Immunity generation
10383899 ยท 2019-08-20
Assignee
Inventors
Cpc classification
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
An improved method for the manufacture of a medicament, which method includes the use of tissues, larval forms or derivatives of insects that have been fed on food containing pathogens.
Claims
1. A method for the manufacture of a medicament, comprising the steps of: exposing larval forms of insects to food containing pathogens for an extended period of time, wherein the larval forms of said insects are at least four days old, and wherein the extended period of time is at least twelve hours; maximizing an expression of anti-microbial peptides by selectively altering the number or nature of the pathogens: wherein the larval forms of insects are exposed to Pseudomonas syringae; and wherein the larval forms of insects are Lucilia serricata.
2. The method for the manufacture of a medicament according to claim 1, wherein the extended period of time is twenty-four hours.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
DESCRIPTION OF THE PREFERRED EMBODIMENTS
(5) Day-old Ross broiler chicks were housed in biosecure facilities and fed commercial chick crumb supplements with 10% of either soya meal, crushed unstimulated Lucilia larvae or crushed unstimulated Lucilia larvae.
(6) Insect larvae reared in a milk powder/sucrose/wheat germ/agar mixture for four days were removed from this medium and washed. They were then introduced into fresh growth medium without added bacteria (unstimulated) or containing approximately 510.sup.7 Pseudomonas syringae per gram (stimulated). After 24 hours on this medium, the larvae were removed, washed to remove all traces of growth medium and freeze-dried. Once dry, they were crushed using a pestle and mortar to obtain a coarse powder for addition to the chick crumb.
(7) At three days old, birds were infected orally with 10.sup.5 cfu Campylobacter jejuni strain M1.
(8) At eight days old, birds were euthanased and the caeca removed and examined for Campylobacter, lactic acid bacteria and enterobacteria by serial dilution and spread plating on mCCDA, MRS, and VRBG agars respectively. Differences in the level of bacteria found in the birds were analysed using a Kruskal-Wallis test with Dunn's post test with P<0.05 being regarded as significant.
(9) The use of feed containing stimulated larvae resulted in a reduction of campylobacter in the caecum (
(10) In terms of colonization, 13% of soya fed birds were negative for campylobacter in the caecum after eight days, 18% of birds fed unstimulated larvae and 41% of birds fed stimulated larvae. The feed containing stimulated larvae resulted in a significant reduction (P<0.05) in the number of birds colonized with campylobacter in the caecum as compared to the soya-supplemented control.
(11) Larvae of Lucilia serricata, Calliphora vacciniae and Musca domestica were assessed for their expression of antimicrobial peptides (AMPs) following stimulation with three different species of bacteria. As bacterial simulation was found to increase AMP expression, experiments have been carried out to investigate the optimal parameters for stimulation of the larvae.
(12) The optimal bacterial/larval combination has been found to be Lucilia serricata stimulated by Pseudomonas syringe, a bacterium which is not pathogenic to animals or humans. Exposure of four-day old larvae to this bacterium for twelve hours has been found to increase AMP expression by up to thirty-fold over unstimulated larvae.
(13) Larvae can be stimulated with live or dead bacteria and this does not affect larval feed consumption or final weight. There is also evidence of an interaction between pathogenicity of the bacterium, time and dose in affecting AMP expression.
(14) In vitro experiments have been carried out using powder prepared from Lucilia serricata larvae stimulated by Pseudomonas syringae testing its effectiveness as an antibacterial agent against Campylobacter jejuni, with powder from unstimulated larvae used as a control.
(15) Over a three-hour time period, Campylobacter bacteria incubated with powder from unstimulated larvae were able to grow whereas the bacterial cultures exposed to 1% w/v powder from larvae stimulated with Pseudomonas syringae showed significant bacterial death (P=0.0015).
(16) Lucilia serricata larvae challenged with Pseudomonas syringae were fed to broiler chicks. The chicks were then infected orally to test their immunity.
(17) Adult Lucilia serricata were allowed to lay eggs in a 1:1:1 mixture of wheat germ, yeast and milk powder that had been solidified with agar. This mixture containing eggs was split into portions and at hatch larvae were either challenged with Pseudomonas syringae or left unchallenged. After 4 days larvae were harvested, washed to remove feed and freeze dried to a moisture content of 15%. Larvae were then ground to a fine powder in a chilled pestle and mortar.
(18) Groups of 18 day-old Ross broiler chicks were housed in biosecure facilities and fed commercial chick crumb supplemented with 10% w/w of either soya meal (to balance protein levels with feed containing larvae), 10% w/w crushed unstimulated Lucilia larvae or 10% w/w crushed stimulated Lucilia larvae.
(19) At 3 days old birds were infected orally with 10.sup.5 cfu Campylobacter jejuni strain M1.
(20) At 8 days old birds were euthanased and the caecal tonsil immediately placed into RNAlater. mRNA was extracted using a Qiagen kit and examined for Gallicin 11 expression by quantitative RT-PCR using the primers D11F cagaattgcagaaagccaca and D11R ttctacgtgtgcgtgtgtga with chicken beta actin as a housekeeping gene. Expression of Gallicin 11 was expressed relative to beta actin expression.
(21) Differences between groups of birds were examined for significance using a Kruskal-Wallis test with Dunn's post hoc test as data were not normally distributed.
(22) The results of the test are shown in
(23) Gallicin 11 was chosen as this has been shown to be expressed in the intestine by others (Hong at et al. Poult. Sci. (2012) 1082).
(24) Diet had a significant effect on Gallicin 11 expression (P=0.0007). In birds fed a diet containing stimulated larvae relative levels of Gallicin 11 expression in the caecum were significantly higher than in birds fed a diet containing unstimulated larvae. This shows that feeding of stimulated larvae, which contain higher amounts of insect AMPs, stimulates host AMP expression. This would give an added stimulation of antibacterial activity in the intestine over and above the provision of fly AMPs in the feed itself.