Sensor for NADP (H) and development of alcohol dehydrogenases

Abstract

The present invention relates to an NADP(H) nanosensor comprising i) a nucleic acid sequence to which a regulator is capable of binding, wherein the oxidation state of the regulator depends on the NADP(H) availability; ii) a promoter sequence following the nucleic acid sequence i), to which an RNA polymerase is capable of binding, wherein the affinity of the RNA polymerase for the promoter sequence is influenced by the oxidation state of the regulator; iii) a nucleic acid sequence which is under the control of the promoter sequence ii) and which codes for an autofluorescent protein. The present invention also relates to a cell, a method for isolating genes which code for NADP(H)-dependent enzymes, and the use of an NADP(H) nanosensor.

Claims

1. A cell comprising an NADPH(H) nanosensor, wherein the NADP(H) nanosensor comprises: i) a nucleic acid to which a regulator is capable of binding, wherein the oxidation state of the regulator depends on the cell's intra-cellular NADP(H) availability; ii) a promoter following the nucleic acid i), to which an RNA polymerase is capable of binding, wherein the affinity of the RNA polymerase for the promoter is influenced by the oxidation state of the regulator; iii) a nucleic acid which is under the control of the promoter ii) and which codes for an autofluorescent protein, wherein the autofluorescent protein is selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), enhanced green fluorescent protein (EGFP), enhanced yellow fluorescent protein (EYFP), enhanced blue fluorescent protein (EBFP), enhanced cyan fluorescent protein (ECFP), DsRed, HcRed, AsRed, Am Cyan, ZsGreen, AcGFP and Zs Yellow, or a photoreceptor protein which contains a LOY domain, wherein components i) and ii) together have a nucleic acid sequence according to SEQ. ID. No. 01, wherein the NADP(H) nanosensor is present in the cell in the episomal form, wherein the cell, in addition to the NADP(H)-nanosensor, comprises a gene which codes for an NADP(H)-dependent enzyme that has been introduced into the cell, and wherein the cell is Escherichia coli (E. coli).

2. The cell according to claim 1, wherein the NADP(H) nanosensor comprises: (1) the E. coli gene for SoxR (soxR); (2) components i) and ii) downstream of (1); (3) at least the first 5 nucleotides of the soxS gene from E. coli following (2); (4) a nucleic acid which codes for an autofluorescent protein, following (2) or (3) and which is under the control of the soxS promoter, as component iii).

3. The cell according to claim 1, wherein the NADP(H) nanosensor comprises: (1) the E. coli gene for SoxR (soxR); (2) components i) and ii) downstream of (1); (3) the soxS gene from E. coli following (2) and under the control of the soxS promoter or a part of this gene; (3) a further nucleic acid following (3) which at the mRNA level corresponds to a ribosome binding site; (4) a nucleic acid, which codes for an autofluorescent protein, following (3) and which is under the control of the soxS promoter, as component iii).

4. The cell according to claim 2 or 3, wherein component (1) or (1) is selected from the group consisting of: a) a nucleic acid sequence according to SEQ. ID. No. 02, and b) a nucleic acid sequence coding for a polypeptide with an amino acid sequence according to SEQ. ID. No. 03.

5. The cell according to claim 1, wherein the nucleic acid (iii) which codes for an auto fluorescent protein is the gene coding for enhanced yellow fluorescent protein (EYFP).

6. The cell according to claim 1, wherein the NADP(H) dependent enzyme is selected from the group consisting of alcohol dehydrogenases, aldehyde dehydrogenases, lactate dehydrogenases, enoate reductases, epoxide reductases, diaminopimelate dehydrogenases, amino acid dehydrogenases, aldehyde oxidoreductases, alkane reductases, amine reductases, epoxide dehydrogenases, carboxylic acid dehydrogenases, hydroxy acid ketoreductases and hydroxy acid dehalogenases.

Description

(1) The invention is now explained in more detail with the aid of figures and non-limiting examples.

(2) FIG. 1 shows the mode of functioning of the NADP(H) nanosensor according to the invention by the example of the particularly preferred embodiment described above.

(3) FIG. 2 shows the specific fluorescence of the E. coli BL21(DE3) cells, prepared in Example 3, with the NADP(H) nanosensor according to the invention (pSensox) and expressed alcohol dehydrogenase (Lbadh) (solid squares). The fluorescence of the nanosensor pSennegK with inactive alcohol dehydrogenase is shown as a control (open squares).

(4) FIG. 3 shows a diagram of the formation of the autofluorescent protein as transcriptional (top) and translational (bottom) fusion.

(5) According to FIG. 1, the NADP(H) nanosensor can comprise the E. coli gene for SoxR (soxR), the intergenic region from E. coli following this, which is located between soxR and soxS and which comprises the soxR binding sequence and the soxS promoter sequence following the SoxR binding sequence, a part sequence of the soxS gene from E. coli (soxS) following this and a nucleic acid sequence following this, under the control of the soxS promoter sequence, which codes for a autofluorescent protein (AFP). At a high cytosol NADP(H) concentration (top left in FIG. 1), the [2Fe-2S] clusters (rhomb) are present in a form reduced by SoxR bound to the promoter. At a low NADP(H) availability (top right in FIG. 1), the [2Fe-2S] clusters are oxidised, and the resulting distortion of the soxS promoter region renders transcription initiation of the target gene possible for the RNA polymerase. According to the invention the native target gene soxS is fused with an autofluorescent protein (AFP). NADP(H)-dependent enzymes cause increased expression of soxS-AFP by consumption of NADP(H) and therefore increased fluorescence of cells as a result of increased NADP(H) consumption.

(6) FIG. 3 shows at the top the transcriptional and at the bottom the translational fusion. In both cases a transcript is formed by the promoter PI, which is, for example, the soxS promoter controlled by SoxR. Whereas during transcriptional fusion two separate peptides are formed due to a second ribosome binding site (RBS), during translational fusion a single peptide is formed, the fusion protein, in which the autofluorescent protein contains additional amino acid sequences.

EXAMPLES

Example 1

(7) Construction of the NADPH Nanosensor (Transcriptional Fusion)

(8) With the primer pairs SoxS_for_SphI (SEQ. ID. No. 04) and SoxR_rev_SalI (SEQ. ID. No. 05) and chromosomal DNA from E. coli DIS5 as the template, the gene soxR as amplified together with the intergenic region of soxR-soxS and the first 63 nucleotides of soxS.

(9) TABLE-US-00001 SoxS_for_SphI: ATCTGCATGCTTACGGCTGGCAATATGCTCGTC SoxRrevSalI: GCTAGTCGACCAAACTAAACCGCCCTTGTG

(10) With the primer pairs EYFP_for_SphI (SEQ. ID. No. 06) and EYFP_rev_ClaI (SEQ. ID. No. 07) and the vector pSenLys as the template, the gene eyfp was amplified together with a ribosome binding site. The vector pSenLys is described in the patent application WO-A-2011/138006.

(11) TABLE-US-00002 EYFP_for_SphI: AGAGGCATGCAAGGAGAATTACATGGTGAGCAAGGGCGAGG EYFP_rev_ClaI: GCGCATCGATTTATTACTTGTACAGCTCGTCCATG

(12) The vector pBtacLbadh codes for the NADPH-dependent alcohol dehydrogenase from Lactobacillus brevis (Lbadh). It is described in Ernst et al. (Ernst M, Kaup B, Mller M, Bringer-Meyer S, Sahm H, Appl. Microbiol. Biotechnol. 2005, 66(6), pages 629-34). The vector pBtacLbadh was treated with the restriction enzymes SalI and ClaI, and the vector fragment5.0 kb in size was isolated from the agarose gel and treated with alkaline phosphatase and purified with the QIAquick Gel Extraction Kit (cat. no. 28704) from Quiagen (Hilden, Germany). The two PCR products and the vector were then ligated by means of T4 DNA ligase from New England Biolabs (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723). The ligation batch was transformed directly into the E. coli strain DH5. Selection of plasmid-carrying cells was carried out by plating out the transformation batch on LB agar (Sambrook et al.: Molecular cloning: a laboratory manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 50 mg/l of ampicillin. Plasmid DNA was isolated from a transformant and checked by treatment with the restriction enzyme BamHI with subsequent agarose gel electrophoresis. The plasmid was called pSenSox and is deposited as the sequence SEQ. ID. No. 08.

(13) pSennegK was created as a derivative with modified alcohol dehydrogenase. Lbadh. For this, with the primers ADH_negK_for (SEQ. ID. No. 09) and ADH_negK_rev (SEQ. ID. No. 10) and again pBtacLbadh as the template, an inactive Lbadh was amplified with an alcohol dehydrogenase deleted by 221 bp. The resulting fragment was ligated with the 5.7 kb size vector fragment containing the gene eyfp together with a ribosome binding site. The sequence of the resulting vector is deposited as SEQ. ID. No. 11.

(14) TABLE-US-00003 ADH_negK_for: ACAAGAATTCGCTAAGAGTGTCGGCACTCC ADH_negK_rev: GGCCAAGCTTCCGAAGAAGACACCATCAAG

(15) pSen-L194S was created as a further derivative with modified alcohol dehydrogenase. Lbadh. For this, with the primers L194S_for (SEQ. ID. No. 12) and L194S_rev (SEQ. ID. No. 13), pSenSox was amplified as a template for targeted insertion of the mutation. The plasmid generated was verified by means of sequencing. The sequence of the resulting vector is deposited as SEQ. ID. No. 14.

(16) TABLE-US-00004 L194S_for: CTGGCTACATCAAGCACCATCTGTTGATG L194S_rev: CGGCCCCTGGTAGGTCATCAACAGATGGTG

(17) pSen-L194A was created as a further derivative with modified alcohol dehydrogenase, Lbadh. For this, with the primers L194A_for (SEQ. ID. No. 15) and L194A_rev (SEQ. ID. No. 16), pSenSox was amplified as a template for targeted insertion of the mutation. The plasmid generated was verified by means of sequencing. The sequence of the resulting vector is deposited as SEQ. ID. No. 17.

(18) TABLE-US-00005 L194A_for: CTGGCTACATCAAGACACCAGCGGTTGATG L194A_rev: CGGCCCCTGGTAGGTCATCAACCGCTGGTG

Example 2

(19) Use of the NADP(H) Nanosensor for Monitoring Alcohol Dehydrogenase-Dependent Product Formation

(20) E. coli BL21(DE3) (Life Technologies GmbH, Frankfurter Strae 129B, 64293 Darmstadt) was transformed with the plasmid pSenSox. 5 ml of 2YT medium (16 g/l of tryptone, 10 g/l of yeast extract. 5 g/l of NaCl) was inoculated with an individual colony and the culture was incubated overnight at 37 C. and 130 rpm. Using this preculture the main culture was inoculated to an OD of 0.05 in 50 ml of 2TY and was incubated at 37 C. and 130 rpm. At the OD of 0.31 mM IPTG was added and the culture was incubated for a further 3 hours to an OD of 5-6.

(21) 0.9 ml portions of the cell suspension were then introduced into a reaction vessel of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany). Methyl acetoacetate (MAA) was added to the cell suspension in increasing concentration in a constant volume of 0.1 ml. The Flowerplate microtiter plate was then incubated at 30 C. 1,200 rpm, shaking radius 3 mm. In the BioLector cultivation system the growth was recorded online as scattered light at 620 nm, and the fluorescence of the culture was recorded continuously at an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The specific fluorescence after 10 hours was plotted against the amount of MAA added and is shown in FIG. 2 (0-70 mM methyl acetoacetate was added to individual batches and after 10 hours the specific fluorescence was determined, this being shown as squares filled with black; E. coli BL21(DE3) pSennegK with inactive Lbadh served as a negative control (empty squares). FIG. 2 shows an increase in the fluorescence with increasing MAA concentration. This increase is due to pSenSox, since a control reaction with the plasmid pSennegK with inactive alcohol dehydrogenase, which, however, is otherwise identical to pSenSox, causes no increase in fluorescence.

Example 3

(22) Use of the NADP(H) Nanosensor for Determining Different Alcohol Dehydrogenase Activities

(23) The strain E. coli BL21(DE3) (Life Technologies GmbH, Frankfurter Strale 129B, 64293 Darmstadt) was transformed in each case with pSennegK, pSen-L194S and pSen-L194A. In addition, the strain E. coli BL21(DE3) pSenSox described in Example 2 was transformed with pET28a as the second plasmid. The vector mentioned last was obtained from Novagen (Life Technologies GmbH. Frankfurter Strae 129B, 64293 Darmstadt), 5 ml of 2YT medium (16 g/l of tryptone, 10 g/l of yeast extract, 5 g/l of NaCl) was inoculated with an individual colony of the particular strain and the culture was incubated overnight at 37 C. and 130 rpm. Using this preculture the main culture was inoculated to an OD of 0.05 in 50 ml of 2TY and was incubated at 37 C. and 130 rpm. At the OD of 0.3 no IPTG was added or 1 mM IPTG was added to the strain E. coli BL21(DE3) pSenSox and the culture was incubated for a further 3 hours to an OD of 5-6.

(24) As described in Example 2, 0.9 mil portions of the cells were then each introduced into a reaction vessel of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany). Methyl acetoacetate (MAA) was in each case added, in 0.1 ml, to the cell suspension to a final concentration of 40 mM. The Flowerplate microtiter plate was then incubated at 30 C., 1,200 rpm, shaking radius 3 mm, and the specific fluorescence was determined. The specific fluorescence obtained after 19 hours is shown in Table 1.

(25) In addition, the alcohol dehydrogenase activity of the recombinant E. coli cells was determined in the individual batches. For this, the cells were harvested at 10.000g, 4 C., 5 min and taken up in 100 mM potassium phosphate buffer, pH 6.5, 1 mM dithiothreitol, 1 mM MgCl.sub.2. The cells were broken down by means of the Silamat S5 (Ivoclar Vivadent GmbH, Germany) with the aid of glass beads of 0.1 mm diameter. The crude extract which was obtained after centrifugation at 16.000g, 4 C., 20 min was employed in the enzyme test for quantification of the alcohol dehydrogenase activity. The test contained 5 mM methyl acetoacetate, 0.25 mM NADPH and 1 mM MgCl.sub.2 in 100 mM potassium phosphate buffer, pH 6.5, and 0.01-0.1 ml of crude extract. The reduction of NADP(H) was monitored at 340 nm and 30 C. An enzyme unit (U) is stated as that amount of crude extract which reduces 0.001 mmol of NADP(H) per minute. It is likewise given in Table 1.

Example 4

(26) Isolation of Mutated Alcohol Dehydrogenase with Modified Substrate Recognition

(27) The alcohol dehydrogenase Lbadh from Lactococcus lactis has a high activity with methyl acetoacetate, but only a low activity of about 10% with 4-methyl-2-pentanone as the substrate. In order to evolve an Lbadh with a higher activity, random mutations were inserted into pSenSox by error-prone PCR (epPCR). To insert the mutations, 10 ng of pSenSox were employed as the template per reaction, as well as 0.1-0.8 mM Mn.sup.2+, at the lower concentrations of below <0.2 mM Mn.sup.2+ a total concentration of at least 0.2 mM being established with Mg.sup.2+, 0.5 l of Taq polymerase from Fermentas (catalogue no. EP0401) was added per reaction. The polynucleotides

(28) TABLE-US-00006 SEQ.ID.No.18: ACAAGAATTCGCTAAGAGTGTCGGCACTCC SEQ.ID.No.19: GGCCAAGCTTCCGAAGAAGACACCATCAAG
were used as primers. The reactions were incubated for 30 minutes. The reaction products were then treated with BamHI and SalI and ligated with the vector pSenSox likewise treated beforehand.

(29) E. coli DH5mer was transformed with the ligation products (Grant, 1990, Proceedings of the National Academy of Sciences, USA, 87, pages 4645-4649). After incubation for 30 h. transformants were washed off from the plates with 10 ml of 2YT and diluted tenfold in fresh 2YT medium. After incubation for 4 hours at 37 C., 20 mM 4-methyl-2-pentanone was added as the substrate, and after a further incubation for three hours the batches were sent for FACS analysis and sorting.

(30) For FACS analysis and sorting of the cells with high fluorescence, the cell suspension in 2YT medium was adjusted to an optical density of less than 0.1 and passed immediately to the FACS ARIA II high-speed cell sorter (Becton Dickinson GmbH, Tullastr. 8-12, 69126 Heidelberg). The analysis was carried out with the excitation wavelengths of 488 and 633 nm and the detection at the emission wavelengths of 53015 nm and 66010 nm under a sample pressure of 70 psi. The data were analysed with the software version BD DIVA 6.1.3 belonging to the apparatus. BD FACSflow was used as the sheath fluid. The electronic gating was set with the aid of the forward and backward scatter in order to exclude non-bacterial particles. In order to sort EYFP-positive cells, the next level of the electronic gating was selected, in order to exclude non-fluorescent cells. In this manner, 123 fluorescent cells were sorted out on Petri dishes which contained 2YT medium.

(31) Reaction vessels of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany) were inoculated, as described in Example 2, with the colonies obtained after incubation for 30 hours at 37 C. However, 20 mM 4-methyl-2-pentanone and not methyl acetoacetate was used as the substrate. After 120 minutes the specific fluorescence was quantified, and a clone was selected, the alcohol dehydrogenase activity of which was determined in the enzyme test as described in Example 3, 20 mM 4-methyl-2-pentanone was used as the substrate here.

(32) The mutant with the plasmid pSen-A93M obtained in this way has a specific activity increased by 26% compared with the starting strain (Table 2), and a conversion rate with 4-methyl-2-pentanone as the substrate increased by 37%. The sequence of the plasmid pSen-A93M is deposited as SEQ. ID. No. 20.

(33) TABLE-US-00007 TABLE 1 Correlation of the alcohol dehydrogenase activity of whole cells with the specific fluorescence. Alcohol dehydrogenase Specific Strain IPTG activity (U mg.sup.1) fluorescence BL21(DE3) pSennegK 0.03 0.01 0.06 BL21(DE3) pSenSox, 0.5 0.1 0.09 pET28a BL21(DE3) pSenL194S 0.7 0.3 0.11 BL21(DE3) pSenL194A 2.7 0.6 0.17 BL21(DE3) pSenSox 6.2 0.6 0.38 BL21(DE3) pSenSox + 15.2 2.0 0.45

(34) TABLE-US-00008 TABLE 2 Increase in the activity and conversion rate of the alcohol dehydrogenase isolated by means of the NADP(H) nanosensor and FACS with 4-methyl-2-pentanone as the substrate. Alcohol dehydrogenase v.sub.max K.sub.M Strain activity (U mg.sup.1) (U mg.sup.1) (mM) DH5 pSensox 1.9 0.2 1.9 0.02 0.10 0.01 DH5 pSenA93M 2.4 0.1 2.6 0.03 0.88 0.03

Example 5

(35) Construction of the NADPH Nanosensor (Translational Fusion)

(36) With the primer pairs SoxS_for_SphI_tl (SEQ. ID. No. 21) and SoxR_rev_SalI_tl (SEQ. ID. No. 22) and chromosomal DNA from E. coli DH5 as the template, the gene soxR was amplified together with the intergenic region of soxR-soxS and the first 63 nucleotides of soxS.

(37) TABLE-US-00009 SoxS_for_SphI_tl: ATCTGCATGCCGGCTGGTCAATATGCTCGTC SoxR_rev_SalI_tl: GCTAGTCGACCAAACTAAAGCGCCCTTGTG

(38) With the primer pairs EYFP_for_SphI_tl (SEQ. ID. No. 23) and EYFP_rev_ClaI_tl (SEQ. ID. No. 24) and the vector pSenLys as the template, the gene eyfp was amplified. The vector pSenLys is described in the patent application WO-A-2011/138006.

(39) TABLE-US-00010 EYFP_for_SphI_tl: AGAGGCATGCGTGAGCAAGGGCGAGG EYFP_rev_ClaI_tl: GCGCATCGATTTATTACTTGTACAGCTCGTCATG

(40) The vector pBtacLbadh codes for the NADPH-dependent alcohol dehydrogenase from Lactobacillus brevis (Lbadh). It is described in Ernst et al. (Ernst M, Kaup B. Mller M. Bringer-Meyer S, Sahm H, Appl. Microbiol. Biotechnol. 2005, 66(6), pages 629-34). The vector pBtacLbadh was treated with the restriction enzymes SalI and ClaI, and the vector fragment5.0 kb in size was isolated from the agarose gel and treated with alkaline phosphatase and purified with the QIAquick Gel Extraction Kit (cat. no. 28704) from Quiagen (Hilden, Germany). The two PCR products and the vector were then ligated by means of T4 DNA ligase from New England BioLabs (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723). The ligation batch was transformed directly into the E. coli strain DH5. Selection of plasmid-carrying cells was carried out by plating out the transformation batch on LB agar (Sambrook et al.: Molecular cloning: a laboratory manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 50 mg/l of ampicillin. Plasmid DNA was isolated from a transformant and checked by treatment with the restriction enzyme BamHI with subsequent agarose gel electrophoresis. The plasmid was called pSenSox_tl and is deposited as the sequence SEQ. ID. No. 25.