 5 cycles out of 40. With traditional PCR methods, finding these informative cycles requires that the reaction be split into multiple reaction tubes that are assayed for PCR product after varying numbers of cycles. This requires either assaying many tubes, or a fairly good idea of the answer before the experiment is begun. Once the position of the exponential phase is determined, the experimental phase can be compared to known standards and the copy number can be calculated.
Competitive Quantitative PCR
[0094] Competitive quantitative PCR methods were developed to attempt to overcome difficulties associated with finding the exponential phase of the reaction and to obtain greater precision. A competitor sequence is constructed that is amplified using the same primers as are used to amplify the target sequence. Competitor and target are differentiated, usually by length or internal sequence, and the relative amount of competitor and target are measured after amplification. If the target and the competitor arc amplified with equal efficiency, then their ratio at the end of the reaction will be the same as the ratio had been at the beginning. This holds true even into the plateau phase as long as both decline in efficiency at the same rate. Thus, finding the exponential region is no longer a problem. Providing standards in the same tubes with the unknown targets allows for additional control not possible with kinetic methods. For example, adding the competitor before mRNA purification would control for variations in sample preparation and reverse transcription.
[0095] The use of currently available competitive PCR techniques continues to suffer from several deficiencies. Firstly, the competitor sequence must be constructed to be as similar as possible to the target sequence with regard to the efficiency of amplification, yet the two sequences must be distinguishable from one another. If the competitor is too close in sequence to the target, heteroduplexes form during the PCR that skew the ratio of the product to the template.
[0096] In addition, competitor must be added to the unknown sample at a concentration approximating that of the target. If one product reaches plateau before the other rises above background, no quantitative information can be obtained from that sample. Usually an unknown sample is split and mixed with multiple concentrations of competitor.
[0097] Other concerns have been raised regarding competitive quantification methods. A common criticism is that despite all efforts, the target and the competitor together in a sample may be amplified at different efficiencies, even if target and competitor are amplified at the same efficiencies when amplified separately (the obvious control). When the target and competitor are combined in one vessel and the reagents are limiting, the efficiencies of the two amplification reactions may change at different rates. Length differences between target and competitor are of most concern here as the longer product may compete more effectively with the primers and may be more affected by reagent limitations. Both of these concerns could be addressed by making the target and competitor sufficiently alike, if it were not for the problem of forming heteroduplexes during the PCR reaction.
Real-Time Quantitative PCR
[0098] Developments in instrumentation have now made real-time monitoring of PCR reactions possible and thus have made the problem of finding the log phase of the reaction trivial.
[0099] Thermocycling may be carried out using standard techniques known to those skilled in the art, including the use of rapid cycling PCR. Rapid cycling techniques arc made possible by the use of high surface area-to-volume sample containers such as capillary tubes. The use of high surface area-to-volume sample containers allows for a rapid temperature response and temperature homogeneity throughout the biological sample. Improved temperature homogeneity also increases the precision of any analytical technique used to monitor PCR during amplification.
[0100] In accordance with an illustrated embodiment of the present invention, amplification of a nucleic acid sequence is conducted by thermal cycling the nucleic acid sequence in the presence of a thermostable DNA polymerase using the device and techniques described in U.S. Pat. No. 5,455,175, the disclosure of which is expressly incorporated herein. In accordance with the present invention, PCR amplification of one or more targeted regions of a DNA sample is conducted while the reaction is monitored by fluorescence.
[0101] The first use of fluorescence monitoring at each cycle for quantitative PCR was developed by Higuchi et al., Simultaneous Amplification and Detection of Specific DNA Sequences, Bio. Technology, 10:413-417, 1992, and used ethidium bromide as the fluorescent entity. Fluorescence was acquired once per cycle for a relative measure of product concentration. The cycle where observable fluorescence first appeared above the background fluorescence (the threshold) correlated with the starting copy number, thus allowing the construction of a standard curve. Probe-based fluorescence detection system dependent on the 5-exonuclease activity of the polymerase has improved the real-time kinetic method by adding sequence specific detection.
[0102] The amplified target may be detected using a TaqMan fluorescent dye to quantitatively measure fluorescence. The TaqMan probe has a unique fluorescently quenched dye and specifically hybridizes to a PCR template sequence, as described by Livak et al., Allelic discrimination using fluorogenic probes and the 5 nuclease assay, Genet Anal. 1999 February; 14(5-6):143-9.), which is incorporated by reference in its entirety. During the PCR extension phase, the hybridized probe is digested by the exonuclease activity of the Taq polymerase, resulting in release of the fluorescent dye specific for that probe.
[0103] The amplified target may also be detected using a Pleiades fluorescent probe detection assay to quantitatively measure fluoresence The Pleiades probe specifically hybridizes to a target DNA sequence and has a fluorescent dye at the 5 terminus which is quenched by the interactions of a 3 quencher and a 5 minor groove binder (MGB), when the probe is not hybridized to the target DNA sequence, as described by Lukhtanov et al., Novel DNA probes with low background and high hybridization-triggered fluorescence, Nucl. Acids. Res. 2007 January; 35(5):e30), which is incorporated by reference in its entirety. By the end of PCR, the fluorescent emissions from the released dyes reflect the molar ratio of the sample. Methods for assaying such emissions are known in the art, and described, for example, by Fabienne Hermitte, Mylopreliferative Biomarkers, Molecular Diagnostic World Congress, 2007.
[0104] Alternatively, PCR amplification of one or more targeted regions of a DNA sample can be conducted in the presence of fluorescently labeled hybridization probes, wherein the probes are synthesized to hybridize to a specific locus present in a target amplified region of the DNA. In an illustrated embodiment, the hybridization probe system comprises two oligonucleotide probes that hybridize to adjacent regions of a DNA sequence wherein each oligonucleotide probe is labeled with a respective member of a fluorescent energy transfer pair. In this embodiment, the presence of the target nucleic acid sequence in a biological sample is detected by measuring fluorescent energy transfer between the two labeled oligonucleotides.
[0105] These instrumentation and fluorescent monitoring techniques have made kinetic PCR significantly easier than traditional competitive PCR. More particularly, real-time PCR has greatly improved the ease, accuracy, and precision of quantitative PCR by allowing observation of the PCR product concentration at every cycle. In illustrated embodiments of the present invention, PCR reactions are conducted using the LIGHTCYCLER (Roche Diagnostics), a real-time PCR instrument that combines a rapid thermal cycler with a fluorimeter. Through the use of this device, the PCR product is detected with fluorescence, and no additional sample processing, membrane arrays, gels, capillaries, or analytical tools are necessary. Other PCR instrumentation, as known in the art, may be used in the practice of the present invention.
Diagnostic Methods
[0106] The present invention can be employed to measure gene expression or a gene expression profile in a biological sample. Desirably, the methods of the invention require much less starting material than conventional diagnostic methods and may be employed to measure gene expression of biomarkers in blood or other tissues. Accordingly, the invention provides for the identification of patterns of gene expression useful in virtually any clinical setting where conventional methods of analysis are used. For example, the present methods provide for the analysis of biomarkers associated with lung cancer (Warner et al., J Mol Diagn 2003; 5: 176-83), risk of lung cancer (Crawford et al., Cancer Res 2000; 60:1609-18, pulmonary sarcoidosis (Allen et al., Am. J. Respir. Cell. Mol. Biol. 1999:21, 693-700), cystic fibrosis (Loitsch et al., Clin. Chem. 1999:45, 619-624), chemoresistance in lung cancer (Weaver et al., Molecular Cancer, 4, 18, 2005; Harr et al., Molecular Cancer, 4, 23, 2005) childhood leukemias (Rots et al, Leukemia, 14, 2166-2175, 2000), staging of bladder cancer (Mitra et al., BMC Cancer 2006; 6:159), and to develop databases of normal range of expression of inflammatory genes in peripheral blood samples (Peters et al., Clinical Chemistry 53: 1030-1037, 2007).
[0107] In one embodiment, the biologic sample is a tissue sample that includes cells of a tissue or organ (e.g., lung, breast, prostatic tissue cells). Such tissue is obtained, for example, from a biopsy of the tissue or organ. In another embodiment, the biologic sample is a biologic fluid sample. Biological fluid samples include blood, blood serum, plasma, urine, seminal fluids, and ejaculate, or any other biological fluid useful in the methods of the invention. Alternatively, the tissue sample is a cytologic fine needle aspirate biopsy or formalin fixed paraffin embedded tissue. Use of the methods of the invention is particularly advantageous for such samples, where RNA often is limited by sample size or degradation.
Diagnostic Assays
[0108] The present invention provides a number of diagnostic assays that are useful for detecting or measuring a target nucleic acid molecule in a biological sample. In particular, the invention provides methods for the detection of alterations in gene expression associated with neoplasia (e.g., BCR-ABL in chronic myelogenous leukemia). In particular embodiments, the invention provides for the detection of genes listed in Table 1 (below).
TABLE-US-00001 TABLE 1 Exemplary Target Genes for Detection of Neoplasia Gene UniGeneID BCR-ABL Hs.517461; Hs.715409 ERBB3 Hs.18681 LCK Hs.470627 DUSP6 Hs.298654 STAT1 Hs.470943 MMD Hs.463483 CPEB4 Hs.127126 RNF4 Hs.66394 STAT2 Hs.530595 NF1 Hs.113577 FRAP1 Hs.338207 DLG2 Hs.503453 IRF4 Hs.401013 ANXA5 Hs.480653 HMMR Hs.72550 HGF Hs.396530 ZNF264 Hs.515634
Alternatively, the invention provides for the detection and diagnosis of a pathogen in a biological sample. A variety of bacterial and viral pathogens may be detected using the system and methods of the invention. Exemplary bacterial pathogens include, but are not limited to, Aerobacter, Aeromonas, Acinetobacter, Actinomyces israelli, Agrobacterium, Bacillus, Bacillus antracis, Bacteroides, Bartonella, Bordetella, Bortella, Borrelia, Brucella, Burkholderia, Calymmatobacterium, Campylobacter, Citrobacter, Clostridium, Clostridium perfringens, Clostridium tetani, Cornyebacterium, corynebacterium diphtheriae, corynebacterium sp., Enterobacter, Enterobacter aerogenes, Enterococcus, Erysipelothrix rhusiopathiae, Escherichia, Francisella, Fusobacterium nucleatum, Gardnerella, Haemophilus, Hafnia, Helicobacter, Klebsiella, Klebsiella pneumoniae, Lactobacillus, Legionella, Leptospira, Listeria, Morganella, Moraxella, Mycobacterium, Neisseria, Pasteurella, Pasteurella multocida, Proteus, Providencia, Pseudomonas, Rickettsia, Salmonella, Serratia, Shigella, Staphylococcus, Stentorophomonas, Streptococcus, Streptobacillus moniliformis, Treponema, Treponema pallidium, Treponema pertenue, Xanthomonas, Vibrio, and Yersinia.
[0109] Examples of viruses detectable using the system and methods of the invention include Retroviridae (e.g. human immunodeficiency viruses, such as HIV-1 (also referred to as HDTV-III, LAVE or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g. polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae (e.g. equine encephalitis viruses, rubella viruses); Flaviridae (e.g. dengue viruses, encephalitis viruses, yellow fever viruses); Coronoviridae (e.g. coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae (e.g. parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g. influenza viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g. reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvovirida (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus; Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g. African swine fever virus); and unclassified viruses (e.g. the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class 1=internally transmitted; class 2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related viruses, and astroviruses).
[0110] Examples of pathogenic fungi include, without limitation, Alternaria, Aspergillus, Basidiobolus, Bipolaris, Blastoschizomyces, Candida, Candida albicans, Candida krusei, Candida glabrata (formerly called Torulopsis glabrata), Candida parapsilosis, Candida tropicalis, Candida pseudotropicalis, Candida guilliermondii, Candida dubliniensis, and Candida lusitaniae, Coccidioides, Cladophialophora, Cryptococcus, Cunninghamella, Curvularia, Exophiala, Fonsecaea, Histoplasma, Madurella, Malassezia, Plastomyces, Rhodotorula, Scedosporium, Scopulariopsis, Sporobolomyces, Tinea, and Trichosporon.
[0111] Parasites can be classified based on whether they arc intracellular or extracellular. An intracellular parasite as used herein is a parasite whose entire life cycle is intracellular. Examples of human intracellular parasites include Leishmania, Plasmodium, Trypanosoma cruzi, Toxoplasma gondii, Babesia, and Trichinella spiralis. An extracellular parasite as used herein is a parasite whose entire life cycle is extracellular. Extracellular parasites capable of infecting humans include Entamoeba histolytica, Giardia lamblia, Enterocytozoon bieneusi, Naegleria and Acanthamoeba as well as most helminths. Yet another class of parasites is defined as being mainly extracellular but with an obligate intracellular existence at a critical stage in their life cycles. Such parasites are referred to herein as obligate intracellular parasites. These parasites may exist most of their lives or only a small portion of their lives in an extracellular environment, but they all have at least one obligate intracellular stage in their life cycles. This latter category of parasites includes Trypanosoma rhodesiense and Trypanosoma gambiense, Isospora, Cryptosporidium, Eimeria, Neospora, Sarcocystis, and Schistosoma. In one aspect, the invention relates to the prevention and treatment of infection resulting from intracellular parasites and obligate intracellular parasites which have at least in one stage of their life cycle that is intracellular. In some embodiments, the invention is directed to the prevention of infection from obligate intracellular parasites which are predominantly intracellular. An exemplary and non-limiting list of parasites for some aspects of the invention include Plasmodium spp. such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii. Blood-borne and/or tissues parasites include Plasmodium spp., Babesia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii. Blood-borne and/or tissues parasites include Plasmodium, Babesia microti, Babesia divergens, Leishmania tropica, Leishmania, Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
Kits
[0112] The invention also provides kits for the detection of gene expression. Such kits are useful for the diagnosis, characterization, or monitoring of a neoplasia in a biological sample obtained from a subject (e.g., CML). Alternatively, the invention provides for the detection of a pathogen gene or genes in a biological sample. In various embodiments, the kit includes at least one primer pair that identifies a target sequence, together with instructions for using the primers to identify a gene expression profile in a biological sample. Preferably, the primers are provided in combination with a standardized mixture of internal standards on a nanofluidic PCR platform (e.g., a high density array). In yet another embodiment, the kit further comprises a pair of primers capable of binding to and amplifying a reference sequence. In yet other embodiments, the kit comprises a sterile container which contains the primers; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container form known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding nucleic acids.
[0113] The instructions will generally include information about the use of the compositions of the invention in detecting a gene expression profile. In particular embodiments, the gene expression profile diagnoses or characterizes a neoplasia. Preferably, the kit further comprises any one or more of the reagents useful for an analytical method described herein (e.g., standardized reverse transcriptase PCR). In other embodiments, the instructions include at least one of the following: descriptions of the primer; methods for using the enclosed materials for the diagnosis of a neoplasia; precautions; warnings; indications; clinical or research studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.
[0114] The following examples are offered by way of illustration, not by way of limitation. While specific examples have been provided, the above description is illustrative and not restrictive. Any one or more of the features of the previously described embodiments can be combined in any manner with one or more features of any other embodiments in the present invention. Furthermore, many variations of the invention will become apparent to those skilled in the art upon review of the specification. The scope of the invention should, therefore, be determined not with reference to the above description, but instead should be determined with reference to the appended claims along with their full scope of equivalents.
[0115] It should be appreciated that the invention should not be construed to be limited to the examples that are now described; rather, the invention should be construed to include any and all applications provided herein and all equivalent variations within the skill of the ordinary artisan.
[0116] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook, 1989); Oligonucleotide Synthesis (Gait, 1984); Animal Cell Culture (Freshney, 1987); Methods in Enzymology Handbook of Experimental Immunology (Weir, 1996); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, 1987); Current Protocols in Molecular Biology (Ausubel, 1987); PCR: The Polymerase Chain Reaction, (Mullis, 1994); Current Protocols in Immunology (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention.
[0117] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
EXAMPLES
Example 1. Probe Sequences have the Potential to Generate Inaccurate Standardized Nucleic Acid Quantification (SNAQ) Measurements
[0118] Serial dilutions of IS amplicon were mixed with a fixed quantity of NT, amplified by PCR and measured by melting curve analysis. A source of inaccuracy was discovered unrelated to a difference in IS and NT fluorescent yield. Fraction NT (y-axis) measurements (closed circles) were graphed relative to the input IS:NT ratio (x-axis) (
[0119] SNAQ measures IS:NT molar ratios using the relative fluorescent signals of each product by melting curve analysis. Models of melting curve analysis and fluorescent efficiency were generated (
[0120] The EC50 shift in
[0121] DNA single strand folding analysis of IS3 indicated that a stable stem loop structure was present at 35 C. but absent at 55 C. Without being bound to theory, secondary structure has the potential to inhibit the probe binding to the IS. Thus, redesign of the probe binding site can decrease the influence of IS template secondary structure on probe binding, and improve accuracy of melting curve response to IS:NT mixtures.
[0122] Two IS templates (IS19 and IS20) were constructed that altered the base pairs in the IS sequence to eliminate the stable secondary structure while producing the desired 15 C. dTM shift between NT and IS. 1519 and 1520 templates are provided at Table 2.
TABLE-US-00002 TABLE2 ISTemplateSequences Name Sequence IS3 GGTTTCTGAATGTCATCGTCCACTCtGCCAaTGGATTTAAGCA GAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGC IS19 ggtttctgaatgtcatcgtccactTagccactAgatttaagcag agttcaaaagcccttcagoggccagtagcatctgactttgagc IS20 ggtttctgaatgtcatcgtccacAcagccacAggatttaagcag agttcaaaagcccttcagcggccagtagcatctgactttgagc
[0123] The melting curve of IS19 (
[0124] Results reported herein were obtained using the following methods and materials unless indicated otherwise.
[0125] Melting Curve Analysis
[0126] Algorithms used for converting melting curve information into molar ratio measurements are known in the art. Briefly, conversion of melting curve data into transcript abundance begins with establishing melting curve parameters for each NT and IS template. Fluorescent probe (e.g., Pleiades) melting curves of samples with either IS or NT template are fit to a variable sloped sigmoid curve, and the resulting Tm and Hill coefficient saved as input parameters for SNAQ analysis. Next, the melting curves for each sample-assay combination are fit to a two sigmoid curve using the parameter inputs defined above, allowing the Bottom.sub.IS and Bottom.sub.NT to be adjusted to minimize the residuals. The fraction NT is calculated from the Bottom.sub.IS and Bottom.sub.NT solutions.
[0127] Lastly, the S/N is calculated for each sample based on four sample replicates. Accurate SNAQ measurement requires >10 S/N. Assays failing to meet this criterion likely require changes, which can be generated by mutation selection of the internal standard. Occasionally, as designed, the probe does not generate sufficient on/off signal and is replaced. With the wide latitude in probe placement and design (Epoch uses Major Groove Binders and modified nucleotides to adjust binding Tm) and numerous options for internal standard probe binding site mutation type and placement, assays with >50 S/N can be routinely designed.
Other Embodiments
[0128] From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.
[0129] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0130] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.