NANO-SENSORS FOR NUCLEIC ACID DETECTION AND DISCRIMINATION
20190256897 ยท 2019-08-22
Inventors
- Ratneshwar Lal (La Jolla, CA)
- Michael Taeyoung Hwang (La Jolla, CA)
- Preston Boone Landon (Oceanside, CA)
- Gennadi V. Glinskii (La Jolla, CA)
- Alexander Mo (San Diego, CA)
- Srinivasan Ramachandran (Fremont, CA)
- Joon Lee (La Jolla, CA)
- Brian Meckes (Evanston, IL)
Cpc classification
C12Q2565/525
CHEMISTRY; METALLURGY
C12Q2565/625
CHEMISTRY; METALLURGY
G01N27/00
PHYSICS
B82Y15/00
PERFORMING OPERATIONS; TRANSPORTING
G01N27/125
PHYSICS
C12Q2565/625
CHEMISTRY; METALLURGY
International classification
Abstract
Methods, systems, and nano-sensor devices are disclosed for detecting or discriminating nucleic acids with a single nucleotide resolution based on nucleic acid strand displacement. The detection can be made by time-lapse fluorescence measurements or by electro-based graphene FET, which can be combined with wireless communication to provide real-time transmission of the detected signals.
Claims
1. A nucleic acid detection device, comprising: a graphene chip that comprises a substrate, a graphene surface on the substrate, a conducting substance at two ends of the graphene surface to form a first electrode and a second electrode, and an insulating substance to insulate the first electrode and the second electrode, wherein the insulating substance further forms a solution reservoir on the graphene surface to receive a nucleic acid probe and a sample nucleic acid; a double-stranded nucleic acid probe attached to the graphene surface of the reservoir, wherein the nucleic acid probe comprises a normal strand having a toehold at one end and a weak strand comprising one or more inosines substituting guanines; and a microcontroller board that comprises a digital meter to measure electric current that passes through the graphene chip when an input voltage is applied to the graphene chip, and a communication module to send values of the measured electric current and the input voltage.
2. The nucleic acid detection device of claim 1, further comprising a mobile device that receives the values from the communication module and processes the values to show resistance changes.
3. The nucleic acid detection device of claim 1, wherein the microcontroller board further comprises a low-pass filter to filter input voltage.
4. The nucleic acid detection device of claim 3, wherein the microcontroller board further comprises a moving-average filter.
5. The nucleic acid detection device of claim 4, wherein the microcontroller board further comprises a second-order moving-average filter.
6. The nucleic acid detection device of claim 1, wherein the substrate includes silicon dioxide coated wafer.
7. The nucleic acid detection device of claim 1, wherein the conducting substance includes conducting silver paste.
8. The nucleic acid detection device of claim 1, wherein the insulating substance includes silicone rubber.
9. The nucleic acid detection device of claim 1, wherein the communication module supports Bluetooth communication.
10. A method of detecting or discriminating a nucleic acid having one or more mismatches, comprising: contacting a double-stranded nucleic acid probe in a solution reservoir on a graphene chip such that the nucleic acid probe is attached to the surface of the graphene chip; contacting a control nucleic acid that is completely complementary to the probe with the probe nucleic acid attached to the graphene surface such that strand displacement occurs between the probe nucleic acid and the control nucleic acid; measuring the electric signal changes during the strand displacement between the probe nucleic acid and the control nucleic acid to obtain a first I-V curve; contacting a target nucleic acid that is partially complementary to the probe with the probe attached to the graphene surface such that strand displacement occurs between the probe nucleic acid and the target nucleic acid; measuring the electric signal changes during the strand displacement between the probe nucleic acid and the target nucleic acid to obtain a second I-V curve; comparing the second I-V curve with the first I-V curve, wherein a shift in the curve indicating the presence of one or more mismatches in the target nucleic acid.
11. The method of claim 10, wherein the measured electric signals are transmitted to a mobile device using wireless communication.
12. The method of claim 10, wherein the wireless communication includes Bluetooth communication.
13. The method of claim 9, wherein the nucleic acid probe comprises a normal strand and a weak strand.
14. The method of claim 13, wherein the normal strand comprises a toehold having one or more nucleotide.
15. The method of claim 13, wherein the weak strand comprises one or more inosines substituting guanines.
16. A method of detecting or discriminating a nucleic acid having one or more mismatches, comprising: contacting a double-stranded probe nucleic acid with a control nucleic acid that is fully complementary to the probe such that a strand displacement between the probe nucleic acid and the control nucleic acid occurs; measuring the kinetics of strand displacement of the probe and the control nucleic acid; contacting the probe nucleic acid with a target nucleic acid having one or more mismatches with the probe such that a strand displacement between the probe nucleic acid and the target nucleic acid occurs; measuring the kinetics of strand displacement of the probe and the target nucleic acid; and comparing the kinetics of the strand displacement of the target nucleic acid with the kinetics of the strand displacement of the control nucleic acid, wherein a change in the kinetics indicating the presence of one or more mismatches in the target nucleic acid.
17. The method of claim 16, wherein the probe nucleic acid is comprises a normal strand and a weak strand.
18. The method of claim 17, wherein a fluorescent label is attached to one end of the weak strand.
19. The method of claim 27, wherein a quencher is attached to one end of the normal strand.
20. The method of claim 18, wherein the kinetics of strand displacement is measured by real-time fluorescence monitoring.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
DETAILED DESCRIPTION
[0074] Certain single nucleotide polymorphism (SNP) analyses are available and some suffer technical limitations. For example, some enzyme-based methods require high costs and long term process, which deter accessment of the general public. More affordable hybridazation based methods are often changllenged by reliability problems. Hybridization-based methods for SNP detection have several disadvantages, including cross-hybridization between allele-specific probes. The average length of the probe on microarray varies considerably; the probe and target strand sequences, except a single mismatch, are complementary to each other. A single mismatch may often fail to reduce the affinity between probe and SNP target strands. This limits the detection of single mismatch in longer probe-target strand hybridization as the longer probes would have more frequent cross hybridization. For example, single mismatch in the center of 15 base pairs (bps) of probe-target hybridization can be detected as there is critical difference in hybridization affinity between a perfect-matched and a single-mismatched hybridization. However, when the probe length is 40 or 50 nucleotides (nt), a single mismatch produce relatively small difference between a perfect-matched and a single-mismatched hybridization. Thus its detection is difficult with the simple hybridization-based methods. The general length of probe used in microarray is more than 20 nt, thus cross hybridization significantly reduces its reliability and specificity. Moreover, detection of a single mismatch in a longer probe is important because fewer probes are needed to obtain the same level of reliable analysis with longer probes (60-80 nt) and they provide more sensitive detection. Moreover, it is still constrained by large and expensive equipment to analyze the data.
[0075] Thus, the detection and sequencing of nucleic acids for diagnostics, forensics and environmental monitoring are of great interest in personalized precision medicine. Some detection methods based on fluorescent labeling require laboratory scale settings such as fluorimeters or laser scanners to analyze optical signals and thus may not be suitable for in-field or at home diagnostic applications. Therefore, it is desirable to develop devices and methods for in-field or at-home detection of specific nucleic acid sequences of small quantities.
[0076] Disclosed herein are nano-sensors and techniques for their design, engineering, and use for detection and discrimination of nucleic acids with a high resolution, sensitivity or specificity. In some implementations, disclosed nano-sensors have achieved 200,000-fold enhancement of sensitivity for detection of nucleic acid molecules compared to current nano-devices. Applications include tools for biological and biomedical research and diagnostic, prognostic, and therapeutic applications for personalized chemoprevention and disease management (e.g., for cancers, cardiovascular and neurodegenerative disorders, diabetes, neurological and developmental disorders). The disclosed technology is ready for the immediate implementation in vitro.
[0077] This disclosure provides for devices and methods of using nucleic acid probes, particularly double-stranded probes such as DNA zippers or DNA tweezers, to detect mismatches between the probe and a target strand. The strand displacement-based technology disclosed herein can be used to detect a single nucleotide mismatch and is less restricted by the length of the nucleic acids, as compared to the prior-art technology. In some embodiments, the conversion of a chemical cue into a substantial mechanical strand displacement is detected by time-lapse fluorescence measurements. In other embodiments, the mismatch between the probe and the target is detected and measured by electrical sensing devices.
[0078] Electrical detection of nucleotide can lower the spatial and budget constraints and using double-stranded probe can solve the reliability problem dramatically. Electrical bimolecular sensors have been developed majorly being focused on enhancing sensitivity of transducers with variety of modification or introduction of new platforms. More effective utilization of DNA nanotechnology can provide different insights and approaches to accelerate evolution of biosensors and bioelectronics.
[0079] Electrical sensing-based methods can successfully lower the limit of sequence specific nucleic acid detection to the femto molar level. A field effect transistor (FET) can be employed as a highly sensitive sensor and can potentially be integrated with other on-chip analytical systems. Disclosed herein are devices and methods for miniaturized chip-based electrical detection of nucleic acid, enabling in-field or at-home detection of specific nucleic acid sequences.
[0080] Graphene is an attractive electronic material of choice for a biosensing platform because it has high sensitivity to the changes in carrier mobility with respect to changes in the gating electric field, low intrinsic electrical noise, mechanical strength and flexibility. DNA strand displacement based-probe on graphene FET can detect single nucleotide polymorphism (SNP) in relatively long nucleic acid sequences with unprecedented specificity. SNPs are markers for a variety of diseases, including various forms of cancer, genetic disorders, and are of critical importance for successful practical implementation of the concept of personalized medicine. Thus, detection of SNP mutations with high specificity and sensitivity is essential for a broad range of diagnostic applications and effective implementations of personalized precision medicine approaches. The feasibility of the approach demonstrates that a more complex design of the probe mechanism can be used to achieve better functionalities and facilitate nano-scale engineering of electrical biosensors.
[0081] Another advantage of using an electrical signal-based sensor is its compact size and portability compared to current fluorescence-based techniques. Also, a fully electronic sensor and signal measurement system can communicate using wireless signal transmission which enables signal processing on a portable computing device such as a smart phone. Wireless transmission of the electrical signals obtained by the biosensors further facilitates unsophisticated end-users to access nucleic acid detection chip technology.
[0082] In some embodiments, this disclosure is directed to designs and technology for sensing specific nucleic acid molecules for the diagnosis of abnormal pathology and diseases such as cancer, genetic disease, or for preparing personalized medicine in both human and non-human animals. The disclosed technology can be used to implement methods for: (i) combining a graphene field effect transistor (FET) and a nucleic acid actuator as a nucleic acid molecular sensor with high specificity; (ii) fabricating graphene FET, consisted of a graphene channel, two electrodes and a solution reservoir, can be operated with the liquid gate method; (iii) designing a nucleic acid actuator such as a DNA zipper with two partially complementary strands of DNA, toeholds and inosine bases, based on strand displacement technique, to be sensitized to a specific nucleic acid sequence; (iv) functionalizing DNA zipper on graphene channel in the FET with 1-Pyrenebutanoic acid succinimidyl ester (PASE) and amine-amide bonding; and (v) measuring the current change by operation of DNA zipper in the FET sensor to detect single nucleotide polymorphism (SNP). Other implementations are also disclosed in this patent document.
Nucleic Acid Probes
[0083] The disclosed technology can be implemented based on architectural principles and use DNA strand displacement reactions and biologically relevant mechanisms of DNA strand dissociation and re-association to design analytical nano-devices uses. The regulatory mechanisms affecting DNA dynamics in vivo involve protein-less structural-functional determinants, in particular, interactions of DNA strands with invading DNA or RNA molecules. The nano-sensors design techniques utilize conversion of a chemical cue into a substantial mechanical strand displacement detected by time-lapse fluorescence measurements, measurements of electro-signal changes, or other methods.
[0084] Although DNA molecules are used as examples to illustrate the technology and devices disclosed herein, one skilled in the art would understand that the same principle and design concept can be applied to other types of nucleic acids, including naturally occurring nucleic acids and artificial nucleic acids. Thus, it is within the purview of one skilled in the art to make and use a nucleic acid probe based on the disclosure provided herewith.
[0085] Dynamic transitions between double-stranded and single-stranded states are intrinsic components of DNA double helix molecular lifecycle during replication, transcription, DNA repair, and reciprocal conformational changes between right-handed B-DNA and high-energy left-handed Z-DNA forms. Structural and molecular determinants governing DNA double helix dynamics and their precise role during execution of these fundamental biological processes remains poorly understood. Protein-less DNA sequences are extensively utilized in nano-engineering to build controlled devices which operate using on-demand transitions between single-stranded and double-stranded states of DNA molecules.
[0086] Various nucleic acid nano-devices, including DNA and RNA nano-devices are disclosed herein for analysis of kinetics of strand displacement reactions and studies of mechanisms of strands' dissociation and re-association to identify structural-functional determinants of DNA double helix nano-dynamics during transitions between double-stranded and single-stranded states. Changes of the conventional double helix introduced by cytosine methylation/deamination reactions and base pairing mismatches significantly influence the kinetics of strand displacement and transition to a single-stranded state induced by invading RNA and DNA molecules. Markedly enhanced kinetics of RNA/RNA interactions facilitate eviction of invading strands and rapid transition to a double-stranded state. Using biological models as a guide for the rational design of RNA sensing nano-devices, 200,000-fold enhancement of nano-device's sensitivity for detection of RNA molecules was achieved. One of regulatory functions of pervasive genome-wide transcription is to enable transition cycles between the double- and single-stranded states of DNA molecules. Non-coding RNA-mediated stochastic effects on DNA double helix dynamics may influence nucleosome formation and placement to extend the accessibility time for DNA binding proteins, thereby increasing a likelihood of the assembly and functions on a DNA scaffold of replication, transcription, DNA repair, and chromatin remodeling complexes.
[0087] The concept of genome-wide pervasive transcription in human cells is based on experimental evidence that nearly 90% of human genome is actively transcribed. Transcriptome complexity in human cells generated by RNA polymerase (Pol) II activity extends beyond the conventional coding genomic loci defined as genes and transcripts containing open reading frames. It expands to thousands long non-coding RNAs (lncRNAs) and myriads short RNA populations, including miRNAs, siRNAs, piwiRNAs, enhancer RNAs (eRNAs), transcription start site (TSS)-RNAs, trans-regulatory RNAs (transRNAs), and small non-coding snpRNAs containing disease-linked SNP markers. The presence of short bidirectional transcripts appears to be a hallmark of active promoters in mammals and pervasive transcription of eukaryotic genomes is associated to a large extent with bidirectional promoters that synthesize mRNA and divergent populations of non-coding RNAs. In human cells, bidirectional transcription generates non-coding RNAs that induce both target gene activation and suppression, in part, by regulating epigenetic states of targeted genomic loci. Thus, there is an unmet need in fundamental and translational biomedical sciences for reliable new methods of nucleic acid detection and discrimination, which would enable a real-time monitoring of the regulatory effects of bidirectional transcription at specific genomic loci in individual cells with a single-nucleotide level analytical precision.
[0088] DNA strand displacement reactions, in which one strand of DNA displaces another in binding to a third strand with partial complementarity to both, are extensively utilized in nano-engineering. Toehold driven strand displacement reactions in which a short single-stranded overhang region (known as a toehold) initiates the strand displacement have been used to create functional DNA devices, including walkers, actuators, and contractile machines. Many DNA devices have forward and reverse reaction cycles with different kinetic rates. The ability to predict toehold driven reaction kinetics when just the domain sequences are known has been difficult but such knowledge is highly desired for DNA nano-engineering. Toeholds is composed of complementary domains that allow an invading strand to bind to a short, single-stranded overhang on one of the DNA strands in a duplex. The invading strand proceeds to displace the incumbent strand (i.e., normal strand without a toehold) in a process called branch migration (BM). BM is iso-energetic and has been described as a simple random walk. The association rate of the toehold is not expected to be heavily dependent on the sequence. A modified strand displacement method with artificial base pairings has been reported recently, using deoxyinosine instead of deoxyguanine, which hybridizes with deoxycytosine, but with less energy than deoxyguanine. It has been suggested that these nano-engineering approaches might be useful for development of the next-generation personalized nanomedicine based on target-specific RNA-guided nano-sensors and nano-devices for diagnostic and therapeutic applications.
[0089] Some examples of domain sequences are listed in Table 1 below.
TABLE-US-00001 TABLE1 ExamplesofDomainSequences Domain Sequence g 5-ACCTACTCAACCATACATCACTCTACCTCAaacactcgaa TCTCCCAAATACTAAGCTGTTCAACTCACC-3' g 5-CCTCCAGTTCCAAGTACCACCATCACACCTACTCAA CCATACATCACTCTACCTCAaacactcgaaTCTCCCAAAT ACTAAGCTGTTCAACTCACC-3 j 5-TTCTGGGGAGTGGGAGATGTTGGCTAGATTTACGGTATAA TGAGGTAGAGTGATGTATGGTTGAGTAGGT-3 j 5-TTCTGGGGAGTGGGAGATGTTGGCTAGATTTACGGTATAA TIAIITAIAITIATITATIITTIAITAIIT-3 j 5-TTCTGGGGAGTGGGAGATGTTGGCTAGATTTACGGTATAA TIAIITAIAITIATITATIITTIAITAIITGTGATGGTGGTACTT GGAACTGGAGG-3 a.sub.1 5-GGTGAGTTGAACAGCTTAGTATTTGGGAGa/IbRQ/-3 a.sub.2 5-/TEX615/aTACCGTAAATCTAGCCAACATCTCCCACTCCCCA GAA-3 f.sub.(10,30) 5-TTCGAGTGTTTGAGGTAGAGTGATGTATGGTTGAGTAGGT-3 f.sub.(8,30) 5-CGAGTGTTTGAGGTAGAGTGATGTATGGTTGAGTAGGT-3 f.sub.(7,30) 5-GAGTGTTTGAGGTAGAGTGATGTATGGTTGAGTAGGT-3 f.sub.
[0090] Regulatory mechanisms affecting DNA dynamics in vivo may involve protein-less structural-functional determinants, in particular, interactions of DNA strands with invading RNA molecules. A diverse array of DNA nanotechnology platforms suitable for time-lapse analysis of protein-less DNA strands dissociation and re-association reactions were designed and tested based on measurements of strand displacement kinetics in the experimental context modeling the conventional DNA double helix, slipped strands and nucleotide mismatch bubbles, and DNA four way junctions (4WJ) nanostructures. In some embodiments, the engineering design techniques utilize conversion of a chemical cue into a substantial mechanical strand displacement detected by time-lapse fluorescence measurements. This approach enables quantitative experimental analyses of strand displacement reaction kinetics induced by invading RNA and DNA strands by modeling common structural features of replication forks associated with early and late replication timing zones (RTZ), sequences of transcription start sites (TSS) and Z-DNA forming regions (ZDR). In other embodiments, the strand displacement is detected by electro-signal change measurements.
[0091] Introduction of a single nucleotide toehold and products of cytosine methylation/deamination reactions markedly enhanced the kinetics of DNA strands displacement. RNA and DNA invading strands containing C/G toehold sequences induce 15-fold faster DNA strand displacement reactions compared to the invading strands bearing A/T toehold sequences (for toehold lengths 10n1). Higher DNA strand displacement kinetics of invading strands containing C/G toehold sequences represents an underlying mechanism of observed genome-wide associations of CG-rich sequences with early RTZ, TSS, and ZDR. Small non-coding RNA transcribed in vivo from genomic regulatory loci represents most likely candidates to function as invading molecules facilitating DNA strand displacement reactions associated with replication, transcription, enhancers' activities, DNA repair, and transitions between B-DNA and Z-DNA conformations.
[0092] Nucleosome repositioning and displacement at functionally active genomic loci continually creates short protein-less segments of DNA double helix undergoing transitions between double-stranded and single-stranded states. Multiple design and engineering strategies and different methods to fuel and drive nano-devices were utilized to study protein-less mechanisms of DNA strands dissociation and re-association processes. Strand displacement reactions employing toeholds rely on having favorable energy for displacing hybridized DNA. A toehold-less strand displacement method with non-conventional base pairings in DNA double helix utilizes deoxyinosine instead of deoxyguanine, which hybridizes with deoxycytosine, but with less energy than deoxyguanine. In addition to fluorescence-based monitoring of strand displacement, the performance of these devices can be visualized because they are able to perform a specific motion and acquire defined geometrical shapes in response to new DNA and/or RNA strands being introduced. DNA and RNA strand hybridization with mismatches can occur naturally in vivo through mutations and single nucleotide polymorphism (SNP) and by changing the number of mismatches, affinity of interactions between strands can be controlled. A novel combinatorial design was employed to create a self-sustaining nano-device in which by controlling both mismatches and hybridization length of interacting strands repeated capture and release of the same DNA strands was achieved. This approach creates a platform that allows for dissociation of DNA strands following the capture of select invading sequences and then targeted release of captured sequences and subsequent re-association of the same DNA strands thus modeling multiple cycles of protein-less dynamics of DNA strands dissociation and re-association.
[0093] The disclosed technology performs the systematic analysis of DNA strands displacement reactions using a suite of nano-devices specifically designed for discovery and characterization of the protein-independent mechanisms governing DNA double helix dynamics. The experiments employed a uniquely broad panel of toehold-less and toehold-bearing nano-devices including conventional DNA double helix, DNA double helix containing inosine and 5-methyl-cytosine nucleotides, four way junction (4WJ) DNA nano-systems, and a self-sustaining nano-device in which repeated continuous cycles of capture and release of the same DNA strands was achieved. One of the unique features of inosine-based nano-devices is the thermodynamic resemblance of molecular bonds of naturally-occurring wobble base pairing, including G:U, I:U, I:A, and I:C bonds. Notably, thermodynamically similar bonds can be formed in DNA double helix in vivo as a result of C/5mC/5hmC deamination, suggesting that DNA double helices containing G:U, G:T, and G-5hmU bonds should manifest increased sensitivity to invading strands and high likelihood of transitions between double-stranded and single-stranded states.
[0094] In some embodiments, the disclosed technology utilizes an inosine-based partial strand displacement scheme in the context of DNA four way junctions (4WJ) modeling structural motifs of DNA replication and providing a model system for accurate analytical determination of DNA strand displacement reaction kinetics. Nano-devices demonstrating on-demand dissociation and re-association of DNA strands in response to induced 4WJ expansion and contraction cycles were developed using this approach. Similar to the conventional DNA double helix, controlled on-demand induction of 4WJ expansion and contraction cycles was triggered by addition into system of toehold-bearing invading strands. RNA or DNA invading strands containing C/G toehold sequences induced 15-fold faster DNA strand displacement reactions compared to the A/T toehold-bearing invading sequences. Invading strands with toehold sequences containing A/C/G and T bases manifest intermediate DNA strand displacement kinetics. These results are in agreement with the reported curves for toehold saturation in a publication by Zhang et al., Control of DNA Strand Displacement Kinetics Using Toehold Exchange, J. Am. Chem. Soc. 131(47): 17303-17314 (2009). The best-fit values from their 3-step model were kn=6.010.sup.6 M1s1 (3) for toeholds composed C/G bases, kn=3.010.sup.6 M1s1 for a typical sequence containing A/C/G and T bases (4), and kn=4.010.sup.5 M1s1 for A/T only toehold sequences (5). For comparison the function Pc(n,b) was plotted as multiples of the aforementioned values as kfPb(n,b).
[0095] Marked differences in kinetics of strands displacement are apparent for sequences having a toehold length n=1, which is expected to occur in genomes very frequently as a result of the spontaneous methyl-cytosine deamination reactions of CpG sequences. The CpG sites are hypermutable because the C of CpGs is considered a preferred site of DNA methylation, and methyl-C (mC) is prone to mutate to T via spontaneous deamination. The net result is that CpGs are replaced over time by TpG/CpAs sequences and the overall mCpGs mutation rate is estimated at 10-50 times the rate of C in any other context, or of any other base in the genome. It was reported that 25% of all methylation events identified in hESC were in a non-CG context. Methylation in non-CG contexts seems specific to ESC because non-CG methylation disappeared upon induced differentiation of the hESC. These data suggest that the mutation-driving mechanism caused by the spontaneous deamination of mC to T may be relevant to the non-canonical methylation events occurring in hESC at non-CG (e.g., CHH and CHG, where H is any base) sequences.
[0096] CpG methylation and deamination play a highly important role in the inactivation of transposons and protecting mammalian genomes from their harmful mutational activity. Methylation and deamination of CpGs embedded within Alu transposons in the human genome resulted in generation of thousands of p53-binding sites with the preferred core motif composed of CpA and TpG dinucleotides. It has been demonstrated that that CpG deamination events may create TF binding sites with much higher efficiency than other single nucleotide mutational events. Evolutionary analysis of TF binding sites in ESC is consistent with the idea that CpG deamination is a major contributor to creation of novel binding sites for NANOG, NANOG, OCT4, and CTCF. These naturally-occurring genome editing mechanisms were recently linked to the creation of the unique to human transcription factor-binding sites. They may play an important selection-supported biological role in human evolution by markedly increasing a combinatorial regulatory complexity of individual genomes and enhancing phenotypic diversity of individual cells within populations.
[0097] Genome editing mechanisms, defined as changes of DNA sequences altering the Watson-Creek base pairing, are not limited to the spontaneous 5mC deamination. Recent experiments demonstrated that in physiological conditions DNA sequence undergoes major structural changes, which markedly affect double helix dynamics and functions. These structural modifications of DNA sequences are due to activity of TET and APOBEC enzyme families. Coupled with base excision repair, they function to erase DNA methylation marks and recover cytosine bases, thus reconstituting the conventional structure of DNA double helix. Because 5mC is the primary target of this regulatory pathway, the corresponding changes of DNA sequences can be defined as DNA methylation-associated genome editing mechanisms. Genome editing mechanisms, which are attributed to the elevated rate of spontaneous deamination of 5mC and increased enzymatic activity of the APOBEC family of cytidine deaminases, were implicated as a major source of mutations in humans. These mutation signatures, characterized, in part, by prominence of C>T substitutions, are present in 29 out of 30 different types of human cancers. The prevalence of this type of mutations, defined as the percentage of samples from data set of 7,042 cancers in which the signature contributed significant number of somatic mutations, exceeds 60% in human cancer samples, reaching 68% of all mutations in some cancer samples.
[0098] Transitions between B- and Z-DNA conformations result in major structural changes of DNA double helix at the B-Z junctions where the base pairing is broken and two bases are extruded from the double helix, thus creating DNA double helices containing single nucleotide toeholds. Notably, similar structural changes were observed during the crystal structure and molecular dynamics studies of interactions of DNA double helix with 5mC-DNA-binding proteins. The 5hmC base is flipped out of the DNA double helix and the 5hmC hydroxyl group participates in hydrogen bonding stabilizing the interactions of 5hmC-modified DNA with the SET and RING-associated domain of the Uhrf1 protein. X-ray diffraction determination of the high-resolution structures of the palindromic Dickerson dodecamer containing either 5hmC or 5mC instead of either the 2nd or 3rd cytosine demonstrated that cytosine methylation appears non-mutagenic since neither the helical structure nor the thermodynamics of DNA double helix are changed. Taken together, these data suggest that polymerases cannot distinguish 5hmC and 5mC modifications from unmodified cytosine.
[0099] Bivalent ions significantly enhance the transition of DNA double helix from B to Z conformations. The effect is markedly (1000-fold) higher on DNA sequences containing 5mC and is readily detectable at physiological concentrations of bivalent ions. This disclosure document suggests that invading RNA molecules interact more efficiently with DNA double helix in Z conformation. Endogenous RNAs may function as efficient inducers of DNA double helix transitions from double-stranded to single-stranded states at genomic loci containing either conventional cytosine or 5-methyl-cytosine nucleotides. Several lines of experimental evidence support the notion that this model reflects biologically relevant regulatory mechanisms. Cytosine methylation appears to decrease kinetics of DNA strand displacement reactions in response to invading RNA molecules, thus decreasing the likelihood of transition from double-stranded to single-stranded states of DNA double helix. These observations are in agreement with the results of high resolution melting experiments demonstrating that methylated DNA has increased thermal stability and 5-methylcytosine hydroxylation reduces DNA thermal stability. Consistently, spectroscopic and calorimetric analyses have revealed that 5hmC introduction reverses the stabilizing effect of 5-methylcytosine on double-stranded DNA. The inhibitory effect of cytosine methylation may be reversed and sensitivity of DNA double helix to the invading RNA molecules is increased in the presence of bivalent ions at physiological concentrations.
[0100] The disclosed technology has potentially significant translational implications. Discovery of architectural principles for design and engineering of analytical nano-devices manifesting 200,000-fold improvement in sensitivity of detection and discrimination of nucleic acid molecules at a single nucleotide resolution should pave the way for a wide range of diagnostic and therapeutic applications. The disclosed technology is ready for the immediate implementation in vitro. Most recent experiments demonstrating the stability and bioactivity of DNA/RNA hybrids in vivo support the feasibility of the assessment of its utility in animal studies and clinical trials in the near future. Importantly, CG-rich and CpG sequences and active transcription have been associated with the early RTZ, TSS, and ZDR in multiple independent studies utilizing either genome-wide approaches or analyses of specific genomic regions. Toehold-containing CG-rich DNA double helix manifest higher sensitivity to invading nucleic acids compared to AT-rich DNA sequences and the marked differences are observed between conventional and toehold-bearing DNA nano-devices having single base toeholds. Results disclosed herein suggest that increased kinetics of DNA strand displacement induced by CG-rich invading strands and variable responsiveness of 5mC-based DNA double helix to invading RNA molecules may reflect common molecular mechanisms underlying these observations. RNA-guided DNA strands displacement reactions in vivo are most likely to occur during a rapid transient DNA unwrapping off the histone surface. Nucleosomal DNA undergoes rapid spontaneous unwrapping/rewrapping cycles: it remains fully wrapped for 250 ms before unwrapping and rewrapping within 10-50 ms. Spontaneous conformational changes of nucleosomes leading to a transient lift of a DNA stretch from the histone surface and a site exposure for sequence-specific DNA binding proteins are likely to occur at the genomic loci harboring nascent chromatin lacking linker histone H1. Genome-wide pervasive transcription continually generates small non-coding RNAs from up to 90% of human genome, including TSS, enhancers, and sites of replication origin, making RNA molecules particularly attractive candidates to function as invading strands inducing DNA strand displacement reactions associated with many biological processes.
[0101] An example scheme of strand displacement and single mismatch detection is shown in
[0102] Another example scheme of strand displacement and single mismatch detection is shown in
[0103] In some embodiments, both normal and weak strands (N and W) are 57 nt, and the N and W strands are complementary to each other except for 10 nt of loop part in the middle of the DNA tweezers. W strand contains 4 guanines which are substituted with inosines (I) to lessen the affinity between the two strands. The structure of the DNA tweezers with the specific sequence is shown in
[0104] In some embodiments, an example of the probe design on the graphene chip is shown in
[0105] The probe design utilizing principle(s) of strand displacement reactions for sensing, detection, discrimination, observation, quantification, measurement, and reporting the presence of a nucleic acid molecule. The probe design includes one or more of the following elements to enable and facilitate the strand displacement reactions: i) toehold extension; ii) chemical modification of strand monomers; and iii) structural changes of interacting strands (such as stem-loops, etc.). The probe design results in changes of conductance of electrical signals due to strand displacement reaction.
[0106] The probe design can be optimized for sensing a nucleic acid molecule utilizing strand displacement reaction in a solution. Additionally, the sensor design can be improved by placing the optimized probe for strand displacement reaction on a solid phase.
Detection by Fluorescence Labeling
[0107] In some embodiments, strand displacement can be monitored over time with fluorescence labeling (
Detection by Graphene FET
[0108] In some embodiments, the binding of target nucleic acid molecules to the nucleic acid probes can be detected by electrical sensors using a graphene FET chip and the electrical signals can be transmitted wireless. For example, the nucleic acid probes can be attached to the surface of the graphene FET chip as follows: 1-Pyrenebutanoic acid succinimidyl ester (PASE) can be used to link graphene and amino group at the N-terminal of a nucleic acid probe. The pyrene group of PASE and graphene is attracted to each other with - stacking interaction and the amino group at N and amide bond on PASE can be covalently linked. See
[0109] In one example, 30-nucleotide long DNA strands can be immobilized onto the graphene surface, by the - stacking with the probe DNA strand. The surface of each graphene chip can be saturated with a probe DNA resulting in a measured increase in the resistance of the graphene. The target DNA, which is complementary to the probe DNA, is the DNA to be detected. When the target DNA hybridizes to the probe DNA, it causes the - stacking of the pyrene label on the DNA with the graphene to be critically weakened. This results in the detachment of the probe/target duplex from the graphene surface resulting in a decrease in the measured resistance of the graphene.
[0110] As shown in
Fabrication of Graphene FET Chip
[0111] As illustrated in
Functionalization of Nucleic Acid Probes on Graphene FET Chip
[0112] In some embodiments, the nucleic acid probes are brought into contact with the surface of the graphene FET chip such that the probes are attached to the surface of the graphene FET chip. Optionally, the surface of the chip is saturated with the nucleic acid probes. Subsequently, the nucleic acid molecules to be tested, including target nucleic acid molecules, are introduced and allowed to bind to the probes such that electrical measurements can be taken. For example, the probe and target nucleic acid molecules are treated by dropping appropriate concentrations of each in the reservoir on the graphene FET chip for a sufficient period of time, e.g., for an hour, to allow the probes to bind to the surface of the FET chip or to allow the target molecules to bind to the probes. The chip is then rinsed gently with a buffer, e.g., phosphate buffered saline (PBS). All volumes of treated samples, including the probes and the targets can be as small as about 90 L.
Electrical Measurement
[0113] In some embodiments, I-V curves and resistance can be measured in a semiconductor parameter analyzer equipped with a probe station. Silver wire can be used as an electrode, which applies gate voltage (Vg) to the 12.5 mM MgCl.sub.2/30 mM Tris buffer solution. Tests can also conducted with 1PBS buffer solution. Vg can be swept from 0.5 to 1 V, and drainsource voltage (Vds) can be between 0.05 and 0.3 V. Drainsource current (Ids) can be measured at an assigned Vds. Resistances can be measured between 0 and 100 mV of Vds.
[0114] In some embodiments, after measurements on the probe station, resistance measurements can be simultaneously performed using a standard digital multi-meter (DMM) (Fluke 175 True RMS multimeter) and connected to the smartphone via the wireless system. The source voltage can be swept between 0 and 0.5 V. Current values can be converted into a voltage signal by introducing a pull-up resistor of 1 k. The potential difference which corresponds to 1000 times the current value can be measured by the device. This data can be sent to a smartphone for further data processing. Voltage values can be plotted against their respective current values with a trend line. Gradient of the trend line represents resistance of the entire circuit with the resistivity of device obtained by subtracting the resistance of the other components, 1 k pull-up resistor and 10 k filtering resistor.
Wireless Communication
[0115] The graphene chip can be integrated into a proprietary wireless system using a microcontroller board. A flow chart of the top-level design of graphene chips communication with a smartphone is presented in
[0116] In some embodiments, communication can be established through the HC-06 Bluetooth module. The HC-06 module communicates with the FRDM-KL25Z using the Serial RS-232 communication protocol while pairing with user electronics, phones and computers, over the Bluetooth communication standard.
Generation of Wireless Signal
[0117] The FRDM-KL25Z microcontroller board can generate a digital approximation of an analogue signal using pulse-width-modulation (PWM). Typically, PWM signals give a relatively good representation of an analogue signal because most electronic appliances do not react to relatively small voltage changes, however, because of the electrolysis of aqueous solutions the graphene system is sensitive to significant voltage changes. The microcontroller board creates the PWM signal by switching the voltage digitally (between the only two modes) off (0 V) and on (3.3 V) producing an analogue signal determined by the time averaging 0 V and 3.3 V over each period interval. For example, to produce a PWM analog signal of 1 V, the microcontroller board generates a signal of 0 V for 70% of the time and 3.3 V signal for 30% of the time. The nature of PWM signals can therefore cause the DNA-chip to experience a voltage of 3.3V regardless of how small the analogue signal generated by the microcontroller board. This bias voltage can cause electrolysis of the aqueous electrolytes and its effect on the system is evident in I-V plot of the system before low-pass filtering.
[0118]
[0119] The effect from the 3.3 V spikes can be removed from the system by implementing a simple 1st order Resistance-Capacitor (RC) low-pass filter with the shown configuration, as shown in
=RCEq. (1)
[0120] To determine the values of R and C, the PWM value can be 0.1V and PWM period can be 200 s. Time period where PWM signal is 3.3V (high):
[0121] Calculate time constant required for V.sub.out=0.1V using Eq. 3 to obtain Eq. 4:
[0122] can be further calculated as
[0123] A low-pass RC filter can be constructed using a 5 k resistor and a 33 nF capacitor, using values R=5 k and C=33 nF:
=5 k*33 nF=165 sEq. (6)
[0124]
[0125]
Evaluation of Measurement System
[0126] The FRDM-KL25Z microcontroller board provides five analogue-to-digital converters (ADC) to measure analogue signals. The board can only measure voltages; therefore, requiring currents to be converted into voltage signals before it can be measured. In some embodiments, currents over a range of voltage values can be recorded to examine the resistance of graphene FETs. Current values can be converted to voltage levels by using a 1 k pull-up resistor between the graphene FET and ground. They can be then obtained by measuring the voltage across the resistor and converting it to current values using ohm's law. These results can be then plotted on an I-V graph with the gradient of the trend line representing resistance of the entire circuit. The use of a trend line rejects measurement noise and reduces the impact of anomalous data points.
[0127] In addition, to reduce noise in the voltage measurement by the FRDM-KL25Z microcontroller board, in some embodiments, every data point was taken as an average over 10000 samples measured.
[0128] This filtering further improves measured values, filtering minor measurement inaccuracies (+0.35%).
Post Measurement Processing
[0129] The Root Mean Squared Error (RMSE) can be used as the measure of accuracy, with smaller RMSE values corresponding to better accuracy. The operation of the algorithm is simulated using 25 accurate measurements made through the course of this research.
[0130] Noise is then removed from device measurements for the next 1000 measurements.
[0131] Simulation can be conducted using 2000-6000 resistance values. The values follow a Gaussian distributed to simulate measurements from human populations. In some embodiments, noise of 2.2% to 10.91% can be added to these resistances. Measurement noise is assumed to be uniformly distributed.
[0132] Table 2 illustrates the changes in measurement noise for the first 9 measurements.
TABLE-US-00002 TABLE 2 Resistance values measured by device and specialized equipment and changes in estimated measurement noise Data Points 1 2 3 4 5 6 7 8 9 Device() 3894.4 5059.8 4775.9 3916.9 7320 3413.2 2038.5 3644.3 5883.4 Accurate() 3780 4980 4850 3780 7080 3210 1850 3440 5800 Noise 1.0303 1.0160 0.9847 1.0362 1.0339 1.0633 1.1019 1.0594 1.0144 E(Noise) 1.0303 1.0231 1.0103 1.0168 1.0202 1.0274 1.0380 1.0407 1.0378
[0133]
[0134] Using the wireless setup, the data can be transferred to both personal computer and smartphone. The examples of the screenshots are shown in
DNA Sensing Data Analysis
[0135] The binding of the nucleic acid probe is observed by an increase in the resistivity of the graphene FET. In some embodiments, to test the operation of specific DNA detection, target DNA, which is the complementary strand to probe DNA, can be added in increasing concentrations. Decreased levels of resistivity indicates binding of the two DNA strands causing them to detach from the graphene surface. Higher concentrations of target DNA results in a greater decrease in resistivity implying more DNA strands binding together, detaching from the graphene surface in the process. This phenomenon demonstrates the ability of this device to detect DNA and offers a possible method to detect specific DNA sequences by using appropriate probe DNA sequences.
where R.sub.non-complementary and R.sub.complementary are the resistance values with non-complementary and complementary target DNA for each of the experimental conditions and Rprobe is the maximum resistance when probe DNA is treated on the sensor.
IMPLEMENTATION OF THE DISCLOSED TECHNOLOGY
[0136] The disclosed and other embodiments and the functional operations described in this document, such as measurements, data collection, and data processing, can be implemented in digital electronic circuitry, or in computer software, firmware, or hardware, including the structures disclosed in this document and their structural equivalents, or in combinations of one or more of them. The relevant operations for the disclosed and other embodiments can be implemented as one or more computer program products, i.e., one or more modules of computer program instructions encoded on a computer readable medium for execution by, or to control the operation of, data processing apparatus. The computer readable medium can be a machine-readable storage device, a machine-readable storage substrate, a memory device, a composition of matter effecting a machine-readable propagated signal, or a combination of one or more them. The term data processing apparatus encompasses all apparatus, devices, and machines for processing data, including by way of example a programmable processor, a computer, or multiple processors or computers. The apparatus can include, in addition to hardware, code that creates an execution environment for the computer program in question, e.g., code that constitutes processor firmware, a protocol stack, a database management system, an operating system, or a combination of one or more of them. A propagated signal is an artificially generated signal, e.g., a machine-generated electrical, optical, or electromagnetic signal, that is generated to encode information for transmission to suitable receiver apparatus.
[0137] A computer program (also known as a program, software, software application, script, or code) can be written in any form of programming language, including compiled or interpreted languages, and it can be deployed in any form, including as a stand-alone program or as a module, component, subroutine, or other unit suitable for use in a computing environment. A computer program does not necessarily correspond to a file in a file system. A program can be stored in a portion of a file that holds other programs or data (e.g., one or more scripts stored in a markup language document), in a single file dedicated to the program in question, or in multiple coordinated files (e.g., files that store one or more modules, sub programs, or portions of code). A computer program can be deployed to be executed on one computer or on multiple computers that are located at one site or distributed across multiple sites and interconnected by a communication network.
[0138] The processes and logic flows described in this document can be performed by one or more programmable processors executing one or more computer programs to perform functions by operating on input data and generating output. The processes and logic flows can also be performed by, and apparatus can also be implemented as, special purpose logic circuitry, e.g., an FPGA (field programmable gate array) or an ASIC (application specific integrated circuit).
[0139] Processors suitable for the execution of a computer program include, by way of example, both general and special purpose microprocessors, and any one or more processors of any kind of digital computer. Generally, a processor will receive instructions and data from a read only memory or a random access memory or both. The essential elements of a computer are a processor for performing instructions and one or more memory devices for storing instructions and data. Generally, a computer will also include, or be operatively coupled to receive data from or transfer data to, or both, one or more mass storage devices for storing data, e.g., magnetic, magneto optical disks, or optical disks. However, a computer need not have such devices. Computer readable media suitable for storing computer program instructions and data include all forms of non-volatile memory, media and memory devices, including by way of example semiconductor memory devices, e.g., EPROM, EEPROM, and flash memory devices; magnetic disks, e.g., internal hard disks or removable disks; magneto optical disks; and CD ROM and DVD-ROM disks. The processor and the memory can be supplemented by, or incorporated in, special purpose logic circuitry.
Example Applications of the Disclosed Technology and Devices
[0140] The disclosed technology and nano-sensor devices have a number of applications including microarrays; biomolecular sensors for in vitro and in vivo uses; implantable biosensors for continuing real time monitoring of biomolecules in the body of humans or animals; digital biosensors; wireless biosensors; and nanobiosensors. Specifically, the disclosed technology enables, in one useful aspect, a cheaper, faster and portable nucleic acid sensing technique and device for detecting nucleic acid damage or mutation in early stages for global health management.
WORKING EXAMPLES
[0141] The following examples illustrate various embodiments of the technology disclosed in this document. By no means the following examples limit the scope of the invention in any way.
Nano-Sensors for Visual-Based Detection
Example 1 Materials and Method
[0142] Chemicals and buffer solutions were obtained from Sigma Aldrich (Saint Louis, Mo.). All DNA constructs were obtained from IDT (Coralville, Iowa). DNA ladders were from Promega (Madison, Wis.). DNA gels were from Lonza (Walkersville, Md.). Nano-gold particles were from BBI (UK). TEM grids were from Ted Pella (Redding, Calif.). All the DNA sequences used appear in Table 3 below.
TABLE-US-00003 TABLE3 SequencesoftheDNANano-Devices L 5-GCCATAGTTAGAGCATGCGCCATAGTIITTTTITTTITTITT IITTTIITTTITTITIITTITITCCCTTCCGAATGCAGCTGCCATTCC GAATGC-3 R 5-CGCAATCCACCGATCATCCGCAATCCAAATCTCCCAACC ACAACAAACCAAACCAACAACAAACAACACCACTATGGC GCATGCTCTAACTATGGC-3 F 5-GGTGTTGTTTGTTGTTGGTTTGGTTTGTTGTGGTTTTTA GATTTGGATTGAAGTGAGCGT-3 C 5-ACGCTCACTTAAATCTAAAAACCACAACAAACCAAACCA ACAACAAAC-3 T 5-AAGGGACCCAACCACAA-3 T-SH 5-/5ThioMC6-D/ttttttAAGGGACCCAACCACAA-3 T-FQ 5-/FAMQ/ttttttAAGGACCCAACCACAA-3 A1 5-CGGATGATCGGTGGATTGCG-3 A2 5-GCATTCGGAATGGCAGCTGCATTC-3 A2-FAM 5-GCATTCGGAATGGCAGCTGCATTCttt/FAM/-3 A1-SH 5-CGGATGATCGGTGGATTGCGttt/3ThioMC3-D/-3 A2-SH 5-/5ThioMC6-D/tGCATTCGGAATGGCAGCTGCATTC-3 L 5-GCCATAGTTAGAGCATGCGCCATAGTIITITTITTTITTITT IITTTIITTTITTITIITTIIITCCCTTCCGAATGCAGCTGCCAT TCCGAATGC-3 R 5-CGCAATCCACCGATCATCCGCAATCCAAATCTCCCAACC ACAACAAACCAAACCAACAACAAACAACACCACTATGGC GCATGCTCTAACTATGGC-3 F 5-GGTGTTGTTTGTTGTTGGTTTGGTTTGTTGTGGTTTTTA GATTTGGATTGAAGTGAGCGT-3 F-no 5-GGTGTTGTTTGTTGTTGGTTTGGTTTGTTGTGGTTGGGA mismatch GATTTGGATTGAAGTGAGCGT-3 F-6 5-GGTGTTGTTTGTTGTTGGTTTGGTTTGTTATAATTAAA mismatches AGATTTGGATTGAAGTGAGCGT-3 F-12 5-GGTGTTGTTTGTTATTAATTTAATTTATTATAATTAAAAGA mismatches TTTGGATTGAAGTGAGCGT-3 AF 5-ACGCTCACTTCAATCCAAATCTAAAAACCACAACAAACC AAACCAACAACAA-3 T 5-AAGGGACCCAACCACAA-3 T-SH 5-/5ThioMC6-D/TTTTTTTAAGGGACCCAACCACAA-3 T-FQ 5-/FAMQ/TTTTTTTAAGGGACCCAACCACAA-3 T-FAM 5-/FAM/TTTTTTTAAGGGACCCAACCACAA-3 A1 5-CGGATGATCGGTGGATTGCG-3 A2 5-GCATTCGGAATGGCAGCTGCATTC-3 A2-FAM 5-GCATTCGGAATGGCAGCTGCATTCGGT/FAM/-3 A1-SH 5-CGGATGATCGGTGGATTGCGTTT/3ThioMC3-D/-3 A2-SH 5-/5ThioMC6-D/TGCATTCGGAATGGCAGCTGCATTC-3
Device Description of DNA Capture and Release
[0143] In some embodiments, disclosed herein is a DNA device that captures and releases a specific DNA strand repeatedly, named Capture and Release device (CR device). The operation of the carrier depends upon mismatches between strands. Given that hybridization energy depends on strand length and temperature, the reaction between different strands can be precisely manipulated. By controlling the number of mismatches and hybridization length, the disclosed DNA device allows repeated capture and release of the same DNA strands while simultaneously being sensitive to nucleotide mismatches.
[0144] In some embodiments, the device consists of three parts, a right side (R), a left side (L) and a targeted capture and release strand (T). R and L are complimentary to one another (
[0145] In one example, R and L had 90 nucleotides (nt), which were complimentary to each other over the entire length. R and L had additional toeholds of 10 nt (5 end for R) and 6 nt (3 end for L), respectively. Thus, the total length for R and L were 100 nt and 96 nt. 26 nt bound R and L, and 20 nt and 24 nt of extended arm parts existed at the end of R and L from toeholds, respectively. In another example, R and L had 64 nucleotides (nt), which were complimentary to each other over the entire length. R and L had additional toeholds of 12 nt (5 end for R) and 6 nt (3 end for L), respectively. Thus, the total length were 76 nt and 70 nt. Among the 64 nt that were complimentary between R and L, 26 nt formed the hinge binding R and L at all times. Extensions were added on to the toehold for binding of fluorophore or thiol containing strands. See
[0146] The toeholds were not complimentary to each other to allow for operation of the device. T was 17 nt and complimentary to L such that it was complimentary over the 6 nt of the toehold on L. The device was designed such that the short 6 nt toehold on the L strand had too weak an affinity for the T strand when at a controlled temperature and concentration. This limited hybridization of T and L when L was hybridized to R. F had 60 nt and two toeholds, one was complimentary to a toehold of R, and the other one was complimentary to a toehold for AF, the anti-fueling strand. AF was 54 nt and 12 nt were a toehold for F strand. Alternatively, AF was 52 nt and 10 nt were a toehold for F strand. Theoretically, F should be complimentary to T and AF should be complimentary to L. Interactions between these strands could disrupt the desirable operation of the device. To prevent these undesirable interactions, F had 3 consecutive nt of mismatch to R and T, which was 36.sup.38 nt from 5 end of F (
[L:R]+T+F.fwdarw.[R:F,L:T] (capturing),
[R:F,L:T]+AF.fwdarw.[L:R]+T+[F:AF] (releasing).
Fluorescence Observation of Device Activity
[0147] Operation of the device was monitored over time by fluorescent probes. Fluorescent probes were tagged to L, while a fluorescence quencher was attached to T (
Transmission Electron Microscopy of Capturing and Releasing
[0148] Operation of the devices was also seen by transmission electron microscopy (TEM, JEOL 1200 EX II TEM). The DNA sequences were elongated by adding thiol containing arms (A) to R and L, enabling DNA to attach to Gold-nano particle (AuNP [d=10-20 nm]) for TEM visualization. The arm parts for L (A1-SH, Table 3) were 20 nt and for R (A2-SH, Table 3) was 24 nt. Citrate-coating of AuNPs was replaced by phosphine to improve stability in buffer solution. Phosphine (bis(p-sulfonateophenil)phenylphosphine dihydrate dipotassuim salt) was added to AuNPs and gently stirred overnight. AuNP samples were suspended with buffer solution and centrifuged. This was repeated 3 times. The disulfide functional groups were cleaved by addition of tris(2-carboxyethyl)phosphine (TCEP) slurry to samples. After 1 hour of mixture, the cleaved samples were purified using Pierce spin cup paper filter. Freshly cleaved DNA samples were then mixed with the AuNPs samples in different ratios. For 1:1 ratios of device to AuNP, thiol groups were attached to L arms, and for 3:1 ratios, it was done on R side (
Gel Electrophoresis Analysis of Capturing
[0149] Capture and release states were verified by DNA gel electrophoresis. The same extended devices used in the Transmission Electron Microscopy experiments were run on the gel (
Example 2 A Single Nucleotide Toehold is Sufficient to Markedly Enhance DNA Strand Displacement Kinetics
[0150] Conventional DNA double helix requires modifications such as single-strand toeholds or replacement of deoxyinosine instead of deoxyguanine to display readily detectable strands' displacement. The effect of toehold lengths on kinetics of strand displacement of DNA nano-devices having sequences that were engineered using either conventional nucleotides or inosine-based DNA double helix designs were analyzed. Activity of the devices was continually monitored and recorded using time-lapse fluorescence detection. Performance of devices was evaluated based on measurements of kinetics of strands' displacement reactions and difference in performance was estimated by calculating the ratios of kinetics' values for each experimental condition.
[0151]
[0152] Time-lapse analysis of DNA double helix dynamics based on kinetics of strand displacement reactions revealed a superior performance of inosine-based DNA nano-devices compared to conventional double helix designs and introduction of a single nucleotide toehold further enhances the kinetics of strands' displacement (
[0153] Inosine-based devices displayed a superior performance regardless of toehold lengths. Notably, introduction of a single nucleotide toehold into devices was sufficient to enhance the strand displacement kinetics of both inosine-based and conventional DNA double helices. However, inosine-based DNA nano-device harboring a single nucleotide toehold was 7,500-fold more efficient in sensing invading strands compared to similar devices engineered using the conventional DNA double helix design, as shown in
[0154] These results demonstrate that inosine-based DNA nano-devices represent a superior experimental system for analysis of DNA double helix dynamics compared to conventional double helix designs and introduction of a single nucleotide toehold further enhances the kinetics of strands' displacement.
[0155] Table 4 below lists examples of some top performing nano-sensors for detection and discrimination of nucleic acids at a single nucleotide resolution.
TABLE-US-00004 TABLE 4 Examples of nano-sensors for detection and discrimination of nucleic acids at a single nucleotide resolution Nano-device sensitivity Invading Concentration, t.sub.1/2 enhancement strand nM k (M1*s1) (sec) factor** Nano-Device: DNA[N]:RNA[w] hybrid RS2-10 (3 nM) 6 nt toehold oRNA + 6 20 nM 180507 192 90254 100 nM 173287 40 86643 oDNA + 6 20 nM 132280 262 1895.1 100 nM 133298 52 1909.7 No toehold oRNA 500 nM 4881 284 2440.5 1000 nM 4951.1 140 2475.6 oDNA 500 nM 6134 226 87.88 1000 nM 6027.4 115 86.35 Nano-Device: RNA[N]:DNA[w] hybrid RS2-10 (3 nM) 6 nt toehold oRNA + 6 10 nM 462098 150 231049 30 nM 372427 67 186213 oDNA + 6 20 nM 145619 238 2086.2 30 nM 160475 146 2299.1 No toehold oRNA 100 nM 77705 92 38853 oDNA 100 nM 72742 96 1042.2 **Calculated compared to the k values measured in the experiments with toehold-less inosine-based RS2 DNA nano-devices.
Example 3 Inosine-Based DNA Nano-Device Efficiently Discriminates Invading Strands at a Single Nucleotide Resolution
[0156] For analysis of DNA double helix dynamics it is highly desirable to have an analytical system capable of discriminating sequences of nucleic acids at a single nucleotide resolution. In the next set of experiments it was determined whether the analytical performance of inosine-based DNA nano-devices was sufficient to discriminate the invading strands at a single nucleotide resolution. To accomplish this task, the invading strands complementary to the [N] strands of inosine-based [N:W] DNA nano-devices were engineered and their ability to induce strands' displacement to the invading strands containing a single nucleotide mismatch was compared. In these experiments, nano-devices and invading strands were designed to recapitulate the endogenous DNA and RNA sequences harboring disease-associate single nucleotide polymorphism (SNP) variants. Invading strands harboring a single nucleotide mismatch were 56-fold less potent in inducing the strands displacement (
[0157] These results demonstrate that inosine-based DNA nano-devices are highly efficient in sensing and discriminating invading DNA and RNA molecules at a single nucleotide resolution, thus further supporting the utility of this system for analysis of DNA double helix dynamics. Inosine-based design of nano-devices and corresponding analytical protocols disclosed herein can be utilized for engineering and cost efficient manufacturing of nano-sensors and analytical instruments for highly reliable, sensitive, and reproducible single nucleotide polymorphism (SNP) measurements.
Example 4 Invading RNA Molecules Induce Strand Displacement Reactions of 5-Methyl-Cytosine DNA Double Helix
[0158]
[0159]
TABLE-US-00005 TABLE 5 Strand Displacement Kinetics oRNA RS2 oDNA RS2 t.sub.1/2 k (M.sup.1*s.sup.1) t.sub.1/2 k (M.sup.1*s.sup.1) DNA No MgCl.sub.2 58675 3.94 1855 124.55 0.2 mM MgCl.sub.2 60475 3.82 1975 116.99 2 mM MgCl.sub.2 110215 2.10 2095 110.29 5 mC DNA No MgCl.sub.2 n/a n/a 4660 49.26 0.2 mM MgCl.sub.2 n/a n/a 3010 76.76 2 mM MgCl.sub.2 62418 3.70 1570 147.17
[0160] Previous experiments indicate that the kinetics of strands' displacement reactions was significantly affected by structural variations of both DNA double helix and invading strands sequences. In the next set of experiments, it was determined whether naturally-occurring chemical modifications of nucleotides' structure such as cytosine methylation would have an effect on strands' displacement reactions of DNA double helices. Toehold-less DNA nano-devices were designed and manufactured recapitulating endogenous sequences in which 5-methyl-cytosines (5mC) were substituted for cytosine nucleotides and strands displacement kinetics of 5mC-based nano-devices were compared to inosine-based nano-devices containing conventional cytosine nucleotides. Invading RNA molecules triggered a dose-dependent dissociation of DNA strands of toehold-less inosine-based nano-devices as shown in
[0161] Collectively, these data indicate that endogenous RNAs may function as efficient inducers of DNA double helix transitions from double-stranded to single-stranded states at genomic loci containing either conventional cytosine or 5-methyl-cytosine nucleotides. Further, the experiments suggest that cytosine methylation decreases kinetics of DNA strand displacement reactions in response to invading RNA molecules. This inhibitory effect of cytosine methylation may be reversed by transition of 5mC-based DNA double helix to Z conformation in the presence of bivalent ions at physiological concentrations.
Example 5 Markedly Enhanced Responsiveness to Invading RNA Molecules of Toehold-Bearing Inosine-Based Nano-Devices Containing RNA/RNA, RNA/DNA and DNA/RNA Hybrid Duplexes
[0162] DNA nano-devices engineered using 5mC-based and inosine-based DNA double helix designs manifested significantly slower kinetics of strands displacement reactions induced by invading RNA molecules compared to DNA sequences as shown in
[0163]
[0164]
[0165] To enhance the device performance, both inosine substitution and toehold extension concepts shown in
[0166] In the next set of experiments the analytical performance of nano-devices containing toehold-less and toehold-bearing DNA[N]/RNA[W] and RNA[N]/DNA[W] hybrid duplexes was investigated (
TABLE-US-00006 TABLE 6 Experimental Rate Constant for Toehold-Mediated Displacement Reactions Measured at 41 C. and 25 C. (in units of M.sup.1s.sup.1) w/Inosine w/o Inosine B.sub.{LR} 2.sup.nd-Order k.sub.{LR}(0, b) fit 25 C. n k n k 10 121000 8 176000 8 96100 7 168000 7 80600 6 151000 6 77100 5 122000 5 55200 4 77000 4 1790 3 56000 3 1270 2 7700 2 10.3 1 6900 1 0.92 0 3800 0 (BESE)* N/A
With inosine data: T=25 C., =1.4, k.sub.n=1.8310.sup.5M.sup.1s.sup.1 (obtained from assuming a pseudo-first order reaction of n=8 as described above), k.sub.{LR} and k.sub.{L} were calculated assuming a pseudo-first order reaction. [B]=3 nM, [f]=30 nM (except for n=1,2, [B]=10 nM, [f]=100 nM and for n=0, [B]=3 nM, [f]=300 nM). .sup.Predicted empirically as [k.sub.{L}(n=1)]+[k.sub.{LR}(n=0)]. Without inosine data: For T=25 C., =3.3, G.sub.AG.sub.base=1.50 kcal/mol, k.sub.n=1.2410.sup.5 M.sup.1s.sup.1 (obtained from assuming a pseudo-first order reaction of n=10 as described), b=30 and P.sub.c(10, 30), [S]=3 nM, [f]=30M (except for n=3, 4, [f]=1 M, n=2, [f]=10 M and for n=1, [f]=100 M).
[0167]
[0168]
[0169] The experiments demonstrate that the design of nano-devices for detection and quantitative analyses of RNA molecules should incorporate the architectural principles of inosine substitutions and toehold extensions during engineering and manufacturing of double-stranded RNA-based nano-sensors. Furthermore, these data suggest that the presence of antisense transcripts in biological systems may have a dramatic effect on DNA double helix dynamics: they appear to preferentially bind to complementary RNA molecules and efficiently remove RNAs from RNA/DNA hybrids triggering transition from single-stranded to double-stranded states.
Example 6 A Self-Sustaining Continually Cycling DNA Nano-Device for Modelling and Mechanistic Analysis of DNA Double Helix Dynamics
[0170] It is desirable that DNA double helix dynamics of both strand dissociation and re-association reactions are continually monitored using the same DNA molecules as it occurs during DNA double helix opening and closing cycles in vivo. A simple DNA device which captured and released of specific DNA strands repeatedly during continuous cycles of operation was designed, as shown in
[0171] To prove successful operation of this device, a fluorescence probe was tagged to L and a fluorescence quencher to T and the activity was monitored in the spectrometer. Addition of F to the system resulted in opening, and a rapid and continuous decrease of fluorescence indicating binding of T containing the quencher (see
[0172] The recycling usage of the CR device offered several practical advantages. It could significantly reduce the production and operation cost for prospective analytical applications. The CR device provided analytical benefits through its repeating operation by responding to presence of fueling and anti-fueling strands. Moreover, a microarray could be fabricated for in vitro diagnostic applications with a CR device which could be repeatedly activated and deactivated to confirm results. This would improve the sensitivity and specificity of the sensor.
[0173]
[0174]
[0175]
[0176]
Example 7 Fluorescence Observation of Device Activity
[0177] Operation of the device was monitored over time by fluorescent probes. Fluorescent probes were tagged to L, while a fluorescence quencher was attached to T (
[0178] Because of the 6 nt toehold on T, the stability of the device at equilibrium increased significantly at lower temperatures (
[0179] Similarly, concentration also affected the device operation. As concentration increased, greater device robustness was achieved. However, similar to at 27 C., maximum fluorescence was reduced. Low concentrations resulted in decreased affinity between T and L resulting in weak capture when the device was opened (
[0180] Altering the number of mismatches in F with T and R eventually lead to device inactivation. The device did not function properly when the opening strand F had more than 6 nt of mismatch or no mismatch (
Example 8 SNP Detection with Fluorescence Observation
[0181] In another example, the strand displacement was monitored over time with fluorescence labelling (
[0182] N strand which was tagged with fluorescence quencher and W strand with fluorescence label were mixed in ratio of 1:1 in 1PBS solution and annealed from 20 C. to 90 C. and cooled to 4 C. over 3-4 hours. A Texas Red having excitation maximum wavelength of 596 nm and emission maximum wavelength of 613 nm was used. Perfect match and single mismatch T strand were both suspended in 1PBS. The hybridized DS probe was diluted in 1PBS into 20 nM and tested using a Tecan Infinite 200 M plate reading spectrometer (San Jose, Calif.) at 27 C. with an accuracy estimated to be approximately 1.5 C. Excitation/Emission of TEXAS red were observed at 590/620 nm. Each experiment began with a 50 L sample volume with a device concentration of 20 nM (20 nm of DS probe and 100 nM or 300 nM of T) in black 96 well plates. Clear microplate sealing films were applied over the sample wells to avoid evaporation. The same test was conducted in 1PBS buffer solution.
[0183] The length of the toehold affected the reaction rate and thus varied length of toeholds were tested (
[0184] To confirm that the single mismatch T did not hybridize partially from toehold part until the mismatched point, the discrimination was verified by DNA gel electrophoresis. To perform DNA gel electrophoresis, the structure of the DS probe was modified to accumulate T to DS probe, not just exchanging their position. The operation of DS probe was not affected when W and N were bound by hinge part in that the hinge part was introduced to conform the DS probe partial-triple strand after strand displacement (
Example 9 Translation of Strands Displacement Reactions into Defined Geometrical Shapes for Visualization of DNA Double Helix Nano-Dynamics
[0185]
[0186]
[0187]
[0188] To visualize DNA strand displacement reactions and demonstrate the potential nano-mechanical applications, gold nanoparticles (AuNPs) of different sizes were attached to tweezers and T. Operation of the devices was also seen by transmission electron microscopy (TEM, JEOL 1200 EX II TEM). The DNA sequences were elongated by adding thiol containing arms (A) to R and L, enabling DNA to attach to gold-nano particle (AuNP [d=10-20 nm]) for TEM visualization. As an example of the device's mechanical activity, it was utilized to capture and release AuNPs linked to small DNA strands. Successful capture of AuNPs was visualized with TEM. 20 nm AuNPs were attached to either R or L while 10 nm particles were attached to T. AuNPs attached to R resulted in a separation gap between 20 nm and 10 nm particles when T bound AuNP were captured (panel (d)), while no gap was present when AuNPs were attached to L(panel (c)), as shown in
[0189] Capture and release states and geometric shape changes of the CR device were verified by DNA gel electrophoresis as shown in
[0190] In these experiments, the DNA devices were unlabeled while T contained a fluorophore. T strand was a 17 nt single stranded sequence. The devices were 96 nt, double stranded, and had 26 nt extended arms. See
Example 10 A Model of RNA-Guided DNA Double Helix Nano-Dynamics
[0191]
[0192]
[0193]
[0194]
[0195] Typically, nucleosomal DNA is not accessible for regulatory proteins. It undergoes rapid spontaneous unwrapping/rewrapping cycles: it remains fully wrapped for 250 ms before unwrapping and rewrapping within 10-50 ms. Spontaneous conformational changes of nucleosomes leading to a transient lift of a DNA stretch from the histone surface and a site exposure for sequence-specific DNA binding proteins are likely to occur at the genomic loci harboring nascent chromatin lacking linker histone H1. Capturing of protein-less DNA strands and RNA-guided DNA strands displacement reactions in vivo are predicted to take place during a rapid transient DNA strands unwrapping off the histone surface.
[0196] The experiments disclosed herein identified novel structural determinants markedly affecting the kinetics of DNA strands displacement reactions that may have fundamental mechanistic implications by asserting the regulatory effects on DNA double helix dynamics in vivo as shown in
Nano-Sensors for Electro-Based Detection
Example 11 Methods of Detection of Nano-Sensors' Engagement with Target Molecules
[0197] Three example methods can be used for detection of nano-sensors' engagement with target nucleic acid molecules:
1. fluorescence-based detection shown in Examples 2-6;
2. gel electrophoresis-based detection shown in Example 7; and
3. transmission electron microscopy-based detection shown in the Example 7.
[0198] Importantly, interactions of nano-sensors with specific genetic targets can be visualized by detecting defined images and geometrical shapes, thus affording digital, computational, and web-based capabilities for capture and transmission of diagnostic information.
[0199] Other examples of methods of detection of nano-sensors' engagement with target molecules are shown in
[0200]
[0201]
[0202]
Example 12 Single Mismatch Detection on Graphene FET
Materials and Methods
[0203] PASE, ethanolamine, MgCl.sub.2 and conducting silver paste were obtained from Sigma Aldrich (Saint Louis, Mo.). Graphene (chemical vapor deposition (CVD) grown graphene) was from ACS material (Medford, Mass.). Silicone rubber was from Dow Corning (Midland, Mich.). PBS and Tris solution were from Thermo Fisher Scientific (Waltham, Mass.). Poly (methyl methacrylate) (PMMA) was from MicroChem (Westborough, Mass.). Ammonium persulfate was from MP Biomedicals (Solon, Ohio). DNA gels were from Lonza (Walkersville, Md.). Ultrapure water was obtained from a Millipore water purification system such as A10 water purification system having a resistivity of 18.2 M The FRDM KL-25Z microcontroller board was purchased from Freescale Semiconductor, Inc. A Bluetooth HC-06 module was purchased from Guangzhou HC Information Technology Co., Ltd. All DNA oligonucleotides were purchased from IDT (Coralville, Iowa) and all DNA sequences are listed in Table 7.
TABLE-US-00007 TABLE7 DNAsequencesusedintheexperiment W 5-TEXASRED615-TGAAAGIGTTTTAATAATAGAATTTTA AAAIACTIGTAIATTTTTTTTTTCTCTATCAATCTCTAACAC CC N GGGTGTTAGAGATTGATAGAGCGGCCTTATTTCTACCAG TCTTTTAAAATTCTATTATTAAAACCCTTTCA-RQ Perfect TGAAAGGGTTTTAATAATAGAATTTTAAAAGACTGGTAG matchT AAATAAGG Single TGAAAGGGTTTTAATAATATAATTTTAAAAGACTGGTAG mismatchT AAATAAGG Probe 5-TAATAATAGAATTTTAAAAGACTGGAATAA-3 Complemen- 5-TTATTCCAGTCTTTTAAAATTCTATTATTA-3 taryDNA Non- 5-ACTGATGCACTGATTACCTGCTACGATCGA-3 complemen- taryDNA N GGGTGTTAGAGATTGATAGAGCGGCCTTATCCAGTATTTTAAAA TTCTATTATTA W TAATAAATIAATTTTAAAAIACTIITTTTTTTTTTCTCTATCAATCTC TAACACCC Perfect TAATAATAGAATTTTAAAAGACTGGAATAA matchDNA Single TAATAATAGAAGTTTAAAAGACTGGAATAA mismatch DNA
Fabrication of Graphene FET Chip
[0204] The top side of graphene on copper film was spin-coated with PMMA to protect the Top side of graphene while the bottom side of graphene was etched away. PMMA acted as supporting layer of the graphene after etching copper. The back side of graphene was removed by oxygen plasma etching. The sample was cut into 4 mm6 mm size with scissors. Copper was etched by floating on 0.1 M of ammonium persulfate for about 5 hours and rinsed in DI water overnight. The graphene supported by PMMA was then transferred on silicon oxide coated silicon wafer. PMMA layer was removed by acetone at 60 C. for 1 hour. The sample was annealed at 300 C. for 2 hour under hydrogen/argon atmosphere. To fabricate transistor, conducting silver paste was used as source and drain electrodes at the two ends of the graphene. Silicone rubber was applied to insulate source and drain electrodes from liquid and construct solution reservoir.
[0205] In another example, the graphene film was cut into 5 mm8 mm size or 2 mm7 mm size with scissors. Graphene films were obtained from the maker prepared on thin copper substrates. The graphene was on the both side of the copper foil and only the top side was used for FET fabrication. To separate the graphene from the copper substrate PMMA was spin-coated on the top (carbon) surface of graphene/copper substrate to protect the graphene while the copper bottom was etched away. Copper was etched by floating on 0.1 M of ammonium persulfate for about 5 hours and rinsed in deionized (DI) water overnight. PMMA acted as a supporting layer to the graphene once the copper was etch away. The back side of graphene was removed by oxygen plasma etching. The graphene supported by PMMA was then transferred on silicon dioxide coated wafer followed by removal of the PMMA layer with acetone at 60 C. for 1 hour. The sample was then annealed at 300 C. for 2 hours under hydrogen/argon atmosphere. To fabricate transistor, conducting silver paste was used as source and drain electrodes at two ends of the graphene. Silicone rubber was then applied to insulate source and drain electrodes from liquid and also used as a solution reservoir.
Immobilization of DNA Zipper or Probe
[0206] 5 mM of PASE in Dimethylformamide (DMF) was treated on the graphene for 1 hour and rinsed with pure DMF and DI water. 50 M of DNA zipper or probe was added on PASE-modified graphene for 2 hours. The graphene FET with DNA zipper or probe functionalization was rinsed with 1PBS. 100 mM of ethanolamine solution was treated to saturate the possibly unreacted amino group on PASE and rinsed with 1PBS solution. All the volume of treated chemicals and samples was 40-50 L.
Visualization of DNA and Graphene Surface
[0207] Topographic images of DNA on graphene surface were acquired to verify proper functionalization of DNA zipper or probe on the graphene channel, using a Multimode atomic force microscope (AFM) equipped with a Nanoscope V controller (Bruker) (
Strand Displacement on the Chip
[0208] Strand displacement reaction was conducted by dropping appropriate concentration of perfect match and single mismatch T strands and incubated overnight in the reservoir on the graphene FET chip. Then the chip was rinsed gently with 1PBS. All the volume of treated samples was 50 L.
Detection of Strand Displacement on Graphene FET
[0209] The scheme of strand displacement on the graphene FET and single mismatch detection is shown in
[0210] The graphene channel (4 mm6 mm) was transferred onto a silicon oxide-coated wafer using an established method. 1-Pyrenebutanoic acid succinimidyl ester (PASE) was used to link graphene and amino group at the N strand of DS probe. The pyrene group of PASE and graphene was attracted to each other with - stacking interaction and the amino group at N and amide bond on PASE were covalentaly bound. The process of graphene functionalization was monitored at each step using AFM. As shown in
[0211] The conformation of the DS probe on the graphene surface is an important factor on the electrical detection of strand displacement. As only 7 nt among 47 bps became double stranded before and after the strand displacement, if the DS probe was laid down or absorbed on the surface, the signal difference would be too small to be detectable by recognizing the charge difference. The AFM image of
[0212] The source and drain electrodes were applied by silver paste and silicone rubber was used to insulate the electrodes and to create solution reservoir. Sample in buffer solution was placed in the reservoir and a gate voltage was applied directly to the top of the buffer solution. When the surface charge was changed by strand displacement, the charge built up and the I-V curve shifted to left side and the resistance was increased. Functionalization of DS probe changed electrical signals of FET (
[0213] Debye length should be considered when detecting electrical charge in ionic solution. It can be written for aqueous solution at room temperature as
where is the Debye length which is expressed in nanometer, I.sub.B is Bjerrum length which is 0.7 nm, z.sub.i is valencies of the various types of ions and .sub.i is number densities or number of molecules per volume. Note that it is an estimate of the distance where Coulomb interactions are ignored, so does the size of the region near a point charge where opposite-charge counterions can be found. It represents net length of electrostatic effect in ionic solution. Charges are electrically screened outside the sphere whose radius is the Debye length. In 1PBS solution, which is generally used as DNA buffer solution, its debye length is less than 1 nm. More diluted PBS, such as 0.1 or 0.01PBS, allows detection of longer part of the hybridazation as reported. However, the DS probe requires a high ionic concentration to stably operate the strand displacement. If the ionic concentration of buffer solution is too low, its double helix structure can be unstable and can not result in proper strand displacement.
[0214] In the following test of strand displacement, 12.5 mM MgCl.sub.2 and 30 mM Tris buffer was used for lengthier detection of DNA as this MgCl.sub.2 concentration was known to be equivalent to about 1PBS for DNA helix stabilization. MgCl.sub.2 was 2:1 electrolyte (e.g. Mg.sup.2+:2Cl.sup.) and its Debye length of 12.5 mM MgCl.sub.2 was calculated by the above equation and was 1.6 nm. The length of 1 nucleotide is known as 0.4 nm thus, about 4 nt can be detected in 12.5 MgCl buffer solution. However it was reported that the electrical effect of DNA rapidly decreased and that only a few sequences close to the graphene surface determined the electrostatic potential on the sensor. The tests were also conducted with 1PBS and compared with MgCl.sub.2 buffer solution. The MgCl.sub.2 buffer solution generated clearer discrimination (
[0215]
[0216] Resistance change of the channel was measured and compared with perfect match and single mismatch targets according to different concentrations. When DNA was accumulated on graphene surface, its resistance was increased. Immobilization of DS probe and addition of target strands increased the resistance of the channel. The resistance increased 4060% when probe was anchored on the graphene surface. Subsequently perfect match and single mismatch T were tested with each concentration from 100 pM to 10 M, which was equivalent to about 3.01110.sup.9 to 3.01110.sup.14 of T molecules in 50 L of buffer solutions. The actual measurements were conducted at the same test of I-V curve measurement. As shown in the
[0217] In control experiments, single strand probe was tested using only N strand of DS probe to confirm that the discrimination of single mismatch in 47 bps resulted from using DS probe. The single mismatch target strand was tested with concentrations ranging from 1 pM to 10 nM.
[0218] Originally microarrays employed photolithography to fabricate micro-sized spot arrays inspired by transistors array in electronics. The proposed sensor can be also be intergrated in the form of microarray which does not need fluorescence labeling or optical components and can reduce number of spots by detecting longer strand. An example of the nano-sensor disclosed herein in a microarray format is illustrated in
[0219] In another example, a graphene FET with two electrodes and a liquid gate chamber was fabricated to examine electrical sensing of DNA using DNA tweezers-based probes as shown in
[0220] The graphene after transfer was characterized by Raman microscopy. The Raman spectrum of the graphene sample indicated high-quality monolayer graphene, as it shows typical Raman spectrum of a single layer graphene (
[0221] To examine the specificity of the graphene FET sensor, perfect match and single-mismatch samples were tested. Target strands in different concentrations (100 nM to 100 M) were incubated on the sensor overnight (
[0222] While this patent document contains many specifics, these should not be construed as limitations on the scope of any invention or of what may be claimed, but rather as descriptions of features that may be specific to particular embodiments of particular inventions. Certain features that are described in this patent document in the context of separate embodiments can also be implemented in combination in a single embodiment. Conversely, various features that are described in the context of a single embodiment can also be implemented in multiple embodiments separately or in any suitable subcombination. Moreover, although features may be described above as acting in certain combinations and even initially claimed as such, one or more features from a claimed combination can in some cases be excised from the combination, and the claimed combination may be directed to a subcombination or variation of a subcombination.
[0223] Similarly, while operations are depicted in the drawings in a particular order, this should not be understood as requiring that such operations be performed in the particular order shown or in sequential order, or that all illustrated operations be performed, to achieve desirable results. Moreover, the separation of various system components in the embodiments described in this patent document should not be understood as requiring such separation in all embodiments.
[0224] Only a few implementations and examples are described and other implementations, enhancements and variations can be made based on what is described and illustrated in this patent document.