Chromen-4-one derivatives for the treatment and prophylaxis of hepatitis B virus disease

11993591 ยท 2024-05-28

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides novel compounds having the general formula (I) wherein R.sup.1 to R.sup.6, and m are as described herein, compositions including the compounds and methods of using the compounds. ##STR00001##

Claims

1. A compound selected from the group consisting of: 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylic acid; 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylic acid; 6-chloro-N-(4-chloro-2-methylphenyl)-3-methyl-4-oxo-chromene-2-carboxamide; 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylic acid; 8-chloro-4-oxo-N-(5-(trifluoromethyl)-1,3,4-thiadiazol-2-yl)-chromene-2-carboxamide; 3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylic acid; 8-chloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide; 8-chloro-N-(2,4-dichlorobenzyl)-4-oxo-chromene-2-carboxamide; N-(5-bromo-3-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide; 4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoic acid; 8-chloro-N-(4-chloro-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide; 6,8-dichloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide; 8-chloro-4-oxo-N-(o-tolyl)-chromene-2-carboxamide; 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoic acid; 2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetic acid; 2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetic acid; methyl 3-(8-chloro-4-oxo-chromene-2-carboxamido)-4-methylbenzoate; 2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic acid; N-(5-bromo-4-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide; 2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic acid; methyl 5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)benzoate; methyl 4-((8-chloro-4-oxo-chromene-2-carboxamido)methyl)benzoate; methyl 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoate; N-(1-(4-bromophenyl)ethyl)-8-chloro-4-oxo-chromene-2-carboxamide; 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide; N-(5-bromo-3-methoxypyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide; 3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylic acid; and ethyl 5-(8-chloro-4-oxo-chromene-2-carboxamido)-1,3,4-thiadiazole-2-carboxylate; or a pharmaceutically acceptable salt thereof.

2. A pharmaceutical composition comprising a compound in accordance with claim 1 and a therapeutically inert carrier.

Description

DETAILED DESCRIPTION OF THE INVENTION

Definitions

(1) As used herein, the term C.sub.1-6alkyl alone or in combination signifies a saturated, linear- or branched chain alkyl group containing 1 to 6, particularly 1 to 4 carbon atoms, for example methyl, ethyl, propyl, isopropyl, 1-butyl, 2-butyl, tert-butyl and the like. Particular C.sub.1-6alkyl groups are methyl, ethyl, isopropyl and tert-butyl. More particularly, C.sub.1-6alkyl group is methyl.

(2) The term C.sub.1-6alkoxy alone or in combination signifies a group C.sub.1-6alkyl-O, wherein the C.sub.1-6alkyl is as defined above; for example methoxy, ethoxy, propoxy, iso-propoxy, n-butoxy, iso-butoxy, 2-butoxy, tert-butoxy, pentoxy, hexyloxy and the like. Particular C.sub.1-6alkoxy groups are methoxy, ethoxy and propoxy. More particularly, C.sub.1-6alkoxy group is methoxy or ethoxy.

(3) The term C.sub.3-7cycloalkyl denotes to a saturated carbon ring containing from 3 to 7 carbon atoms, particularly from 3 to 6 carbon atoms, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and the like. Particular C.sub.3-7cycloalkyl group is cyclopropyl, cyclobutyl or cyclopentyl.

(4) The term C.sub.3-7cycloalkoxy denotes a group C.sub.3-7cycloalkyl-O, wherein the C.sub.3-7 cycloalkyl is as defined above; for example cyclopropoxy, cyclobutoxy, cyclopentoxy.

(5) Particular C.sub.3-7cycloalkoxy group is cyclobutoxy.

(6) The term halogen and halo are used interchangeably herein and denote fluoro, chloro, bromo, or iodo.

(7) The term haloC.sub.1-6alkyl denotes an alkyl group wherein at least one of the hydrogen atoms of the alkyl group is replaced by same or different halogen atoms, particularly fluoro atoms. Examples of haloC.sub.1-6alkyl include monochloro-, difluoro- or trifluoro-methyl, -ethyl or -propyl, for example difluoromethyl and trifluoromethyl.

(8) The term carbonyl alone or in combination refers to the group C(O).

(9) The term bond refers to a chemical bond between two atoms, or two moieties when the atoms joined by the bond are considered to be part of larger substructure. In one aspect, when a group described herein is a bond, the referenced group is absent thereby allowing a bond to be formed between the remaining identified groups.

(10) The term oxo means an ?O group and may be attached to a carbon atom or a sulfur atom.

(11) The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term pharmaceutically acceptable salt refers to conventional acid-addition salts or base-addition salts that retain the biological effectiveness and properties of the compounds of formula (I) and are formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases. Acid-addition salts include for example those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid and nitric acid, and those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, fumaric acid, and the like. Base-addition salts include those derived from ammonium, potassium, sodium and, quaternary ammonium hydroxides, such as for example, tetramethyl ammonium hydroxide. The chemical modification of a pharmaceutical compound into a salt is a technique well known to pharmaceutical chemists in order to obtain improved physical and chemical stability, hygroscopicity, flowability and solubility of compounds. It is for example described in Bastin R. J., et al., Organic Process Research & Development 2000, 4, 427-435. Particular are the sodium salts of the compounds of formula (I).

(12) Compounds of the general formula (I) which contain one or several chiral centers can either be present as racemates, diastereomeric mixtures, or optically active single isomers. The racemates can be separated according to known methods into the enantiomers. Particularly, diastereomeric salts which can be separated by crystallization are formed from the racemic mixtures by reaction with an optically active acid such as e.g. D- or L-tartaric acid, mandelic acid, malic acid, lactic acid or camphorsulfonic acid.

(13) cccDNA Inhibitors

(14) The present invention provides (i) a compound having the general formula (I):

(15) ##STR00005##
Wherein R.sup.1 is H, halogen or C.sub.1-6alkyl; R.sup.2 is H, halogen or C.sub.1-6alkyl; R.sup.3 is H, halogen or C.sub.1-6alkyl; R.sup.4 is H, halogen or C.sub.1-6alkyl; R.sup.5 is H, halogen or C.sub.1-6alkyl; m is 0 or 1; R.sup.6 is -L-Cy.sup.1, or Cy.sup.2; wherein L is N(R.sup.7)X,

(16) ##STR00006## wherein R.sup.7 is H or C.sub.1-6alkyl; X is a bond or C(R.sup.x1R.sup.y1); wherein R.sup.x1 is H or C.sub.1-6alkyl, R.sup.y1 is H or C.sub.1-6alkyl; Cy.sup.1 is phenyl, thiadiazolyl, pyridyl, phenylC.sub.1-6alkyl, phenylC.sub.1-6alkoxy or phenylcarbonyl; wherein phenyl, thiadiazolyl, pyridyl, phenylC.sub.1-6alkyl, phenylC.sub.1-6alkoxy and phenylcarbonyl are unsubstituted or substituted by one or two or three substituents independently selected from halogen, hydroxy, carboxy, NO.sub.2, C.sub.1-6alkyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, carboxyC.sub.3-7cycloalkoxy, carboxyC.sub.1-6alkoxy, (carboxyC.sub.1-6alkoxy)C.sub.1-6alkoxy, C.sub.1-6alkoxycarbonyl, (carboxyC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy and (C.sub.1-6alkoxycarbonylC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy; Cy.sup.2 is isoindolinyl, 3,4-dihydro-1H-isoquinolinyl, 3,4-dihydro-2H-quinolinyl, piperidyl, 2,6-diazaspiro[3.3]heptanyl, 2-azaspiro[3.3]heptanyl or 8-azabicyclo[3.2.1]octanyl; wherein isoindolinyl, 3,4-dihydro-1H-isoquinolinyl, 3,4-dihydro-2H-quinolinyl, piperidyl, 2,6-diazaspiro[3.3]heptanyl, 2-azaspiro[3.3]heptanyl and 8-azabicyclo[3.2.1]octanyl are unsubstituted or substituted by one or two or three substituents independently selected from OH, halogen, C.sub.1-6alkyl, C.sub.1-6alkoxy, NO.sub.2, (carboxyC.sub.1-6alkoxy)C.sub.1-6alkoxy, (carboxyC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy, C.sub.1-6alkoxycarbonyl, (C.sub.1-6alkoxycarbonylC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy and oxo;
or a pharmaceutically acceptable salt thereof.

(17) A further embodiment of the present invention is (ii) a compound of formula (I) according to (i), wherein R.sup.1 is H, F, Cl, Br, I or methyl; R.sup.2 is H, F, Cl, Br, I or methyl; R.sup.3 is H, F, Cl, Br, I or methyl; R.sup.4 is H, F, Cl, Br, I or methyl; R.sup.5 is H, F, Cl, Br, I or methyl; m is 0 or 1; R.sup.6 is -L-Cy.sup.1, or Cy.sup.2; L is N(R.sup.7)X,

(18) ##STR00007## wherein R.sup.7 is H or methyl; X is a bond or C(R.sup.x1R.sup.y1); wherein R.sup.x1 is H or methyl, R.sup.y1 is H or methyl; Cy.sup.1 is phenyl, 1,3,4-thiadiazol-2-yl, 2-pyridyl, phenylmethyl, phenylmethoxy or phenylcarbonyl; wherein phenyl, 1,3,4-thiadiazol-2-yl, 2-pyridyl, phenylmethyl, phenylmethoxy and phenylcarbonyl are unsubstituted or substituted by one or two or three substituents independently selected from F, Cl, Br, CF.sub.3, hydroxy, NO.sub.2, carboxy, methyl, methoxy, carboxycyclobutoxy, carboxypropoxy, carboxymethoxy, (carboxymethoxy)ethoxy, methoxycarbonyl, (carboxycyclobutoxy)ethoxy, ethoxycarbonyl and (methoxycarbonylcyclobutoxy)ethoxy; Cy.sup.2 is isoindolin-2-yl, 3,4-dihydro-1H-isoquinolin-2-yl, 3,4-dihydro-2H-quinolin-1-yl, 1-piperidyl, 2,6-diazaspiro[3.3]heptan-2-yl, 2-azaspiro[3.3]heptan-2-yl or 8-azabicyclo[3.2.1]octan-8-yl; wherein isoindolin-2-yl, 3,4-dihydro-1H-isoquinolin-2-yl, 3,4-dihydro-2H-quinolin-1-yl, 1-piperidyl, 2,6-diazaspiro[3.3]heptan-2-yl, 2-azaspiro[3.3]heptan-2-yl and 8-azabicyclo[3.2.1]octan-8-yl are unsubstituted or substituted by one or two or three substituents independently selected from F, Cl, Br, OH, methyl, methoxy, NO.sub.2, (carboxymethoxy)ethoxy, tert-butoxycarbonyl, (carboxycyclobutoxy)ethoxy, (methoxycarbonylcyclobutoxy)ethoxy and oxo;
or a pharmaceutically acceptable salt thereof.

(19) A further embodiment of the present invention is (iii) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is H or halogen; R.sup.2 is H; R.sup.3 is H or halogen; R.sup.4 is H; R.sup.5 is H or C.sub.1-6alkyl; m is 1; R.sup.6 is -L-Cy.sup.1; wherein L is NHX, wherein X is a bond or C(R.sup.x1R.sup.y1); wherein R.sup.x1 is H or C.sub.1-6alkyl, R.sup.y1 is H; Cy.sup.1 is phenyl, thiadiazolyl or pyridyl; wherein phenyl, thiadiazolyl and pyridyl are substituted by one or two substituents independently selected from halogen, hydroxy, carboxy, C.sub.1-6alkyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, carboxyC.sub.3-7cycloalkoxy, carboxyC.sub.1-6alkoxy, (carboxyC.sub.1-6alkoxy)C.sub.1-6alkoxy, C.sub.1-6alkoxycarbonyl and (carboxyC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy.

(20) A further embodiment of the present invention is (iv) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is H or Cl; R.sup.2 is H; R.sup.3 is H or Cl; R.sup.4 is H; R.sup.5 is H or methyl; m is 1; L is NHX, wherein X is a bond or C(R.sup.x1R.sup.y1); wherein R.sup.x1 is H or methyl, R.sup.y1 is H; Cy.sup.1 is phenyl, 1,3,4-thiadiazol-2-yl or 2-pyridyl; wherein phenyl, 1,3,4-thiadiazol-2-yl and 2-pyridyl are substituted by one or two substituents independently selected from F, Cl, Br, CF.sub.3, hydroxy, carboxy, methyl, methoxy, carboxycyclobutoxy, carboxypropoxy, carboxymethoxy, (carboxymethoxy)ethoxy, methoxycarbonyl, (carboxycyclobutoxy)ethoxy and ethoxycarbonyl.

(21) A further embodiment of the present invention is (v) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein Cy.sup.1 is phenyl; wherein phenyl is substituted by one or two substituents independently selected from halogen and C.sub.1-6alkyl.

(22) A further embodiment of the present invention is (vi) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein phenyl is substituted by one or two substituents independently selected from Cl and methyl.

(23) In another embodiment (vii) of the present invention, particular compounds of the present invention are selected from: 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylic acid; 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylic acid; 6-chloro-N-(4-chloro-2-methylphenyl)-3-methyl-4-oxo-chromene-2-carboxamide; 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylic acid; 8-chloro-4-oxo-N-(5-(trifluoromethyl)-1,3,4-thiadiazol-2-yl)-chromene-2-carboxamide; 3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylic acid; 8-chloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide; 8-chloro-N-(2,4-dichlorobenzyl)-4-oxo-chromene-2-carboxamide; N-(5-bromo-3-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide; 4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoic acid; 8-chloro-N-(4-chloro-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide; 6,8-dichloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide; 8-chloro-4-oxo-N-(o-tolyl)-chromene-2-carboxamide; 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoic acid; 2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetic acid; 2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetic acid; methyl 3-(8-chloro-4-oxo-chromene-2-carboxamido)-4-methylbenzoate; 2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic acid; N-(5-bromo-4-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide; 2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic acid; methyl 5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)benzoate; methyl 4-((8-chloro-4-oxo-chromene-2-carboxamido)methyl)benzoate; methyl 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoate; N-(1-(4-bromophenyl)ethyl)-8-chloro-4-oxo-chromene-2-carboxamide; 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide; N-(5-bromo-3-methoxypyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide; 3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylic acid; and ethyl 5-(8-chloro-4-oxo-chromene-2-carboxamido)-1,3,4-thiadiazole-2-carboxylate; or a pharmaceutically acceptable salt thereof.

(24) A further embodiment of the present invention is (viii) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is halogen; R.sup.2 is H; R.sup.3 is H; R.sup.4 is H; R.sup.5 is H; m is 1; R.sup.6 is Cy.sup.2; wherein Cy.sup.2 is isoindolinyl, 3,4-dihydro-1H-isoquinolinyl or 3,4-dihydro-2H-quinolinyl; wherein isoindolinyl, 3,4-dihydro-1H-isoquinolinyl and 3,4-dihydro-2H-quinolinyl are substituted by one substituent independently selected from halogen, C.sub.1-6alkoxy and NO.sub.2.

(25) A further embodiment of the present invention is (ix) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is Cl; R.sup.2 is H; R.sup.3 is H; R.sup.4 is H; R.sup.5 is H; m is 1; R.sup.6 is Cy.sup.2; wherein Cy.sup.2 is isoindolin-2-yl, 3,4-dihydro-1H-isoquinolin-2-yl or 3,4-dihydro-2H-quinolin-1-yl; wherein isoindolin-2-yl, 3,4-dihydro-1H-isoquinolin-2-yl and 3,4-dihydro-2H-quinolin-1-yl are substituted by one substituent independently selected from Cl, Br, methoxy and NO.sub.2.

(26) In another embodiment (x) of the present invention, particular compounds of the present invention are selected from: 2-(5-bromoisoindoline-2-carbonyl)-8-chloro-chromen-4-one; 8-chloro-2-(6-methoxy-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one; 8-Chloro-2-(7-chloro-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one; 2-(6-bromo-1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-8-chloro-chromen-4-one; 8-chloro-2-(8-chloro-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one; 2-(4-bromoisoindoline-2-carbonyl)-8-chloro-chromen-4-one; and 8-chloro-2-(7-nitro-3,4-dihydro-2H-quinoline-1-carbonyl)chromen-4-one;
or a pharmaceutically acceptable salt thereof.

(27) A further embodiment of the present invention is (xi) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is halogen; R.sup.2 is H; R.sup.3 is H or halogen; R.sup.4 is H; R.sup.5 is H or halogen; m is 0; R.sup.6 is -L-Cy.sup.1, or Cy.sup.2; wherein L is

(28) ##STR00008## Cy.sup.1 is phenyl, phenylC.sub.1-6alkyl, phenylC.sub.1-6alkoxy or phenylcarbonyl; wherein phenyl, phenylC.sub.1-6alkyl, phenylC.sub.1-6alkoxy and phenylcarbonyl are unsubstituted or substituted by one substituent independently selected from carboxy, C.sub.1-6alkoxycarbonyl and (carboxyC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy; Cy.sup.2 is isoindolinyl, 3,4-dihydro-1H-isoquinolinyl, piperidyl, 2,6-diazaspiro[3.3]heptanyl, 2-azaspiro[3.3]heptanyl or 8-azabicyclo[3.2.1]octanyl; wherein isoindolinyl, 3,4-dihydro-1H-isoquinolinyl, piperidyl, 2,6-diazaspiro[3.3]heptanyl, 2-azaspiro[3.3]heptanyl and 8-azabicyclo[3.2.1]octanyl are unsubstituted or substituted by one or two substituents independently selected from OH, C.sub.1-6alkyl, C.sub.1-6alkoxy, (carboxyC.sub.1-6alkoxy)C.sub.1-6alkoxy, (carboxyC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy, C.sub.1-6alkoxycarbonyl, (C.sub.1-6alkoxycarbonylC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy and oxo.

(29) A further embodiment of the present invention is (xii) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is Cl; R.sup.2 is H; R.sup.3 is H or F; R.sup.4 is H; R.sup.5 is H or I; m is 0; R.sup.6 is -L-Cy.sup.1, or Cy.sup.2; wherein L is

(30) ##STR00009## Cy.sup.1 is phenyl, phenylmethyl, phenylmethoxy or phenylcarbonyl; wherein phenyl, phenylmethyl, phenylmethoxy and phenylcarbonyl are unsubstituted or substituted by one substituent independently selected from carboxy, methoxycarbonyl and (carboxycyclobutoxy)ethoxy; Cy.sup.2 is isoindolin-2-yl, 3,4-dihydro-1H-isoquinolin-2-yl, 1-piperidyl, 2,6-diazaspiro[3.3]heptan-2-yl, 2-azaspiro[3.3]heptan-2-yl or 8-azabicyclo[3.2.1]octan-8-yl; wherein isoindolin-2-yl, 3,4-dihydro-1H-isoquinolin-2-yl, 1-piperidyl, 2,6-diazaspiro[3.3]heptan-2-yl, 2-azaspiro[3.3]heptan-2-yl and 8-azabicyclo[3.2.1]octan-8-yl are unsubstituted or substituted by one or two substituents independently selected from OH, methyl, methoxy, (carboxymethoxy)ethoxy, (carboxycyclobutoxy)ethoxy, tert-butoxycarbonyl, (methoxycarbonylcyclobutoxy)ethoxy and oxo.

(31) A further embodiment of the present invention is (xiii) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.6 is Cy.sup.2; wherein Cy.sup.2 is 3,4-dihydro-1H-isoquinolinyl; wherein 3,4-dihydro-1H-isoquinolinyl is substituted one time by (carboxyC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy.

(32) A further embodiment of the present invention is (xiv) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein Cy.sup.2 is 3,4-dihydro-1H-isoquinolin-2-yl; wherein 3,4-dihydro-1H-isoquinolin-2-yl is substituted one time by (carboxycyclobutoxy)ethoxy.

(33) In another embodiment (xv) of the present invention, particular compounds of the present invention are selected from: 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)isoindolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid; 3-((4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)methyl)benzoic acid; 2-(2-((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetic acid; 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-1-methyl-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic acid; methyl 3-(((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)methyl)benzoate; 2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxyisoindolin-1-one; 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxy-3,4-dihydroisoquinolin-1-one; 8-chloro-6-fluoro-2-(4-phenylpiperazin-1-yl)-chromen-4-one; 4-benzyloxy-1-(8-chloro-3-iodo-4-oxo-chromen-2-yl)pyridin-2-one; 8-chloro-2-(6-hydroxy-2-azaspiro[3.3]heptan-2-yl)chromen-4-one; 8-chloro-6-fluoro-2-(4-phenylpiperidin-1-yl)-chromen-4-one; 3-(2-(4-(1-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylic acid; 8-chloro-2-(3-hydroxy-8-azabicyclo[3.2.1]octan-8-yl)-chromen-4-one; methyl 3-(4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)benzoate; methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-3-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylate; 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxyisoindolin-1-one; 8-chloro-2-(6-hydroxy-1-methyl-3,4-dihydro-1H-isoquinolin-2-yl)chromen-4-one; 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxo-1,2,3,4-tetrahydroisoquinolin-6-yl)oxy)ethoxy)cyclobutanecarboxylic acid; 4-(benzyloxy)-1-(8-chloro-4-oxo-chromen-2-yl)pyridin-2(1H)-one; 8-chloro-2-(4-hydroxypiperidin-1-yl)-3-iodo-chromen-4-one; tert-butyl 6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carboxylate; methyl 3-[6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carbonyl]benzoate; 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylic acid; and 2-(8-chloro-4-oxo-chromen-2-yl)-7-methoxy-3,4-dihydroisoquinolin-1-one;
or a pharmaceutically acceptable salt thereof.

(34) A further embodiment of the present invention is (xvi) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is halogen; R.sup.2 is H; R.sup.3 is H; R.sup.4 is H; R.sup.5 is H or halogen; m is 0; R.sup.6 is N(R.sup.7)CH.sub.2Cy.sup.1; wherein R.sup.7 is H or C.sub.1-6alkyl; Cy.sup.1 is phenyl; wherein phenyl is unsubstituted or substituted by one substituent independently selected from C.sub.1-6alkoxy and (carboxyC.sub.3-7cycloalkoxy)C.sub.1-6alkoxy.

(35) A further embodiment of the present invention is (xvii) a compound of formula (I) according to (i), or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is Cl; R.sup.2 is H; R.sup.3 is H; R.sup.4 is H; R.sup.5 is H or I; m is 0; R.sup.6 is N(R.sup.7)CH.sub.2Cy.sup.1; wherein R.sup.7 is H or methyl; Cy.sup.1 is phenyl; wherein phenyl is unsubstituted or substituted by one substituent independently selected from methoxy and (carboxycyclobutoxy)ethoxy.

(36) In another embodiment (xviii) of the present invention, particular compounds of the present invention are selected from: 8-chloro-3-iodo-2-((4-methoxybenzyl)amino)-chromen-4-one; 8-chloro-2-((4-methoxybenzyl)(methyl)amino)-chromen-4-one; 8-chloro-2-((4-methoxybenzyl)amino)-chromen-4-one; 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)(methyl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic acid; and 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic acid;
or a pharmaceutically acceptable salt thereof.
Synthesis

(37) The compounds of the present invention can be prepared by any conventional means. Suitable processes for synthesizing these compounds as well as their starting materials are provided in the schemes below and in the subsequent examples. All substituents, in particular, R.sup.1 to R.sup.7, m, L, Cy.sup.1 and Cy.sup.2 are defined above unless otherwise indicated. Furthermore, and unless explicitly otherwise stated, all reactions, reaction conditions, abbreviations and symbols have the meanings well known to a person of ordinary skill in the art.

(38) ##STR00010##

(39) Condensation of compound of formula II with amine II-1 in the presence of HATU and a suitable base, such as DIPEA or TEA, affords compound of formula Ia.

(40) ##STR00011##
wherein R.sup.8 is C.sub.1-6alkyl; R.sup.9 is C.sub.1-6alkyl; Ai is phenyl, wherein phenyl is unsubstituted or substituted by halogen, C.sub.1-6alkyl or haloC.sub.1-6alkyl; G.sub.1 is C.sub.1-6alkyl; G.sub.2 is C.sub.1-6alkyl, C.sub.3-7cycloalkyl or phenylC.sub.1-6alkyl; Q is halogen, OTs, OTf or OMs.

(41) Condensation of compound of formula II with aniline II-2 in the presence of HATU and a suitable base, such as DIPEA, affords compound of formula II-3. Dealkylation of compound of formula II-3 with a suitable Lewis acid, such as BBr.sub.3, in a suitable solvent, such as DCM, affords compound of formula Ib. Substitution of compound of formula Ib with compound of formula II-4 in the presence of a suitable base, such as K.sub.2CO.sub.3, in a suitable solvent, such as DMF, affords compound of formula II-5. Hydrolysis of compound of formula II-5 with a suitable acid, such as hydrogen chloride or trifluoroacetic acid, affords compound of formula Ic.

(42) ##STR00012##
wherein R.sup.8 is C.sub.1-6alkyl; R.sup.9 is C.sub.1-6alkyl; Y is isoindolinyl, 3,4-dihydro-1H-isoquinolinyl, phenylmethylamino or phenylmethyl(methyl)amino, wherein isoindolinyl and 3,4-dihydro-1H-isoquinolinyl are unsubstituted or substituted by one substituent independently selected from C.sub.1-6alkyl and oxo; G.sub.1 is C.sub.1-6alkyl; G.sub.2 is C.sub.1-6alkyl, C.sub.3-7cycloalkyl or phenylC.sub.1-6alkyl; Q is halogen, OTs, OTf or Oms.

(43) Condensation of compound of formula III with DMF-DMA in a suitable solvent, such as toluene, affords compound of formula III-1. Cyclization of compound of formula III-1 in the presence of a suitable acid, such as HCl, in a suitable solvent, such as AcOH, affords compound of formula III-2. Substitution of compound of formula III-2 with 1H-1,2,4-triazole (halogen is added in case of need), in the presence of a suitable base, such as K.sub.2CO.sub.3, in a suitable solvent, such as DMF, affords compound of formula III-3. Substitution of compound of formula III-3 with amine II-1 in the presence of a suitable base, such as K.sub.2CO.sub.3, to give compound of formula Id.

(44) The compound of formula If can be prepared by starting with substitution of compound of formula III-3 with compound of formula III-4 in the presence of a suitable base, such as K.sub.2CO.sub.3 or Cs.sub.2CO.sub.3, affords compound of formula III-5. Dealkylation of compound of formula III-5 with a suitable Lewis acid, such as BBr.sub.3, in a suitable solvent, such as DCM, affords compound of formula III-7. Substitution of compound of formula III-7 with compound of formula II-4 in the presence of a suitable base, such as K.sub.2CO.sub.3, in a suitable solvent, such as DMF, affords compound of formula Ie. Hydrolysis of compound of formula Ie with a suitable acid or base, such as hydrogen chloride, trifluoroacetic acid or LiOH, affords compound of formula If. The compound of formula III-7 can also be prepared by substitution of compound of formula III-3 with compound of formula III-6 in the presence of a suitable base, such as K.sub.2CO.sub.3 or Cs.sub.2CO.sub.3, in a suitable solvent, such as DCM.

(45) ##STR00013##
wherein R.sup.8 is C.sub.1-6alkyl; R.sup.9 is C.sub.1-6alkyl; R.sup.10 is C.sub.1-6alkoxycarbonyl or phenylC.sub.1-6alkoxycarbonyl; Ai is phenyl, wherein phenyl is unsubstituted or substituted by halogen, C.sub.1-6alkyl or haloC.sub.1-6alkyl; Z is piperidyl or 8-azabicyclo[3.2.1]octanyl; G.sub.1 is C.sub.1-6alkyl; G.sub.2 is C.sub.1-6alkyl, C.sub.3-7cycloalkyl or phenylC.sub.1-6alkyl; Q is halogen, OTs, OTf or OMs.

(46) Substitution of compound of formula III-8 with compound of formula III-9 in the presence of trimethylsilyl trifluoromethanesulfonate and trimethylsilane, in a suitable solvent, such as DMF, affords compound of formula III-11. Hydrolysis of compound of formula III-11 in the presence of Pd/C, in a suitable solvent, such as EtOH, affords compound of formula III-12. Substitution of compound of formula III-3 with compound of formula III-12 in the presence of a suitable base, such as K.sub.2CO.sub.3, in a suitable solvent, such as DMF, affords compound of formula Ig. Hydrolysis of compound of formula Ig with a suitable acid or base, such as hydrogen chloride, trifluoroacetic acid or LiOH, affords compound of formula Ih. The compound of formula III-11 can be prepared by starting with substitution of compound of formula III-10 with compound of formula II-4 in the presence of a suitable base, such as K.sub.2CO.sub.3 or Cs.sub.2CO.sub.3, in a suitable solvent, such as DCM, to give compound of formula III-11.

(47) ##STR00014##
wherein R.sup.9 is C.sub.1-6alkyl; R.sup.11 is (C.sub.1-6alkoxycarbonyl)phenyl.

(48) Substitution of compound of formula III-3 with compound of formula III-13 in the presence of a suitable base, such as K.sub.2CO.sub.3, affords compound of formula Ii. Deprotection of compound of formula Ii with a suitable acid, such as hydrogen chloride or trifluoroacetic acid, affords compound of formula III-14. Condensation of compound of formula III-14 with acid III-15 in the presence of HATU and a suitable base, such as DIPEA or TEA, affords compound of formula Ij.

(49) ##STR00015##
wherein R.sup.9 is C.sub.1-6alkyl; A.sub.2 is phenyl or phenylC.sub.1-6alkyl; Q is halogen, OTs, OTf or OMs.

(50) Substitution of compound of formula IV with compound of formula IV-1 in the presence of a suitable base, such as K.sub.2CO.sub.3, in a suitable solvent, such as THF, affords compound of formula IV-2. Cyclization of compound of formula IV-2 with compound of formula IV-3 in the presence of POCl.sub.3 and a suitable base, such as AcONa, affords compound of formula Ik.

(51) Hydrolysis of compound of formula Ik with a suitable base, such as LiCl or LiOH, affords compound of formula Im.

(52) This invention also relates to a process for the preparation of a compound of formula (I) comprising one of the following steps: (a) Condensation of compound of formula (II),

(53) ##STR00016##
with amine (II-1), in the presence of HATU and a base; (b) Dealkylation of compound of formula (II-3),

(54) ##STR00017##
in the presence of a Lewis acid; (c) Hydrolysis of compound of formula (II-5),

(55) ##STR00018##
in the presence of an acid; (d) Substitution of compound of formula (III-3),

(56) ##STR00019##
with amine (II-1), in the presence of a base; (e) Substitution of compound of formula (III-7),

(57) ##STR00020##
with compound of formula (II-4) in the presence of a base; (f) Hydrolysis of compound of formula (Ie),

(58) ##STR00021##
in the presence of an acid or a base; (g) Substitution of compound of formula (III-3) with compound of formula (III-12) in the presence of a base; (h) Hydrolysis of compound of formula (Ig),

(59) ##STR00022##
in the presence of an acid or a base; (i) Substitution of compound of formula (III-3) with compound of formula (III-13) in the presence of a base; (j) Condensation of compound of formula (III-14),

(60) ##STR00023##
with acid (III-15) in the presence of HUTA and a base; (k) Cyclization of compound of formula (IV-2),

(61) ##STR00024##
with compound of formula (IV-3) in the presence of POCl.sub.3 and AcONa; (l) Hydrolysis of compound of formula (Ik),

(62) ##STR00025##
in the presence of a base; wherein R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7 and L are defined above; R.sup.8 is C.sub.1-6alkyl; R.sup.9 is C.sub.1-6alkyl; Ai is phenyl, wherein phenyl is unsubstituted or substituted by halogen, C.sub.1-6alkyl or haloC.sub.1-6alkyl; A.sub.2 is phenyl or phenylC.sub.1-6alkyl; Y is isoindolinyl, 3,4-dihydro-1H-isoquinolinyl, phenylmethylamino or phenylmethyl(methyl)amino, wherein isoindolinyl and 3,4-dihydro-1H-isoquinolinyl are unsubstituted or substituted by one substituent independently selected from C.sub.1-6alkyl and oxo; Z is piperidyl or 8-azabicyclo[3.2.1]octanyl; G.sub.1 is C.sub.1-6alkyl; G.sub.2 is C.sub.1-6alkyl, C.sub.3-7cycloalkyl or phenylC.sub.1-6alkyl; Q is halogen, OTs, OTf or OMs.
The base in step (a) or (j), can be for example DIPEA or TEA;
The Lewis acid in step (b), can be for example BBr.sub.3;
The acid in step (c), (f) or (h), can be for example hydrogen chloride or trifluoroacetic acid;
The base in step (d), (e), (g) or (i), can be for example K.sub.2CO.sub.3;
The base in step (f) or (h), can be for example LiOH;
The base in step (1), can be for example LiCl or LiOH.

(63) A compound of formula (I) when manufactured according to the above process is also an object of the invention.

(64) The compound of this invention also shows good safety and PK profile.

(65) Pharmaceutical Compositions and Administration

(66) The invention also relates to a compound of formula (I) for use as therapeutically active substance. Another embodiment provides pharmaceutical compositions or medicaments containing the compounds of the invention and a therapeutically inert carrier, diluent or excipient, as well as methods of using the compounds of the invention to prepare such compositions and medicaments. In one example, compounds of formula (I) may be formulated by mixing at ambient temperature at the appropriate pH, and at the desired degree of purity, with physiologically acceptable carriers, i.e., carriers that are non-toxic to recipients at the dosages and concentrations employed into a galenical administration form. The pH of the formulation depends mainly on the particular use and the concentration of compound, but preferably ranges anywhere from about 3 to about 8. In one example, a compound of formula (I) is formulated in an acetate buffer, at pH 5. In another embodiment, the compounds of formula (I) are sterile. The compound may be stored, for example, as a solid or amorphous composition, as a lyophilized formulation or as an aqueous solution.

(67) Compositions are formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The effective amount of the compound to be administered will be governed by such considerations, and is the minimum amount necessary to inhibit cccDNA in HBV patients, consequently lead to the reduction of HBsAg and HBeAg (HBV e antigen) in serum. For example, such amount may be below the amount that is toxic to normal cells, or the mammal as a whole.

(68) In one example, the pharmaceutically effective amount of the compound of the invention administered parenterally per dose will be in the range of about 0.1 to 100 mg/kg, alternatively about 0.1 to 50 mg/kg of patient body weight per day, with the typical initial range of compound used being 0.3 to 15 mg/kg/day. In another embodiment, oral unit dosage forms, such as tablets and capsules, preferably contain from about 25 to about 1000 mg of the compound of the invention.

(69) The compounds of the invention may be administered by any suitable means, including oral, topical (including buccal and sublingual), rectal, vaginal, transdermal, parenteral, subcutaneous, intraperitoneal, intrapulmonary, intradermal, intrathecal and epidural and intranasal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.

(70) The compounds of the present invention may be administered in any convenient administrative form, e.g., tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. Such compositions may contain components conventional in pharmaceutical preparations, e.g., diluents, carriers, pH modifiers, sweeteners, bulking agents, and further active agents.

(71) A typical formulation is prepared by mixing a compound of the present invention and a carrier or excipient. Suitable carriers and excipients are well known to those skilled in the art and are described in detail in, e.g., Ansel, Howard C., et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems. Philadelphia: Lippincott, Williams & Wilkins, 2004; Gennaro, Alfonso R., et al. Remington: The Science and Practice of Pharmacy. Philadelphia: Lippincott, Williams & Wilkins, 2000; and Rowe, Raymond C. Handbook of Pharmaceutical Excipients. Chicago, Pharmaceutical Press, 2005. The formulations may also include one or more buffers, stabilizing agents, surfactants, wetting agents, lubricating agents, emulsifiers, suspending agents, preservatives, antioxidants, opaquing agents, glidants, processing aids, colorants, sweeteners, perfuming agents, flavoring agents, diluents and other known additives to provide an elegant presentation of the drug (i.e., a compound of the present invention or pharmaceutical composition thereof) or aid in the manufacturing of the pharmaceutical product (i.e., medicament).

(72) An example of a suitable oral dosage form is a tablet containing about 25 to 500 mg of the compound of the invention compounded with about 90 to 30 mg anhydrous lactose, about 5 to 40 mg sodium croscarmellose, about 5 to 30 mg polyvinylpyrrolidone (PVP) K30, and about 1 to 10 mg magnesium stearate. The powdered ingredients are first mixed together and then mixed with a solution of the PVP. The resulting composition can be dried, granulated, mixed with the magnesium stearate and compressed to tablet form using conventional equipment. An example of an aerosol formulation can be prepared by dissolving the compound, for example 5 to 400 mg, of the invention in a suitable buffer solution, e.g. a phosphate buffer, adding a tonicifier, e.g. a salt such sodium chloride, if desired. The solution may be filtered, e.g., using a 0.2 micron filter, to remove impurities and contaminants.

(73) An embodiment, therefore, includes a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

(74) In a further embodiment includes a pharmaceutical composition comprising a compound of formula (I), or a pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier or excipient.

(75) Another embodiment includes a pharmaceutical composition comprising a compound of formula (I), or a pharmaceutically acceptable salt thereof for use in the treatment of HBV infection.

(76) Indications and Methods of Treatment

(77) The compounds of the invention can inhibit cccDNA and have anti-HBV activity. Accordingly, the compounds of the invention are useful for the treatment or prophylaxis of HBV infection.

(78) The invention relates to the use of a compound of formula (I) for the inhibition of cccDNA.

(79) The invention also relates to the use of a compound of formula (I) for the inhibition of HBeAg.

(80) The invention further relates to the use of a compound of formula (I) for the inhibition of HBsAg.

(81) The invention relates to the use of a compound of formula (I) for the inhibition of HBV DNA.

(82) The invention relates to the use of a compound of formula (I) for the treatment or prophylaxis of HBV infection.

(83) The use of a compound of formula (I) for the preparation of medicaments useful in the treatment or prophylaxis diseases that are related to HBV infection is an object of the invention.

(84) The invention relates in particular to the use of a compound of formula (I) for the preparation of a medicament for the treatment or prophylaxis of HBV infection.

(85) Another embodiment includes a method for the treatment or prophylaxis of HBV infection, which method comprises administering an effective amount of a compound of Formula (I), or enantiomers, diastereomers, prodrugs or pharmaceutically acceptable salts thereof.

EXAMPLES

(86) The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention.

(87) Abbreviations used herein are as follows:

(88) AcOH: acetic acid ACN: acetonitrile BBr.sub.3: boron tribromide DCM: dichloromethane DIPEA: N,N-Diisopropylethylamine DMAP: 4-dimethylaminopyridine DME: dimethoxyethane DMF: N, N-dimethylfonriamide DMF-DMA: N,N-Dimethylformamide dimethyl acetal EC.sub.50: the molar concentration of an inhibitor, which produces 50% of the maximum possible response for that inhibitor. FBS: fetal bovine serum H.sub.2O.sub.2: hydrogen peroxide HPLC: high performance liquid chromatography HATU: 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate min: minute MS (ESI): mass spectroscopy (electron spray ionization) Ms: methylsulfonyl NCS: N-chlorosuccinimide NMP: N-methyl-2-pyrrolidone obsd.: observed PE: petroleum ether PPA: polyphosphoric acid PPh.sub.3: triphenylphosphine POCl.sub.3: phosphorus oxychloride Py: pyridine Sphos: 2-dicyclohexylphosphino-2,6-dimethoxybiphenyl TEA: trimethylamine Tf: trifluoromethanesulfonyl TFA: trifluoroacetic acid TFAA: trifluoroacetic anhydride THF: Tetrahydrofuran Ts: p-tolylsulfonyl ?: chemical shift
General Experimental Conditions

(89) Intermediates and final compounds were purified by flash chromatography using one of the following instruments: i) Biotage SP1 system and the Quad 12/25 Cartridge module, ii) ISCO combi-flash chromatography instrument. Silica gel Brand and pore size: i) KP-SIL 60 ?, particle size: 40-60 ?m; ii) CAS registry NO: Silica Gel: 63231-67-4, particle size: 47-60 micron silica gel; iii) ZCX from Qingdao Haiyang Chemical Co., Ltd, pore: 200-300 or 300-400.

(90) Intermediates and final compounds were purified by preparative HPLC on reversed phase column using X Bridge? Perp C.sub.18 (5 ?m, OBD? 30?100 mm) column or SunFire? Perp C.sub.18 (5 ?m, OBD? 30?100 mm) column.

(91) LC/MS spectra were obtained using a Waters UPLC-SQD Mass. Standard LC/MS conditions were as follows (running time 3 mins): Acidic condition: A: 0.1% formic acid and 1% acetonitrile in H.sub.2O; B: 0.1% formic acid in acetonitrile; Basic condition: A: 0.05% NH.sub.3H.sub.2O in H.sub.2O; B: acetonitrile. Mass spectra (MS): generally only ions which indicate the parent mass are reported, and unless otherwise stated the mass ion quoted is the positive mass ion (M+H).sup.+. NMR Spectra were obtained using Bruker Avance 400 MHz.

(92) All reactions involving air-sensitive reagents were performed under an argon atmosphere. Reagents were used as received from commercial suppliers without further purification unless otherwise noted.

PREPARATIVE EXAMPLES

Intermediate 1: 8-chloro-4-oxo-chromene-2-carboxylic Acid

(93) ##STR00026##

(94) To a solution of sodium hydride (1.41 g, 35.2 mmol) in EtOH (60 mL) was added 1-(3-chloro-2-hydroxyphenyl)ethanone (2 g, 11.7 mmol) and diethyl oxalate (3.77 g, 3.52 mL, 25.8 mmol) and then the resulting mixture was stirred at 80? C. for 12 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4N HCl and then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue (3.2 g, 11.7 mmol) was dissolved in the mixed solvent of AcOH (10 mL) and HCl (2 mL) and the mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was adjusted to pH?3 by addition of 4N HCl and then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 8-chloro-4-oxo-chromene-2-carboxylic acid (2 g, 76%) as a yellow solid which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 225.1

Intermediate 2: 6,8-dichloro-4-oxo-chromene-2-carboxylic Acid

(95) ##STR00027##

(96) To a solution of sodium ethoxide (16.6 g, 244 mmol) in EtOH (60 mL) was added 1-(3,5-dichloro-2-hydroxyphenyl)ethanone (10 g, 48.8 mmol) and diethyl oxalate (42.8 g, 40 mL, 293 mmol) was added and then the resulting mixture was stirred at 80? C. for 12 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4N HCl and then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue (15 g, 48.8 mmol) was dissolved in the mixed solvent of AcOH (100 mL) and HCl (20 mL) and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was adjusted to pH?3 by addition of 4N HCl and then extracted with EtOAc (150 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 6,8-dichloro-4-oxo-chromene-2-carboxylic acid (6.3 g, 50%) as a yellow solid which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 259.1&261.1

Intermediate 3&4: 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3) & 8-chloro-3-iodo-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-4)

(97) ##STR00028## Step 1: Preparation of (E)-1-(3-chloro-2-hydroxyphenyl)-3-(dimethylamino)prop-2-en-1-one

(98) ##STR00029##

(99) To a solution of 1-(3-chloro-2-hydroxyphenyl)ethanone (6 g, 35.2 mmol) in toluene (50 mL) was added DMF-DMA (8.38 g, 9.42 mL, 70.3 mmol) at room temperature and the resulting mixture was then stirred at 120? C. for 5 hours. After the reaction was completed, the mixture was concentrated in vacuo to give (E)-1-(3-chloro-2-hydroxyphenyl)-3-(dimethylamino)prop-2-en-1-one (8 g, 101%) as a brown solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 226.1

Step 2: Preparation of 8-chloro-chromen-4-one

(100) ##STR00030##

(101) To a solution of (E)-1-(3-chloro-2-hydroxyphenyl)-3-(dimethylamino)prop-2-en-1-one (2.1 g, 9.31 mmol) in AcOH (20 mL) was added HCl (5 mL) at room temperature and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was concentrated in vacuo. The residue was then extracted with EtOAc (150 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 8-chloro-chromen-4-one (1.4 g, 83.3%) as a yellow foam, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 181.1

Step 3: Preparation of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3) & 8-chloro-3-iodo-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-4)

(102) ##STR00031##

(103) To a solution of 8-chloro-chromen-4-one (1.5 g, 8.31 mmol), 1H-1,2,4-triazole (1.15 g, 16.6 mmol) and potassium carbonate (5.74 g, 41.5 mmol) in DML (40 mL) was added I.sub.2 (3.16 g, 12.5 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 3 hours.

(104) After the reaction was completed, the mixture was quenched with sodium thiosulphate solution and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (1.6 g, 77.8%) (Int-3) as a yellow foam, MS obsd. (ESI.sup.+) [(M+H).sup.+]: 248.1 and 8-chloro-3-iodo-2-(1,2,4-triazol-1-yl)-chromen-4-one (800 mg, 25%) (Int-4) as a yellow foam, MS obsd. (ESI.sup.+) [(M+H).sup.+]: 374.1.

Intermediate 5: 1-methyl-1,2,3,4-tetrahydroisoquinolin-6-ol; Hydrobromide

(105) ##STR00032## Step 1: Preparation of N-[2-(3-methoxyphenyl)ethyl]acetamide

(106) ##STR00033##

(107) To a solution of acetyl chloride (2.62 g, 2.38 mL, 33.3 mmol) in DCM (20 mL) was added slowly a solution of 2-(3-methoxyphenyl)ethanamine (5.04 g, 33.3 mmol) and Et.sub.3N (5.06 g, 6.97 mL, 50 mmol) in DCM (50 mL) at 0? C. and then the resulting mixture was stirred at room temperature for 10 hours. After the reaction was completed, the mixture was washed with IN HCl (100 mL), saturated NaHCO.sub.3 solution, brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give N-[2-(3-methoxyphenyl)ethyl]acetamide (6.2 g, 96%). Step 2: Preparation of 6-methoxy-1-methyl-3,4-dihydroisoquinoline

(108) ##STR00034##

(109) A solution of N-[2-(3-methoxyphenyl)ethyl]acetamide (2.2 g, 11.4 mmol) and POCl.sub.3 (8.73 g, 5.31 mL, 56.9 mmol) in toluene (30 mL) was stirred at 120? C. for 5 hours. After the reaction was completed, the mixture was poured into H.sub.2O (100 mL). The resulting mixture was adjusted to pH?10 by addition of 12 N NaOH and then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 6-methoxy-1-methyl-3,4-dihydroisoquinoline (1.9 g, 95%). Step 3: Preparation of 6-methoxy-1-methyl-1,2,3,4-tetrahydroisoquinoline

(110) ##STR00035##

(111) To a solution of 6-methoxy-1-methyl-3,4-dihydroisoquinoline (2.1 g, 12 mmol) in MeOH (20 mL) was added NaBH.sub.4 (907 mg, 24 mmol) at 0? C. and the resulting mixture was stirred at room temperature overnight. The mixture was adjusted to pH?3 by addition of IN HCl and concentrated in vacuo. The residue was adjusted to pH?8 by IN NaOH and extracted with DCM (20 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 6-methoxy-1-methyl-1,2,3,4-tetrahydroisoquinoline (2.0 g, 94%).

Step 4: Preparation of 1-methyl-1,2,3,4-tetrahydroisoquinolin-6-ol; Hydrobromide

(112) ##STR00036##

(113) A solution of 6-methoxy-1-methyl-1,2,3,4-tetrahydroisoquinoline (1.2 g, 6.77 mmol) in HBr (11.7 g, 47% wt. in H.sub.2O, 67.7 mmol) was stirred at 100? C. overnight. After the reaction was completed, the mixture was concentrated in vacuo and triturated with EtOAc. The mixture was filtered and the solid was collected and dried in vacuo to give 1-methyl-1,2,3,4-tetrahydroisoquinolin-6-ol; hydrobromide (1.1 g, 99%) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 164.

Intermediate 6: 8-chloro-6-fluoro-2-(1,2,4-triazol-1-yl)-chromen-4-one

(114) ##STR00037## Step 1: Preparation of (E)-1-(3-chloro-5-fluoro-2-hydroxyphenyl)-3-(dimethylamino)prop-2-en-1-one

(115) ##STR00038##

(116) To a solution of 1-(3-chloro-5-fluoro-2-hydroxyphenyl)ethan-1-one (8 g, 42.42 mmol) in toluene (50 mL) was added DMF-DMA (8.38 g, 9.42 mL, 70.3 mmol) at room temperature and the resulting mixture was then stirred at 120? C. for 5 hours. After the reaction was completed, the mixture was concentrated in vacuo to give the crude (E)-1-(3-chloro-5-fluoro-2-hydroxyphenyl)-3-(dimethylamino)prop-2-en-1-one (5 g, 48.4%) as a brown solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 244.1

Step 2: Preparation of 8-chloro-6-fluoro-chromen-4-one

(117) ##STR00039##

(118) To a solution of (E)-1-(3-chloro-5-fluoro-2-hydroxyphenyl)-3-(dimethylamino)prop-2-en-1-one (5 g, 20.52 mmol) in AcOH (20 mL) was added HCl (5 mL) at room temperature and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was then extracted with EtOAc (150 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 8-chloro-6-fluoro-chromen-4-one (3.6 g, 88.3%) as a yellow foam, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 199.1

Step 3: Preparation of 8-chloro-6-fluoro-2-(1,2,4-triazol-1-yl)-chromen-4-one

(119) ##STR00040##

(120) To a solution of 8-chloro-6-fluoro-chromen-4-one (1.8 g, 9.06 mmol), 1H-1,2,4-triazole (1.15 g, 16.6 mmol) and potassium carbonate (6.8 g, 49.5 mmol) in DMF (40 mL) was added diiodine (3.16 g, 12.5 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 3 hours. After the reaction was completed, the mixture was quenched with sodium thiosulphate solution and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 8-chloro-6-fluoro-2-(1,2,4-triazol-1-yl)-chromen-4-one (600 mg, 25.28%) as a yellow foam, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 266.1.

Intermediate 7: methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate

(121) ##STR00041## Step 1: Preparation of 2-benzyloxyethoxy(trimethyl)silane

(122) ##STR00042##

(123) To a solution of 2-benzyloxyethanol (20.0 g, 131.4 mmol) and TEA (20.0 g, 197.1 mmol) in DCM (200 mL) was added trimethylsilyl chloride (17.1 g, 157.7 mmol) at 0? C. and the resulting mixture was then stirred at 25? C. for 16 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc=50:1 to 10:1) to give the 2-benzyloxyethoxy(trimethyl)silane (25.0 g, 84.9%) as a colorless oil. Step 2: Preparation of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate

(124) ##STR00043##

(125) To a solution of 2-benzyloxyethoxy(trimethyl)silane (25.0 g, 111.4 mmol) and methyl 3-oxocyclobutanecarboxylate (15.0 g, 117.0 mmol) in DCM (200 mL) was added slowly trimethylsilyl trifluoromethanesulfonate (12.4 g, 55.7 mmol) at ?78? C. After that, the mixture was stirred at ?78? C. for 1 hour and then to the resulting mixture was added triethylsilane (14.25 g, 122.57 mmol). The resulting mixture was then warmed to room temperature and stirred at room temperature for 1 hour. After the reaction was completed, the mixture was washed with saturated NH.sub.4Cl solution, brine, dried over anhydrous sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE/EtOAc=100:1-50:1) to give methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (28 g, 95.1%) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 265.1. Step 3: Preparation of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate

(126) ##STR00044##

(127) To a solution of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (28.0 g, 105.9 mmol) in MeOH (300.0 mL) was added Pd(OH).sub.2 (wet) (1.48 g, 10.6 mmol) at room temperature and the resulting mixture was then hydrogenated under H.sub.2 atmosphere at room temperature overnight. After the reaction was completed, the mixture was filtered through silica gel pad and the filtrate was concentrated in vacuo to give methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (18 g, 97.6%) as a colorless oil.

Intermediate 8: methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate

(128) ##STR00045##

(129) To a solution of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (Int-7, 5 g, 28.7 mmol) and DMAP (5.26 g, 43.1 mmol) in DCM (80 mL) was added 4-methylbenzene-1-sulfonyl chloride (6.02 g, 31.6 mmol) at room temperature and the resulting mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was washed with IN HCl (25 mL), water (15 mL), saturated NaHCO.sub.3 solution, brine and concentrated in vacuo to give methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (8.1 g, 85.6%) as a colorless oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 329.2.

Intermediate 9: 1,2,3,4-tetrahydroisoquinolin-6-ol; Hydrobromide

(130) ##STR00046##

(131) A solution of 6-methoxy-1,2,3,4-tetrahydroisoquinoline (200 mg, 1.23 mmol) in HBr (3.16 g, 47% wt. in H.sub.2O, 18.4 mmol) was stirred at 100? C. overnight. After the reaction was completed, the mixture was concentrated in vacuo and triturated with EtOAc. The mixture was filtered and the solid was collected and dried in vacuo to give 1,2,3,4-tetrahydroisoquinolin-6-ol; hydrobromide (170 mg, 93%) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 150.

Intermediate 10: isoindolin-5-ol; Hydrobromide

(132) ##STR00047##

(133) A solution of 5-methoxyisoindoline (800 mg, 5.36 mmol) in HBr (13.8 g, 47% wt. in H.sub.2O, 80.4 mmol) was stirred at 100? C. overnight. After the reaction was completed, the mixture was concentrated in vacuo and triturated with EtOAc. The mixture was filtered and the solid was collected and dried in vacuo to give isoindolin-5-ol; hydrobromide (1.1 g, 95%) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 136.

Example 1

3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylic Acid

(134) ##STR00048## Step 1: Preparation of 8-chloro-N-(2-fluoro-4-methoxyphenyl)-4-oxo-chromene-2-carboxamide

(135) ##STR00049##

(136) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 300 mg, 1.34 mmol) in DCM (20 mL) was added 2-fluoro-4-methoxyaniline (283 mg, 2 mmol), DIPEA (276 mg, 2.14 mmol) and HATU (762 mg, 2 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1-1:2) to give 8-chloro-N-(2-fluoro-4-methoxyphenyl)-4-oxo-chromene-2-carboxamide (200 mg, 43.1%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? ppm 10.13-10.23 (m, 1H), 7.99-8.12 (m, 2H), 7.51-7.66 (m, 2H), 6.96-7.07 (m, 2H), 6.82-6.90 (m, 1H), 3.84 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 348.1. Step 2: Preparation of 8-chloro-N-(2-fluoro-4-hydroxyphenyl)-4-oxo-chromene-2-carboxamide

(137) ##STR00050##

(138) To a solution of 8-chloro-N-(2-fluoro-4-methoxyphenyl)-4-oxo-chromene-2-carboxamide (230 mg, 661 ?mol) in DCM (10 mL) was added BBr.sub.3 (1 M solution in DCM, 5 mL, 5 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 8-chloro-N-(2-fluoro-4-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (200 mg, 90.6%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 334.1. Step 3: Preparation of methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylate

(139) ##STR00051##

(140) To a solution of 8-chloro-N-(2-fluoro-4-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (250 mg, 749 ?mol) and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 295 mg, 899 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (207 mg, 1.5 mmol) at room temperature and the resulting mixture was then stirred at 50? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylate (150 mg, 40.9%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 490.1.

Step 4: Preparation of 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylic Acid

(141) ##STR00052##

(142) To a solution of methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylate (150 mg, 306 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-fluorophenoxy)ethoxy)cyclobutanecarboxylic acid (10 mg, 6.86%) as a light yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.13-12.19 (m, 1H), 10.11-10.25 (m, 1H), 7.97-8.13 (m, 2H), 7.50-7.66 (m, 2H), 7.02-7.08 (m, 1H), 6.99-7.02 (m, 1H), 6.82-6.92 (m, 1H), 4.13-4.21 (m, 1H), 4.07-4.14 (m, 2H), 3.58-3.68 (m, 2H), 2.87-2.97 (m, 1H), 2.33-2.47 (m, 2H), 2.10-2.23 (m, 1H), 1.92-2.05 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 476.1.

Example 2

3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylic Acid

(143) ##STR00053## Step 1: Preparation of 8-chloro-N-(4-methoxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide

(144) ##STR00054##

(145) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 300 mg, 1.34 mmol) in DCM (20 mL) was added 4-methoxy-2-methylaniline (275 mg, 2 mmol), DIPEA (276 mg, 2.14 mmol) and HATU (762 mg, 2 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1-1:2) to give 8-chloro-N-(4-methoxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (300 mg, 65.3%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 344.1. Step 2: Preparation of 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide

(146) ##STR00055##

(147) To a solution of 8-chloro-N-(4-methoxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (400 mg, 1.16 mmol) in DCM (20 mL) was added BBr.sub.3 (1 M solution in DCM, 8 mL, 8 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (340 mg, 88.6%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.1. Step 3: Preparation of methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylate

(148) ##STR00056##

(149) To a solution of 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (170 mg, 516 ?mol) and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 203 mg, 619 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (143 mg, 1.03 mmol) at room temperature and the resulting mixture was then stirred at 50? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylate (120 mg, 47.9%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 486.1.

Step 4: Preparation of 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylic Acid

(150) ##STR00057##

(151) To a solution of methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylate (140 mg, 288 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)cyclobutanecarboxylic acid (27 mg, 19.9%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.15-12.22 (m, 1H), 9.87-9.95 (m, 1H), 7.98-8.13 (m, 2H), 7.50-7.63 (m, 1H), 7.40-7.48 (m, 1H), 7.01-7.06 (m, 1H), 6.89-6.96 (m, 1H), 6.80-6.89 (m, 1H), 4.12-4.21 (m, 1H), 4.03-4.10 (m, 2H), 3.55-3.68 (m, 2H), 2.83-2.97 (m, 1H), 2.35-2.43 (m, 2H), 2.25-2.29 (m, 3H), 1.92-2.20 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 472.1.

Example 3

6-chloro-N-(4-chloro-2-methylphenyl)-3-methyl-4-oxo-chromene-2-carboxamide

(152) ##STR00058##

(153) To a solution of 6-chloro-3-methyl-4-oxo-chromene-2-carboxylic acid (100 mg, 419 ?mol) in DCM (20 mL) was added 4-chloro-2-methylaniline (119 mg, 0.84 mmol), DIPEA (162 mg, 1.26 mmol) and HATU (239 mg, 629 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 6-chloro-N-(4-chloro-2-methylphenyl)-3-methyl-4-oxo-chromene-2-carboxamide (60 mg, 39.5%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.38-10.59 (m, 1H), 8.00-8.07 (m, 1H), 7.88-7.99 (m, 1H), 7.80-7.88 (m, 1H), 7.46-7.53 (m, 1H), 7.41-7.46 (m, 1H), 7.30-7.37 (m, 1H), 2.28 (s, 3H), 2.22 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 362.1.

Example 4

2-(5-bromoisoindoline-2-carbonyl)-8-chloro-chromen-4-one

(154) ##STR00059##

(155) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 150 mg, 668 ?mol) in DCM (20 mL) was added 5-bromoisoindoline (198 mg, 1 mmol), DIPEA (138 mg, 1.07 mmol) and HATU (381 mg, 1 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-(5-bromoisoindoline-2-carbonyl)-8-chloro-chromen-4-one (30 mg, 11.1%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 8.01-8.12 (m, 2H), 7.61-7.69 (m, 1H), 7.49-7.60 (m, 2H), 7.30-7.43 (m, 1H), 6.90-6.93 (m, 1H), 5.23-5.36 (m, 2H), 4.83-4.96 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 404.1 & 406.1.

Example 5

3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylic Acid

(156) ##STR00060##

Step 1: Preparation of 8-chloro-N-(4-methoxy-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide Acid

(157) ##STR00061##

(158) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 200 mg, 890 ?mol) in DCM (20 mL) was added 4-methoxy-2-(trifluoromethyl)aniline (204 mg, 1.07 mmol), DIPEA (345 mg, 2.67 mmol) and HATU (508 mg, 1.34 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo, the residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1-1:2) to give 8-chloro-N-(4-methoxy-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide (300 mg, 84.7%) as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.16-10.21 (m, 1H), 7.98-8.13 (m, 2H), 7.64-7.70 (m, 1H), 7.52-7.61 (m, 1H), 7.30-7.38 (m, 2H), 6.99-7.06 (m, 1H), 3.88 (s, 3H). MS obsd. (ESP) [(M+H).sup.+]: 398.1.

Step 2: Preparation of 8-chloro-N-(4-hydroxy-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide

(159) ##STR00062##

(160) To a solution of 8-chloro-N-(4-methoxy-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide (200 mg, 503 ?mol) in DCM (20 mL) was added BBr.sub.3 (1 M solution in DCM, 8 mL, 8 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 8-chloro-N-(4-hydroxy-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide (150 mg, 77.7%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESP) [(M+H).sup.+]: 384.1.

Step 3: Preparation of methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylate

(161) ##STR00063##

(162) To a solution of 8-chloro-N-(4-hydroxy-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide (150 mg, 391 ?mol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 154 mg, 469 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (108 mg, 782 ?mol) at room temperature and the resulting mixture was then stirred at 50? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylate (140 mg, 66.3%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 540.1.

Step 4: Preparation of 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylic Acid

(163) ##STR00064##

(164) To a solution of methyl 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylate (140 mg, 259 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) at room temperature and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 3-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-(trifluoromethyl)phenoxy)ethoxy)cyclobutanecarboxylic acid (44 mg, 32.3%) as a light yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.11-12.23 (m, 1H), 10.08-10.23 (m, 1H), 7.98-8.12 (m, 2H), 7.62-7.69 (m, 1H), 7.51-7.60 (m, 1H), 7.30-7.40 (m, 2H), 6.96-7.05 (m, 1H), 4.19-4.24 (m, 2H), 4.12-4.19 (m, 1H), 3.62-3.69 (m, 2H), 2.86-2.96 (m, 1H), 2.36-2.46 (m, 2H), 2.09-2.20 (m, 1H), 1.92-2.04 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 526.1.

Example 6

8-chloro-4-oxo-N-(5-(trifluoromethyl)-1,3,4-thiadiazol-2-yl)-chromene-2-carboxamide

(165) ##STR00065##

(166) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 90 mg, 401 ?mol) in DCM (20 mL) was added 5-(trifluoromethyl)-1,3,4-thiadiazol-2-amine (136 mg, 0.81 mmol), DIPEA (82.9 mg, 641 ?mol) and HATU (229 mg, 601 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo, the residue was purified by preparative HPLC to give 8-chloro-4-oxo-N-(5-(trifluoromethyl)-1,3,4-thiadiazol-2-yl)-chromene-2-carboxamide (86 mg, 57.1%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 8.07-8.12 (m, 1H), 7.99-8.06 (m, 1H), 7.48-7.63 (m, 1H), 7.37 (s, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 376.1.

Example 7

3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylic Acid

(167) ##STR00066##

Step 1: Preparation of 8-chloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide

(168) ##STR00067##

(169) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 1 g, 4.45 mmol) in DCM (20 mL) was added 4-chloro-2-methoxyaniline (842 mg, 5.34 mmol), DIPEA (1.15 g, 8.9 mmol) and HATU (3.3 g, 8.9 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1?1:3) to give 8-chloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.3 g, 80.3%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 364.1.

Step 2: Preparation of 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide

(170) ##STR00068##

(171) To a solution of 8-chloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.2 g, 3.3 mmol) in DCM (40 mL) was added BBr.sub.3 (1 M solution in DCM, 25 mL, 25 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (800 mg, 69.3%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 350.1.

Step 3: Preparation of methyl 3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylate

(172) ##STR00069##

(173) To a solution of 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (190 mg, 543 ?mol), methyl 3-chlorocyclobutane-1-carboxylate (105 mg, 75 ?L, 543 ?mol) in DMF (5 mL) was added Cs.sub.2CO.sub.3 (260 mg, 782 ?mol) at room temperature and the resulting mixture was then stirred at 90? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylate (200 mg, 79.8%) as a yellow foam, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 462.1.

Step 4: Preparation of 3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylic Acid

(174) ##STR00070##

(175) To a solution of methyl 3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylate (150 mg, 324 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 3-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)cyclobutane-1-carboxylic acid (10 mg, 6.88%) as a light yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.29-12.42 (m, 1H), 9.45-9.56 (m, 1H), 8.31-8.40 (m, 1H), 8.09-8.17 (m, 1H), 8.02-8.09 (m, 1H), 7.52-7.62 (m, 1H), 7.08-7.17 (m, 2H), 7.06 (s, 1H), 5.00-5.11 (m, 1H), 2.67-2.86 (m, 3H), 2.26-2.39 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 448.1.

Example 8

8-chloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide

(176) ##STR00071##

(177) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 100 mg, 445 ?mol) in DCM (20 mL) was added 4-chloro-2-methylaniline (126 mg, 0.89 mmol), DIPEA (173 mg, E34 mmol) and HATU (254 mg, 668 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide (30 mg, 19.4%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.00-10.07 (m, 1H), 8.07-8.13 (m, 1H), 8.01-8.07 (m, 1H), 7.62-7.71 (m, 1H), 7.50-7.60 (m, 1H), 7.40-7.47 (m, 1H), 7.30-7.38 (m, 1H), 7.01-7.08 (m, 1H), 2.37 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 348.1.

Example 9

8-chloro-N-(2,4-dichlorobenzyl)-4-oxo-chromene-2-carboxamide

(178) ##STR00072##

(179) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 100 mg, 445 ?mol) in DCM (20 mL) was added (2,4-dichlorophenyl)methanamine (157 mg, 890 ?mol), DIPEA (92.1 mg, 712 ?mol) and HATU (254 mg, 668 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-N-(2,4-dichlorobenzyl)-4-oxo-chromene-2-carboxamide (9 mg, 5.28%) as yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 9.25-9.31 (m, 1H), 7.97-8.08 (m, 2H), 7.62-7.70 (m, 1H), 7.50-7.58 (m, 1H), 7.44-7.47 (m, 2H), 6.94-7.01 (m, 1H), 4.47-4.63 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 382.1.

Example 10

N-(5-bromo-3-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide

(180) ##STR00073##

(181) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 150 mg, 668 ?mol) in DCM (20 mL) was added 5-bromo-3-methylpyridin-2-amine (200 mg, 1.07 mmol), DIPEA (138 mg, 1.07 mmol) and HATU (381 mg, 1 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give N-(5-bromo-3-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide (70 mg, 26.6%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.81-10.90 (m, 1H), 8.37-8.49 (m, 1H), 7.97-8.14 (m, 3H), 7.48-7.60 (m, 1H), 7.02-7.09 (m, 1H), 2.27 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 393.1 & 395.1.

Example 11

4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoic Acid

(182) ##STR00074##

Step 1: Preparation of 6,8-dichloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide

(183) ##STR00075##

(184) To a solution of 6,8-dichloro-4-oxo-chromene-2-carboxylic acid (Int-2, 1.3 g, 5.02 mmol) in DCM (20 mL) was added 4-chloro-2-methoxyaniline (949 mg, 6.02 mmol), DIPEA (1.15 g, 8.9 mmol) and HATU (3.3 g, 8.9 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1-1:4) to give 6,8-dichloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.6 g, 80%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 398.1.

Step 2: Preparation of 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide

(185) ##STR00076##

(186) To a solution of 6,8-dichloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.6 g, 4.01 mmol) in DCM (40 mL) was added BBr.sub.3 (1 M solution in DCM, 25 mL, 25 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 6,8-dichloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (1 g, 64.8%) as a yellow foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 384.1.

Step 3: Preparation of methyl 4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoate

(187) ##STR00077##

(188) To a solution of 6,8-dichloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (190 mg, 494 ?mol), methyl 4-bromobutanoate (98.4 mg, 68.3 ?l, 543 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (137 mg, 988 ?mol) at room temperature and the resulting mixture was then stirred at 90? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoate (100 mg, 41.8%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 484.1.

Step 4: Preparation of 4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoic Acid

(189) ##STR00078##

(190) To a solution of methyl 4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoate (120 mg, 248 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 4-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)butanoic acid (7 mg, 6.01%) as a light yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.11-12.18 (m, 1H), 9.45-9.55 (m, 1H), 8.24-8.34 (m, 2H), 7.88-8.05 (m, 1H), 7.22-7.33 (m, 1H), 7.07-7.16 (m, 1H), 7.00-7.07 (m, 1H), 4.14-4.25 (m, 2H), 2.41-2.47 (m, 2H), 1.98-2.08 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 470.1.

Example 12

8-chloro-N-(4-chloro-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide

(191) ##STR00079##

(192) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 200 mg, 890 ?mol) in DCM (20 mL) was added 4-chloro-2-(trifluoromethyl)aniline (209 mg, 1.07 mmol), DIPEA (230 mg, 1.78 mmol) and HATU (760 mg, 2 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-N-(4-chloro-2-(trifluoromethyl)phenyl)-4-oxo-chromene-2-carboxamide (60 mg, 16.8%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.24-10.30 (m, 1H), 8.01-8.12 (m, 2H), 7.94-7.96 (m, 1H), 7.87-7.92 (m, 2H), 7.53-7.60 (m, 1H), 7.00-7.08 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 402.1.

Example 13

6,8-dichloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide

(193) ##STR00080##

(194) To a solution of 6,8-dichloro-4-oxo-chromene-2-carboxylic acid (Int-2, 200 mg, 772 ?mol) in DCM (20 mL) was added 4-chloro-2-methylaniline (175 mg, 1.24 mmol), DIPEA (160 mg, 1.24 mmol) and HATU (440 mg, 1.16 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 6,8-dichloro-N-(4-chloro-2-methylphenyl)-4-oxo-chromene-2-carboxamide (10 mg, 3.39%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.04-10.14 (m, 1H), 8.24-8.34 (m, 1H), 7.95-8.00 (m, 1H), 7.57-7.66 (m, 1H), 7.40-7.47 (m, 1H), 7.30-7.39 (m, 1H), 7.04-7.12 (m, 1H), 2.31 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 382.1.

Example 14

8-Chloro-2-(6-methoxy-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one

(195) ##STR00081##

(196) A solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 50 mg, 0.22 mmol), 6-methoxy-1,2,3,4-tetrahydroisoquinoline (54.5 mg, 0.33 mmol), HATU (169 mg, 0.45 mmol) and TEA (89.9 mg, 0.89 mmol) in DCM (2 mL) was stirred at room temperature for 10 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-(6-methoxy-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one (10 mg, 12.1%) as yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? 8.00-8.07 (m, 2H), 7.54 (t, 7=7.89 Hz, 1H), 7.00-7.23 (m, 1H), 6.67-6.85 (m, 3H), 4.66-4.84 (m, 2H), 3.81 (t, 7=5.81 Hz, 2H), 3.67-3.78 (m, 3H), 2.79-3.05 (m, 2H). MS obsd. (ESI+) [(M+H)+]: 370.1.

Example 15

8-chloro-4-oxo-N-(o-tolyl)-chromene-2-carboxamide

(197) ##STR00082##

(198) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (100 mg, 445 ?mol) in DCM (20 mL) was added o-toluidine (47.7 mg, 445 ?mol), DIPEA (92.1 mg, 712 ?mol) and HATU (254 mg, 668 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-4-oxo-N-(o-tolyl)-chromene-2-carboxamide (5 mg, 3.58%) as a light yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 9.93-9.99 (m, 1H), 8.02-8.12 (m, 2H), 7.61-7.68 (m, 1H), 7.53-7.59 (m, 1H), 7.17-7.38 (m, 3H), 7.03-7.08 (m, 1H), 2.38 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 314.1.

Example 16

8-Chloro-2-(7-chloro-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one

(199) ##STR00083##

(200) A solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 50 mg, 0.22 mmol), 7-chloro-1,2,3,4-tetrahydroisoquinoline (56 mg, 0.33 mmol), HATU (169 mg, 0.44 mmol) and TEA (89.9 mg, 0.89 mmol) in DCM (2 mL) was stirred at room temperature for 10 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-Chloro-2-(7-chloro-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one (10 mg, 12%) as yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? 7.96-8.10 (m, 2H), 7.54 (t, 7=7.89 Hz, 1H), 7.18-7.46 (m, 3H), 6.66-6.80 (m, 1H), 4.73-4.94 (m, 2H), 3.74-3.91 (m, 2H), 2.84-3.01 (m, 2H). MS obsd. (ESI+) [(M+H)+]: 374.2.

Example 17

2-(6-bromo-1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-8-chloro-chromen-4-one

(201) ##STR00084##

(202) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 150 mg, 668 ?mol) in DCM (20 mL) was added 6-bromo-1,2,3,4-tetrahydroisoquinoline (212 mg, 1 mmol), DIPEA (138 mg, 1.07 mmol) and HATU (381 mg, 1 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-(6-bromo-1,2,3,4-tetrahydroisoquinoline-2-carbonyl)-8-chloro-chromen-4-one (24 mg, 8.58%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.99-8.06 (m, 2H), 7.51-7.58 (m, 1H), 7.41-7.51 (m, 2H), 7.25-7.30 (m, 1H), 6.72-6.76 (m, 1H), 4.71-4.88 (m, 2H), 3.77-3.87 (m, 2H), 2.88-3.03 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 418.1 & 420.1.

Example 18

4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoic Acid

(203) ##STR00085##

Step 1: Preparation of methyl 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoate

(204) ##STR00086##

(205) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 250 mg, 1.11 mmol) in DCM (20 mL) was added methyl 4-amino-3-methylbenzoate (184 mg, 1.11 mmol), DIPEA (230 mg, 1.78 mmol) and HATU (635 mg, 1.67 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1-1:5) to give methyl 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoate (110 mg, 26.6%) as a yellow foam. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 372.1.

Step 2: Preparation of 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoic Acid

(206) ##STR00087##

(207) To a solution of methyl 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoate (150 mg, 403 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by preparative HPLC to give 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoic acid (20 mg, 13.9%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.75-13.08 (m, 1H), 9.87-10.02 (m, 1H), 8.07-8.13 (m, 1H), 8.02-8.07 (m, 1H), 7.81-7.93 (m, 3H), 7.52-7.60 (m, 1H), 7.05-7.09 (m, 1H), 2.42 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.1

Example 19

2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetic Acid

(208) ##STR00088##

Step 1: Preparation of ethyl 2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetate

(209) ##STR00089##

(210) To a solution of 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (170 mg, 516 ?mol), ethyl 2-(2-(tosyloxy)ethoxy)acetate (187 mg, 619 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (143 mg, 1.03 mmol) at room temperature and the resulting mixture was then stirred at 50? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give ethyl 2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetate (100 mg, 42.2%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 460.1.

Step 2: Preparation of 2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetic Acid

(211) ##STR00090##

(212) To a solution of ethyl 2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetate (100 mg, 217 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 2-(2-(4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylphenoxy)ethoxy)acetic acid (7 mg, 7.45%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.38-12.96 (m, 1H), 9.86-10.01 (m, 1H), 7.98-8.14 (m, 2H), 7.52-7.63 (m, 1H), 7.40-7.49 (m, 1H), 7.00-7.12 (m, 1H), 6.90-6.95 (m, 1H), 6.74-6.90 (m, 1H), 4.01-4.11 (m, 4H), 3.76-3.89 (m, 2H), 2.28 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 432.1.

Example 20

2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetic Acid

(213) ##STR00091##

Step 1: Preparation of tert-butyl 2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetate

(214) ##STR00092##

(215) To a solution of 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (150 mg, 428 ?mol), tert-butyl 2-bromoacetate (83.6 mg, 428 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (148 mg, 1.07 mmol) at room temperature and the resulting mixture was then stirred at 50? C. for 1 hour. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give tert-butyl 2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetate (100 mg, 50.3%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 464.1.

Step 2: Preparation of 2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetic Acid

(216) ##STR00093##

(217) To a solution of tert-butyl 2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetate (100 mg, 215 ?mol) in DCM (4 mL) was added trifluoroacetic acid (5 mL, 64.9 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)acetic acid (20 mg, 22.7%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 13.16-13.43 (m, 1H), 9.76-9.83 (m, 1H), 8.23-8.32 (m, 1H), 8.06-8.13 (m, 1H), 8.00-8.06 (m, 1H), 7.52-7.62 (m, 1H), 7.32-7.39 (m, 1H), 7.12-7.22 (m, 1H), 7.03 (s, 1H), 4.99 (s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 408.1.

Example 21

Methyl 3-(8-chloro-4-oxo-chromene-2-carboxamido)-4-methylbenzoate

(218) ##STR00094##

(219) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 250 mg, 1.11 mmol) in DCM (20 mL) was added methyl 3-amino-4-methylbenzoate (184 mg, 1.11 mmol), DIPEA (230 mg, 1.78 mmol) and HATU (635 mg, 1.67 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 3-(8-chloro-4-oxo-chromene-2-carboxamido)-4-methylbenzoate (190 mg, 45.9%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.05-10.15 (m, 1H), 8.22-8.34 (m, 1H), 8.00-8.15 (m, 2H), 7.75-7.83 (m, 1H), 7.52-7.61 (m, 1H), 7.46-7.52 (m, 1H), 7.01-7.14 (m, 1H), 3.90 (s, 3H), 2.43 (s, 3H) MS obsd. (ESI.sup.+) [(M+H).sup.+]: 372.1.

Example 22

2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic Acid

(220) ##STR00095##

Step 1: Preparation of 6,8-dichloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide

(221) ##STR00096##

(222) To a solution of 6,8-dichloro-4-oxo-chromene-2-carboxylic acid (Int-2, 1.3 g, 5.02 mmol) in DCM (20 mL) was added 4-chloro-2-methoxyaniline (949 mg, 6.02 mmol), DIPEA (1.3 g, 10 mmol) and HATU (2.6 g, 7 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1-1:1) to give 6,8-dichloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.6 g, 80%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 398.1.

Step 2: Preparation of 6,8-dichloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide

(223) ##STR00097##

(224) To a solution of 6,8-dichloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.6 g, 4.01 mmol) in DCM (30 mL) was added BBr.sub.3 (1 M solution in DCM, 15 mL, 15 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 6,8-dichloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (1 g, 64.8%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 384.1.

Step 3: Preparation of ethyl 2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetate

(225) ##STR00098##

(226) To a solution of 6,8-dichloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (150 mg, 390 ?mol), ethyl 2-(2-(tosyloxy)ethoxy)acetate (142 mg, 468 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (108 mg, 782 ?mol) at room temperature and the resulting mixture was then stirred at 50? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give ethyl 2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetate (120 mg, 59.8%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 514.1.

Step 4: Preparation of 2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic Acid

(227) ##STR00099##

(228) To a solution of ethyl 2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetate (120 mg, 233 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 2-(2-(5-chloro-2-(6,8-dichloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic acid (30 mg, 26.4%) as a light yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.15-12.22 (m, 1H), 9.54-9.59 (m, 1H), 8.29-8.35 (m, 2H), 7.96-8.01 (m, 1H), 7.32-7.39 (m, 1H), 7.10-7.16 (m, 1H), 7.01-7.06 (m, 1H), 4.32-4.40 (m, 2H), 4.01-4.09 (m, 2H), 3.83-3.92 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 486.1.

Example 23

N-(5-bromo-4-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide

(229) ##STR00100##

(230) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 150 mg, 668 ?mol) in DCM (20 mL) was added 5-bromo-4-methylpyridin-2-amine (200 mg, 1.07 mmol), DIPEA (138 mg, 1.07 mmol) and HATU (381 mg, 1 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give N-(5-bromo-4-methylpyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide (70 mg, 26.6%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 10.71-10.81 (m, 1H), 8.49-8.58 (m, 1H), 8.16-8.23 (m, 1H), 8.07-8.12 (m, 1H), 8.01-8.07 (m, 1H), 7.46-7.61 (m, 1H), 7.06-7.14 (m, 1H), 2.45 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 393.1&395.1.

Example 24

2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic Acid

(231) ##STR00101##

Step 1: Preparation of 8-chloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide

(232) ##STR00102##

(233) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 1.0 g, 4.45 mmol) in DCM (20 mL) was added 4-chloro-2-methoxyaniline (842 mg, 5.34 mmol), DIPEA (1.15 g, 8.9 mmol) and HATU (2.6 g, 7 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel flash chromatography (elution with PE/EtOAc=10:1?1:3) to give 8-chloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.3 g, 80.2%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 364.1.

Step 2: Preparation of 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide

(234) ##STR00103##

(235) To a solution of 8-chloro-N-(4-chloro-2-methoxyphenyl)-4-oxo-chromene-2-carboxamide (1.2 g, 3.3 mmol) in DCM (30 mL) was added BBr.sub.3 (1 M solution in DCM, 25 mL, 25 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (800 mg, 69.3%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 350.1.

Step 3: Preparation of ethyl 2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetate

(236) ##STR00104##

(237) To a solution of 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (150 mg, 428 ?mol), ethyl 2-(2-(tosyloxy)ethoxy)acetate (155 mg, 514 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (118 mg, 857 ?mol) at room temperature and the resulting mixture was then stirred at 50? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give ethyl 2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetate (120 mg, 58.3%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 480.1.

Step 4: Preparation of 2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic Acid

(238) ##STR00105##

(239) To a solution of ethyl 2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetate (120 mg, 250 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours.

(240) After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 2-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)acetic acid (33 mg, 29.2%) as a light yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.50-12.68 (m, 1H), 9.43-9.59 (m, 1H), 8.27-8.38 (m, 1H), 8.06-8.12 (m, 1H), 7.98-8.05 (m, 1H), 7.49-7.66 (m, 1H), 7.30-7.41 (m, 1H), 7.09-7.16 (m, 1H), 6.94-7.06 (m, 1H), 4.28-4.43 (m, 2H), 4.08 (s, 2H), 3.84-3.93 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 452.1.

Example 25

Methyl 5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)benzoate

(241) ##STR00106##

(242) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 250 mg, 1.11 mmol) in DCM (20 mL) was added methyl 2-amino-5-chlorobenzoate (331 mg, 1.78 mmol), DIPEA (230 mg, 1.78 mmol) and HATU (635 mg, 1.67 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)benzoate (4 mg, 0.916%) as a white foam. .sup.1H NMR (DMSO-Y, 400 MHz): ? ppm 8.64-8.71 (m, 1H), 8.08-8.14 (m, 1H), 8.02-8.07 (m, 3H), 7.82-7.87 (m, 1H), 7.54-7.63 (m, 1H), 7.05-7.09 (m, 1H), 3.93 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 392.1.

Example 26

Methyl 4-((8-chloro-4-oxo-chromene-2-carboxamido)methyl)benzoate

(243) ##STR00107##

(244) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 100 mg, 445 ?mol) in DCM (10 mL) was added methyl 4-(aminomethyl)benzoate (147 mg, 890 ?mol), DIPEA (92.1 mg, 712 ?mol) and HATU (254 mg, 668 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 4-((8-chloro-4-oxo-chromene-2-carboxamido)methyl)benzoate (10 mg, 6.04%) as a white foam. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? ppm 9.31-9.40 (m, 1H), 7.99-8.09 (m, 2H), 7.89-7.98 (m, 2H), 7.46-7.61 (m, 3H), 6.90-7.02 (m, 1H), 4.54-4.69 (m, 2H), 3.85 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 372.1.

Example 27

Methyl 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoate

(245) ##STR00108##

(246) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 250 mg, 1.11 mmol) in DCM (10 mL) was added methyl 4-amino-3-methylbenzoate (184 mg, 1.11 mmol), DIPEA (230 mg, 1.78 mmol) and HATU (635 mg, 1.67 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 4-(8-chloro-4-oxo-chromene-2-carboxamido)-3-methylbenzoate (110 mg, 26.6%) as a light yellow foam. .sup.1H NMR (DMSO-<fc, 400 MHz): ? ppm 9.96-10.04 (m, 1H), 8.08-8.13 (m, 1H), 8.02-8.08 (m, 1H), 7.92-7.98 (m, 2H), 7.85-7.91 (m, 1H), 7.50-7.63 (m, 1H), 6.98-7.14 (m, 1H), 3.93 (s, 3H), 2.44 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 372.1.

Example 28

8-chloro-2-(8-chloro-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one

(247) ##STR00109##

(248) A solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 50 mg, 0.22 mmol), 8-chloro-1,2,3,4-tetrahydroisoquinoline (56 mg, 0.33 mmol), HATU (169 mg, 0.45 mmol,) and TEA (89.9 mg, 0.89 mmol) in DCM (2 mL) was stirred at room temperature for 10 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-(8-chloro-3,4-dihydro-1H-isoquinoline-2-carbonyl)chromen-4-one (10 mg, 12%) as a yellow foam. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? 8.04 (dt, 7=1.41, 7.24 Hz, 2H), 7.55 (t, 7=7.95 Hz, 1H), 7.19-7.42 (m, 3H), 6.70-6.83 (m, 1H), 4.73-4.92 (m, 2H), 3.76-3.96 (m, 2H), 2.88-3.09 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:374.1.

Example 29

N-(1-(4-bromophenyl)ethyl)-8-chloro-4-oxo-chromene-2-carboxamide

(249) ##STR00110##

(250) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 100 mg, 445 ?mol) in DCM (10 mL) was added 1-(4-bromophenyl)ethanamine (178 mg, 890 ?mol), DIPEA (92.1 mg, 712 ?mol) and HATU (254 mg, 668 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give N-(1-(4-bromophenyl)ethyl)-8-chloro-4-oxo-chromene-2-carboxamide (70 mg, 38.7%) as a white foam. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? ppm 9.10-9.25 (m, 1H), 8.03-8.08 (m, 1H), 7.98-8.02 (m, 1H), 7.49-7.59 (m, 3H), 7.35-7.43 (m, 2H), 6.94-7.00 (m, 1H), 5.04-5.15 (m, 1H), 1.44-1.54 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 406.1&408.1.

Example 30

8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide

(251) ##STR00111##

Step 1: Preparation of 8-chloro-N-(4-methoxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide

(252) ##STR00112##

(253) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 300 mg, 1.34 mmol) in DCM (10 mL) was added 4-methoxy-2-methylaniline (275 mg, 2 mmol), DIPEA (518 mg, 4.01 mmol) and HATU (762 mg, 2 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-N-(4-methoxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (400 mg, 87%) as a white foam. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 344.1.

Step 2: Preparation of 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide

(254) ##STR00113##

(255) To a solution of 8-chloro-N-(4-methoxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (400 mg, 1.16 mmol) in DCM (15 mL) was added BBr.sub.3 (1 M solution in DCM, 10 mL, 10 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and the solid was purified by preparative HPLC to give 8-chloro-N-(4-hydroxy-2-methylphenyl)-4-oxo-chromene-2-carboxamide (340 mg, 88.6%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? ppm 9.80-9.87 (m, 1H), 9.36-9.47 (m, 1H), 8.00-8.12 (m, 2H), 7.49-7.60 (m, 1H), 7.27-7.36 (m, 1H), 6.98-7.07 (m, 1H), 6.67-6.77 (m, 1H), 6.61-6.67 (m, 1H), 2.21 (s, 3H) MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.1.

Example 31

2-(4-bromoisoindoline-2-carbonyl)-8-chloro-chromen-4-one

(256) ##STR00114##

(257) A solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 50 mg, 0.22 mmol), 4-bromoisoindoline (66.1 mg, 0.33 mmol), HATU (169 mg, 0.45 mol) and TEA (89.9 mg, 0.89 mmol) in DCM (2 mL) was stirred at room temperature for 10 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by preparative HPLC to give 2-(4-bromoisoindoline-2-carbonyl)-8-chloro-chromen-4-one (10 mg, 11.1%) as yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? 8.00-8.14 (m, 2H), 7.52-7.62 (m, 2H), 7.37-7.49 (m, 1H), 7.26-7.35 (m, 1H), 6.89-7.00 (m, 1H), 5.35-5.53 (m, 2H), 4.81-5.08 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 404.1.

Example 32

N-(5-bromo-3-methoxypyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide

(258) ##STR00115##

(259) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 150 mg, 668 ?mol) in DCM (10 mL) was added 5-bromo-3-methoxypyridin-2-amine (217 mg, 1.07 mmol), DIPEA (138 mg, 1.07 mmol) and HATU (381 mg, 1 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give N-(5-bromo-3-methoxypyridin-2-yl)-8-chloro-4-oxo-chromene-2-carboxamide (5 mg, 1.83%) as a yellow foam. .sup.1H NMR (DMSO-<fc, 400 MHz): ? ppm 10.49-10.50 (m, 1H), 8.15-8.16 (m, 1H), 8.07-8.08 (m, 1H), 8.01-8.02 (m, 1H), 7.87-7.88 (m, 1H), 7.53-7.57 (m, 1H), 7.01-7.02 (m, 1H), 3.92 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 409.1&411.1.

Example 33

8-chloro-2-(7-nitro-3,4-dihydro-2H-quinoline-1-carbonyl)chromen-4-one

(260) ##STR00116##

(261) A solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 50 mg, 0.22 mmol), 7-nitro-1,2,3,4-tetrahydroquinoline (59.5 mg, 0.33 mmol), HATU (169 mg, 0.45 mmol) and TEA (89.9 mg, 0.89 mmol) in DCM (2 mL) was stirred at room temperature for 10 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-(7-nitro-3,4-dihydro-2H-quinoline-1-carbonyl)chromen-4-one (10 mg, 11.7%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? 8.15-8.54 (s, 1H), 7.89-8.04 (m, 3H), 7.57 (d, 7=8.44 Hz, 1H), 7.50 (t, 7=7.89 Hz, 1H), 6.90 (s, 1H), 3.84-3.98 (m, 2H), 2.99 (t, 7=6.54 Hz, 2H), 1.93-2.13 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:385.1.

Example 34

3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylic Acid

(262) ##STR00117##

Step 1: Preparation of methyl 3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylate

(263) ##STR00118##

(264) To a solution of 8-chloro-N-(4-chloro-2-hydroxyphenyl)-4-oxo-chromene-2-carboxamide (150 mg, 428 ?mol), methyl 3-(2-(tosyloxy)ethoxy)cyclobutane-1-carboxylate (169 mg, 514 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (118 mg, 857 ?mol) at room temperature and the resulting mixture was then stirred at 50? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylate (120 mg, 55.3%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 506.1.

Step 2: Preparation of 3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylic Acid

(265) ##STR00119##

(266) To a solution of methyl 3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylate (120 mg, 237 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (3 mL, 9 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 3-(2-(5-chloro-2-(8-chloro-4-oxo-chromene-2-carboxamido)phenoxy)ethoxy)cyclobutane-1-carboxylic acid (52 mg, 44.6%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.06-12.17 (m, 1H), 9.47-9.57 (m, 1H), 8.28-8.37 (m, 1H), 8.07-8.14 (m, 1H), 7.99-8.06 (m, 1H), 7.48-7.60 (m, 1H), 7.30-7.36 (m, 1H), 7.07-7.14 (m, 1H), 6.96-7.03 (m, 1H), 4.28-4.36 (m, 2H), 4.11-4.21 (m, 1H), 3.65-3.76 (m, 2H), 2.78-2.92 (m, 1H), 2.28-2.43 (m, 2H), 2.03-2.18 (m, 1H), 1.87-2.01 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 492.1.

Example 35

Ethyl 5-(8-chloro-4-oxo-chromene-2-carboxamido)-1,3,4-thiadiazole-2-carboxylate

(267) ##STR00120##

(268) To a solution of 8-chloro-4-oxo-chromene-2-carboxylic acid (Int-1, 120 mg, 534 ?mol) in DCM (10 mL) was added ethyl 5-amino-1,3,4-thiadiazole-2-carboxylate (187 mg, 1.07 mmol), DIPEA (110 mg, 855 ?mol) and HATU (305 mg, 801 ?mol) at room temperature and the resulting mixture was then stirred at room temperature for 18 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give ethyl 5-(8-chloro-4-oxo-chromene-2-carboxamido)-1,3,4-thiadiazole-2-carboxylate (50 mg, 24.6%) as a yellow foam. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? ppm 8.06-8.13 (m, 1H), 7.98-8.06 (m, 1H), 7.51-7.60 (m, 1H), 7.31-7.38 (m, 1H), 4.38-4.49 (m, 2H), 1.31-1.41 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 380.1.

Example 36

3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic Acid

(269) ##STR00121##

Step 1: Preparation of 8-chloro-2-(6-hydroxy-3,4-dihydro-1H-isoquinolin-2-yl)chromen-4-one

(270) ##STR00122##

(271) A solution of 8-chloro-2-(1,2,4-triazol-1-yl)chromen-4-one (50 mg, 202 ?mol), 1,2,3,4-tetrahydroisoquinolin-6-ol; Hydrobromide (Int-9, 92.9 mg, 404 ?mol) and K.sub.2CO.sub.3 (69.8 mg, 505 ?mol) in DMF (1 mL) was stirred at 80? C. for 1 hour. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 8-chloro-2-(6-hydroxy-3,4-dihydro-1H-isoquinolin-2-yl)chromen-4-one (61 mg, 91%).

Step 2: Preparation of methyl 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylate

(272) ##STR00123##

(273) To a solution of 8-chloro-2-(6-hydroxy-3,4-dihydro-1H-isoquinolin-2-yl)chromen-4-one (26 mg, 79.3 ?mol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 26 mg, 79.3 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (11 mg, 79.3 ?mol) at room temperature and the resulting mixture was then stirred at 90? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylate (38 mg) as a yellow oil, which was used in next step directly without further purification.

Step 3: Preparation of 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic Acid

(274) ##STR00124##

(275) LiOH (8.91 mg, 372 ?mol) was added to a solution of methyl 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylate (60 mg, 124 ?mol) in MeOH/H.sub.2O (1 mL/0.5 mL) and the resulting mixture was stirred at room temperature for 1 hour. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and then concentrated in vacuo. The residue was purified by preparative HPLC to give 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic acid (25 mg, 41%) as a white solid. .sup.1H NMR (DMSO-76, 400 MHz): ? ppm 7.80-7.90 (m, 2H), 7.39 (t, 7=7.9 Hz, 1H), 7.19-7.22 (m, 1H), 6.82-6.87 (m, 2H), 5.59 (s, 1H), 4.64 (s, 2H), 4.02-4.08 (m, 2H), 3.89-3.96 (m, 1H), 3.80 (t, 7=5.9 Hz, 2H), 3.43-3.67 (m, 2H), 2.96 (t, 7=5.9 Hz, 2H), 2.52-2.63 (m, 1H), 2.35-2.47 (m, 2H), 1.93-2.02 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 470.

Example 37

3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)isoindolin-5-yl]oxyethoxy]cyclobutanecarboxylic Acid

(276) ##STR00125##

Step 1: Preparation of 8-chloro-2-(5-hydroxyisoindolin-2-yl)chromen-4-one

(277) ##STR00126##

(278) A solution of 8-chloro-2-(1,2,4-triazol-1-yl)chromen-4-one (60 mg, 242 ?mol), isoindolin-5-ol; Hydrobromide (Int-10, 62.8 mg, 291 ?mol) and K.sub.2CO.sub.3 (83.7 mg, 606 ?mol) in DMF (1 mL) was stirred at 80? C. for 1 hour. The mixture was concentrated in vacuo and purified by flash chromatography (elution with DCM/MeOH=100:1-10:1) to give 8-chloro-2-(5-hydroxyisoindolin-2-yl)chromen-4-one (62 mg, 79%) as a yellow oil.

Step 2: Preparation of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)isoindolin-5-yl]oxyethoxy]cyclobutanecarboxylate

(279) ##STR00127##

(280) To a solution of 8-chloro-2-(5-hydroxyisoindolin-2-yl)chromen-4-one (76 mg, 242 ?mol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 79.5 mg, 242 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (33.5 mg, 242 ?mol) at room temperature and the resulting mixture was then stirred at 90? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)isoindolin-5-yl]oxyethoxy]cyclobutanecarboxylate (110 mg) as a yellow oil, which was used in next step directly without further purification.

Step 3: Preparation of 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)isoindolin-5-yl]oxyethoxy]cyclobutanecarboxylic Acid

(281) ##STR00128##

(282) LiOH (10.7 mg, 447 ?mol) was added to a solution of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)isoindolin-5-yl]oxyethoxy]cyclobutanecarboxylate (70 mg, 149 ?mol) in MeOH/H.sub.2O (1 mL/0.5 mL) and the resulting mixture was stirred at room temperature for 1 hour. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and then concentrated in vacuo. The residue was purified by preparative HPLC to give 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)isoindolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid (45 mg, 66%). .sup.1H NMR (DMSO-<fc, 400 MHz): ? ppm 7.91 (dd, 7=7.8, 1.6 Hz, 1H), 7.84 (dd, 7=7.9, 1.5 Hz, 1H), 7.40 (t, 7=7.8 Hz, 1H), 7.34 (br d, 7=8.2 Hz, 1H), 7.04 (br s, 1H), 6.94 (dd, 7=8.4, 2.3 Hz, 1H), 5.33 (s, 1H), 4.58-5.11 (m, 4H), 4.03-4.11 (m, 2H), 3.77-4.00 (m, 1H), 3.42-3.70 (m, 2H), 2.52-2.63 (m, 1H), 2.35-2.47 (m, 2H), 1.92-2.04 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:456.

Example 38

3-((4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)methyl)benzoic Acid

(283) ##STR00129##

Step 1: Preparation of methyl 3-((4-acetylpiperazin-1-yl)methyl)benzoate

(284) ##STR00130##

(285) To a solution of 1-(piperazin-1-yl)ethan-1-one (2.56 g, 20.0 mmol) and K.sub.2CO.sub.3 (5.53 g, 40.0 mmol) in THF (50 mL) was added methyl 3-(bromomethyl)benzoate (3.67 g, 16.0 mmol) at room temperature and the resulting mixture was then stirred at 60? C. for 16 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column on silica gel (PE:EA=5:1 to 1:1) to give methyl 3-((4-acetylpiperazin-1-yl)methyl)benzoate (1.2 g, 21.7%) as a yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 277.0.

Step 2: Preparation of methyl 3-((4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)methyl)benzoate

(286) ##STR00131##

(287) To a solution of methyl 3-((4-acetylpiperazin-1-yl)methyl)benzoate (553 mg, 2.0 mmol) in DCM (10.0 mL) was added POCl.sub.3 (675 mg, 4.4 mmol) at 0? C. and then the mixture was stirred at 25? C. for 1 hour. Then 3-chloro-2-hydroxybenzoic acid (345 mg, 2.0 mmol) was added at 0? C. and the resulting mixture was then stirred at 0? C. for 1 hour. Then the resulting mixture was stirred at 60? C. for another 14 hours. The mixture was concentrated in vacuo and the residue was dissolved in DCM (20.0 mL), NaOAc (1.31 g, 16.0 mmol) was added to the mixture and the mixture was stirred at 60? C. for 4 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column on silica gel (DCM:MeOH=200:1 to 25:1) to give methyl 3-((4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)methyl)benzoate (400 mg, 48.4%) as a yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 413.1.

Step 3: Preparation of 3-((4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)methyl)benzoic Acid

(288) ##STR00132##

(289) To a solution of methyl 3-((4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)methyl)benzoate (206 mg, 0.5 mmol) in mixed solvent of TEA/DMF (1.0 mL/1.0 mL) was added LiCl (424 mg, 10.0 mmol). Then the mixture was stirred at 100? C. for 16 hours. After the reaction was completed, the mixture was adjusted to pH?5 by addition of AcOH. The resulting mixture was then concentrated in vacuo, the residue was purified by preparative HPLC to give 3-((4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)methyl)benzoic acid (16 mg, 8.02%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.92-13.32 (m, 1H), 7.85 (dd, 7=7.78, 17.32 Hz, 4H), 7.48-7.74 (m, 2H), 7.39 (t, 7=7.78 Hz, 1H), 5.65 (br. s., 1H), 3.43-4.67 (m, 8H), 2.99-3.29 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 399.1.

Example 39

2-(2-((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetic Acid

(290) ##STR00133##

Step 1: Preparation of tert-butyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate

(291) ##STR00134##

(292) To a solution of tert-butyl 3-hydroxy-8-azabicyclo[3.2.1]octane-8-carboxylate (4.0 g, 17.6 mmol) in ACN (20 mL) was added 2-iodoxybenzoic acid (9.86 g, 35.2 mmol) at room temperature and the resulting mixture was stirred at 50? C. for 4 hours. After the reaction was completed, the mixture was filtered and the liquid was concentrated in vacuo to give tert-butyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (3.0 g, 63.1%) as white solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 170.1&226.1.

Step 2: Preparation of 8-azabicyclo[3.2.1]octan-3-one

(293) ##STR00135##

(294) A solution of tert-butyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (3.0 g, 13.32 mmol) in dioxane (4 M HCl solution in Dioxane, 10 mL, 40 mmol) was stirred at 25? C. for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo to give 8-azabicyclo[3.2.1]octan-3-one (1.6 g, 100%) as white solid, which was used in next step directly without further purification.

Step 3: Preparation of benzyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate

(295) ##STR00136##

(296) To a solution of tert-butyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (1.33 g, 10.59 mmol) and triethylamine (5.9 mL, 42.34 mmol) in DCM (10.0 mL) was added benzyl chloroformate (1.49 mL, 10.59 mmol) at 0? C. and the resulting mixture was then stirred at 0? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give benzyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (1.9 g, 69.3%) as yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 260.1.

Step 4: Preparation of ethyl 2-(2-((trimethylsilyl)oxy)ethoxy)acetate

(297) ##STR00137##

(298) To a solution of ethyl 2-(2-hydroxyethoxy)acetate (2.0 g, 13.5 mmol) in DCM (20.0 mL) was added triethylamine (2.82 mL, 20.25 mmol) and trimethylchlorosilane (2.06 mL, 16.2 mmol) at 0? C. and the resulting mixture was then stirred at 25? C. for 3 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column (PE:EtOAc=50:1-20:1) to give ethyl 2-(2-((trimethylsilyl)oxy)ethoxy)acetate (1.9 g, 64%) as light yellow oil.

Step 5: Preparation of benzyl 3-(2-(2-ethoxy-2-oxoethoxy)ethoxy)-8-azabicyclo[3.2.1]octane-8-carboxylate

(299) ##STR00138##

(300) To a solution of benzyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (879.6 mg, 3.39 mmol) in DCM (2.0 mL) was added ethyl 2-(2-((trimethylsilyl)oxy)ethoxy)acetate (700.0 mg, 3.39 mmol) and trimethylsilyl trifluoromethanesulfonate (376.99 mg, 1.7 mmol) at ?78? C. and the resulting mixture was stirred at ?78? C. for 2 hours. Trimethylsilane (433.9 mg, 3.73 mmol) was then added to the mixture at ?78? C. and the resulting mixture was stirred at 25? C. for 1 hour. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography (PE:EA=20:1) to give benzyl 3-(2-(2-ethoxy-2-oxoethoxy)ethoxy)-8-azabicyclo[3.2.1]octane-8-carboxylate (359 mg, 11.9%) as light yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 392.1.

Step 6: Preparation of ethyl 2-(2-((8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetate

(301) ##STR00139##

(302) A solution of benzyl 3-(2-(2-ethoxy-2-oxoethoxy)ethoxy)-8-azabicyclo[3.2.1]octane-8-carboxylate (398.0 mg, 1.05 mmol) and Pd/C (113 mg, 0.11 mmol) in EtOH (4.0 mL) was stirred at 25? C. under hydrogen balloon for 12 hours. After the reaction was completed, the mixture was filtered and the liquid was concentrated in vacuo to give ethyl 2-(2-((8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetate (169 mg, 65.7%) as light yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 258.1.

Step 7: Preparation of ethyl 2-(2-((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetate

(303) ##STR00140##

(304) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 150 mg, 0.61 mmol), ethyl 2-(2-((8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetate (171.46 mg, 0.67 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (251 mg, 1.82 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give ethyl 2-(2-((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetate (70 mg, 16.2%) as a yellow foam. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.1.

Step 8: Preparation of 2-(2-((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetic Acid

(305) ##STR00141##

(306) To a solution of ethyl 2-(2-((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetate (70 mg, 160 ?mol) in the mixed solvent of THF (10 mL) and H.sub.2O (3 mL) was added LiOH*H.sub.2O (35.0 mg, 0.86 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 12 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-(2-((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)ethoxy)acetic acid (40 mg, 61.5%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.600 (s, 1H), 7.878-7.794 (m, 2H), 7.385-7.374 (m, 1H), 5.542-5.532 (m, 1H), 4.464-4.462 (m, 2H), 4.083-4.072 (m, 2H), 3.620-3.617 (m, 2H), 3.538-3.536 (m, 3H), 2.230-2.228 (m, 2H), 2.000-1.942 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 408.1.

Example 40

3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-1-methyl-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic Acid

(307) ##STR00142##

Step 1: Preparation of methyl 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-1-methyl-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylate

(308) ##STR00143##

(309) 60% NaH (58.5 mg, 1.46 mmol) was added to a solution of 8-chloro-2-(6-hydroxy-1-methyl-3,4-dihydro-1H-isoquinolin-2-yl)chromen-4-one (250 mg, 731 ?mol) in DMF (3 mL) at room temperature and the resulting mixture was stirred at room temperature for 30 mins. Methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 480 mg, 1.46 mmol) was added and the resulting mixture was stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was filtered and concentrated in vacuo to give methyl 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-1-methyl-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylate (310 mg) as a yellow oil, which was used in next step without further purification.

Step 2: Preparation of 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-1-methyl-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic Acid

(310) ##STR00144##

(311) A solution of methyl 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-1-methyl-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylate (100 mg, 201 ?mol) and LiOH (24 mg, 1 mmol) in THF (3 mL)/H.sub.2O (1 mL) was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and concentrated in vacuo. The residue was purified by preparative HPLC to give 3-[2-[[2-(8-chloro-4-oxo-chromen-2-yl)-1-methyl-3,4-dihydro-1H-isoquinolin-6-yl]oxy]ethoxy]cyclobutanecarboxylic acid (38 mg, 39%) as a white solid. .sup.1H NMR (DMSO-76, 400 MHz): ? ppm 12.15 (br s, 1H), 7.87 (dd, 7=7.8, 1.6 Hz, 1H), 7.82 (dd, 7=7.9, 1.5 Hz, 1H), 7.39 (t, 7=7.8 Hz, 1H), 7.19 (d, 7=8.3 Hz, 1H), 6.82 (s, 1H), 6.83 (d, 7=10.1 Hz, 1H), 5.64 (s, 1H), 5.27 (br d, 7=6.5 Hz, 1H), 4.15 (quin, 7=6.7 Hz, 1H), 3.89-4.08 (m, 3H), 3.47-3.67 (m, 3H), 2.96 (t, 7=5.9 Hz, 2H), 2.53-2.76 (m, 1H), 2.32-2.46 (m, 2H), 2.10-2.18 (m, 1H), 1.93-2.02 (m, 1H), 1.51 (d, 7=6.6 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 484.

Example 41

Methyl 3-(((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)methyl)benzoate

(312) ##STR00145##

Step 1: Preparation of tert-butyl 3-((3-(methoxycarbonyl)benzyl)oxy)-8-azabicyclo[3.2.1]octane-8-carboxylate

(313) ##STR00146##

(314) To a solution of tert-butyl 3-hydroxy-8-azabicyclo[3.2.1]octane-8-carboxylate (1.0 g, 4.4 mmol) in DMF (10 mL) was added 60% sodium hydride (879.81 mg, 22 mmol) at 0? C. and the resulting mixture was stirred at 0? C. for 30 mins. Methyl 3-(chloromethyl)benzoate (974.68 mg, 5.28 mmol) was then added to the mixture at 0? C. and the resulting mixture was stirred at 25? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica (PE/Ethyl acetate=20:1-5:1) to give tert-butyl 3-((3-(methoxycarbonyl)benzyl)oxy)-8-azabicyclo[3.2.1]octane-8-carboxylate (800 mg, 48.4%) as light yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 376.1&320.1.

Step 2: Preparation of methyl 3-(((8-azabicyclo[3.2.1]octan-3-yl)oxy)methyl)benzoate

(315) ##STR00147##

(316) A solution of tert-butyl 3-((3-(methoxycarbonyl)benzyl)oxy)-8-azabicyclo[3.2.1]octane-8-carboxylate (800 mg, 2.13 mmol) in dioxane (4 M HCl solution in Dioxane, 4 mL, 16 mmol) was stirred at 25? C. for 12 hours. After the reaction was completed, the mixture was concentrated in vacuo to give methyl 3-(((8-azabicyclo[3.2.1]octan-3-yl)oxy)methyl)benzoate (600 mg, quant.) as a white solid, which was used in next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 276.1.

Step 3: Preparation of methyl 3-(((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)methyl)benzoate

(317) ##STR00148##

(318) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 431 mg, 1.74 mmol), methyl 3-(((8-azabicyclo[3.2.1]octan-3-yl)oxy)methyl)benzoate (400 mg, 1.45 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (602.3 mg, 4.36 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 3-(((8-(8-chloro-4-oxo-chromen-2-yl)-8-azabicyclo[3.2.1]octan-3-yl)oxy)methyl)benzoate (20 mg, 3.2%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.96-7.87 (m, 3H), 7.82 (dd, 7=1.5, 7.9 Hz, 1H), 7.66-7.61 (m, 1H), 7.60-7.54 (m, 1H), 7.39 (t, 7=7.9 Hz, 1H), 5.60 (s, 1H), 5.26 (br s, 1H), 4.57 (br s, 2H), 4.52 (s, 2H), 3.34 (s, 3H), 2.36-2.31 (m, 2H), 2.31-2.24 (m, 2H), 2.21-2.12 (m, 2H), 1.95 (br d, 7=15.2 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 454.1.

Example 42

8-chloro-3-iodo-2-((4-methoxybenzyl)amino)-chromen-4-one

(319) ##STR00149##

(320) To a solution of 8-chloro-3-iodo-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-4, 187 mg, 500 ?mol), (4-methoxyphenyl)methanamine (137 mg, 1 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (143 mg, 1.03 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-3-iodo-2-((4-methoxybenzyl)amino)-chromen-4-one (10 mg, 4.5%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 8.30-8.43 (m, 1H), 7.86-7.95 (m, 1H), 7.78-7.86 (m, 1H), 7.33-7.43 (m, 3H), 6.87-6.94 (m, 2H), 4.55-4.64 (m, 2H), 3.74 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 442.1.

Example 43

2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxyisoindolin-1-one

(321) ##STR00150##

(322) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 700 mg, 2.83 mmol), 5-methoxyisoindolin-1-one (553 mg, 3.39 mmol) in DMF (10 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxyisoindolin-1-one (200 mg, 20.7%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.95-8.02 (m, 2H), 7.78-7.84 (m, 1H), 7.47-7.54 (m, 1H), 7.36-7.41 (m, 1H), 7.12-7.18 (m, 2H), 5.21 (s, 2H), 3.94 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 342.1.

Example 44

2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxy-3,4-dihydroisoquinolin-1-one

(323) ##STR00151##

(324) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 800 mg, 3.23 mmol), 6-methoxy-3,4-dihydroisoquinolin-1-one (687 mg, 3.88 mmol) in DMF (10 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxy-3,4-dihydroisoquinolin-1-one (200 mg, 17.4%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.93-8.03 (m, 3H), 7.46-7.58 (m, 1H), 6.94-7.04 (m, 2H), 6.77-6.81 (m, 1H), 4.19-4.28 (m, 2H), 3.86 (s, 3H), 3.13-3.20 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 356.1.

Example 45

8-chloro-6-fluoro-2-(4-phenylpiperazin-1-yl)-chromen-4-one

(325) ##STR00152##

(326) To a solution of 8-chloro-6-fluoro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-6, 300 mg, 1.14 mmol), 1-phenylpiperazine (916 mg, 5.65 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (602.3 mg, 4.36 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-6-fluoro-2-(4-phenylpiperazin-1-yl)-chromen-4-one (36 mg, 8.58%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.92 (dd, 7=8.16, 3.01 Hz, 1H), 7.60 (dd, 7=8.16, 3.14 Hz, 1H), 7.26 (t, 7=7.97 Hz, 2H), 7.01 (d, 7=8.03 Hz, 2H), 6.84 (t, 7=7.05 Hz, 1H), 5.69 (s, 1H), 3.71-3.79 (m, 4H), 2.52-2.56 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 359.1.

Example 46

4-benzyloxy-1-(8-chloro-3-iodo-4-oxo-chromen-2-yl)pyridin-2-one

(327) ##STR00153##

(328) To a solution of 8-chloro-3-iodo-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-4, 187 mg, 500 ?mol), 4-(benzyloxy)pyridin-2-one (150 mg, 0.746 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (143 mg, 1.03 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 4-benzyloxy-1-(8-chloro-3-iodo-4-oxo-chromen-2-yl)pyridin-2-one (12 mg, 4.8%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 8.07-8.13 (m, 2H), 7.74-7.79 (m, 1H), 7.58-7.65 (m, 1H), 7.36-7.52 (m, 5H), 6.31-6.38 (m, 1H), 6.07-6.14 (m, 1H), 5.21 (s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 506.1.

Example 47

8-chloro-2-(6-hydroxy-2-azaspiro[3.3]heptan-2-yl)chromen-4-one

(329) ##STR00154##

(330) A solution of 8-chloro-2-(1,2,4-triazol-4-yl)-chromen-4-one (116 mg, 0.47 mmol), 2-azaspiro[3.3]heptan-6-ol (53 mg, 0.47 mmol) and K.sub.2CO.sub.3 (193 mg, 1.41 mmol) in DMF (10 mL) was stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-(6-hydroxy-2-azaspiro[3.3]heptan-2-yl)-chromen-4-one (50 mg, 36.6%) as yellow solid/H NMR (DMSO-76, 400 MHz): ? 7.79 (dd, 7=1.47, 7.83 Hz, 1H), 7.71 (dd, 7=1.34, 7.83 Hz, 1H), 7.29 (t, 7=7.83 Hz, 1H), 5.03 (d, 7=5.99 Hz, 1H), 4.97-5.00 (m, 1H), 4.08 (s, 2H), 4.02 (s, 2H), 3.89-3.99 (m, 1H), 2.47 (mm, 2H), 1.93-2.02 (m, 2H). MS obsd. (ESI+) [(M+H)+]: 292.0.

Example 48

8-chloro-2-((4-methoxybenzyl)(methyl)amino)-chromen-4-one

(331) ##STR00155##

(332) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 700 mg, 2.83 mmol), l-(4-methoxyphenyl)-N-methylmethanamine (513 mg, 3.39 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-((4-methoxybenzyl)(methyl)amino)-chromen-4-one (600 mg, 64.4%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.85-7.92 (m, 1H), 7.77-7.85 (m, 1H), 7.35-7.45 (m, 1H), 7.26-7.34 (m, 2H), 6.89-6.98 (m, 2H), 5.39-5.45 (m, 1H), 4.74 (s, 2H), 3.73 (s, 3H), 3.14 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.1.

Example 49

8-chloro-6-fluoro-2-(4-phenylpiperidin-1-yl)-chromen-4-one

(333) ##STR00156##

(334) To a solution of 8-chloro-6-fluoro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-6, 300 mg, 1.14 mmol), 4-phenylpiperidine (910 mg, 5.65 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (602.3 mg, 4.36 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-6-fluoro-2-(4-phenylpiperidin-1-yl)-chromen-4-one (31 mg, 7.65%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.90 (dd, 7=8.16, 3.01 Hz, 1H), 7.59 (dd, 7=8.22, 3.07 Hz, 1H), 7.26-7.34 (m, 4H), 7.21 (s, 1H), 5.68 (s, 1H), 4.28 (br d, 7=13.55 Hz, 2H), 3.02-3.17 (m, 2H), 2.84-2.94 (m, 1H), 1.92 (br d, 7=11.04 Hz, 2H), 1.76 (br d, 7=3.76 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.1.

Example 50

3-(2-(4-(1-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylic Acid

(335) ##STR00157##

Step 1: Preparation of tert-butyl 4-(4-hydroxyphenyl)piperidine-1-carboxylate

(336) ##STR00158##

(337) To a solution of 4-(piperidin-4-yl)phenol (2 g, 11.28 mmol), triethylamine (2.36 mL, 16.93 mmol) in DCM (20 mL) was added di-t-butyldicarbonate (3 g, 13.54 mmol) at 10? C. and the resulting mixture was then stirred at 10? C. for 15 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give tert-butyl 4-(4-hydroxyphenyl)piperidine-1-carboxylate (2.5 g, 78.1%) as a white solid, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 278.1.

Step 2: Preparation of tert-butyl 4-(4-(2-(3-(methoxycarbonyl)cyclobutoxy)ethoxy)phenyl)piperidine-1-carboxylate

(338) ##STR00159##

(339) To a solution of tert-butyl 4-(4-hydroxyphenyl)piperidine-1-carboxylate (330 mg, 1.19 mmol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 560 mg, 1.71 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (700 mg, 5.06 mmol) at room temperature and the resulting mixture was then stirred at 70? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give tert-butyl 4-(4-(2-(3-(methoxycarbonyl)cyclobutoxy)ethoxy)phenyl)piperidine-1-carboxylate (350 mg, 20.3%) as a yellow oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 434.1.

Step 3: Preparation of methyl 3-(2-(4-(piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylate

(340) ##STR00160##

(341) A solution of tert-butyl 4-(4-(2-(3-(methoxycarbonyl)cyclobutoxy)ethoxy)phenyl)piperidine-1-carboxylate (700 mg, 1.61 mmol) in dioxane (4 M HCl solution in Dioxane, 10 mL, 40 mmol) was stirred at 25? C. for 12 hours. After the reaction was completed, the mixture was concentrated in vacuo to give methyl 3-(2-(4-(piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylate (150 mg, 25%) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 334.1.

Step 4: Preparation of methyl 3-(2-(4-(1-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylate

(342) ##STR00161##

(343) To a solution of 8-chloro-6-fluoro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-6, 179.3 mg, 0.67 mmol), methyl 3-(2-(4-(piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylate (150 mg, 0.45 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (124 mg, 0.9 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 5 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-(4-(1-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylate (238 mg, quant.) as a yellow foam, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 530.1.

Step 5: Preparation of 3-(2-(4-(1-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylic Acid

(344) ##STR00162##

(345) To a solution of methyl 3-(2-(4-(1-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylate (238 mg, 0.45 mmol) in the mixed solvent of THF (10 mL) and H.sub.2O (3 mL) was added LiOH*H.sub.2O (35.0 mg, 0.86 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 12 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and then concentrated in vacuo. The residue was purified by preparative HPLC to give 3-(2-(4-(1-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)piperidin-4-yl)phenoxy)ethoxy)cyclobutane-1-carboxylic acid (18 mg, 7.5%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.30 (s, 1H), 7.91 (dd, 7=3.0, 8.2 Hz, 1H), 7.59 (dd, 7=3.0, 8.2 Hz, 1H), 7.19 (d, 7=8.7 Hz, 2H), 6.87 (d, 7=8.7 Hz, 2H), 5.68 (s, 1H), 4.26 (br d, 7=13.4 Hz, 2H), 4.15-3.8 (m, 3H), 3.65-3.58 (m, 2H), 3.25-3.12 (m, 2H), 2.96-2.56 (m, 2H), 2.45-2.35 (m, 2H), 2.20-2.09 (m, 1H), 2.02-1.92 (m, 1H), 1.88 (br d, 7=11.2 Hz, 2H), 1.75-1.62 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 516.1.

Example 51

8-chloro-2-(3-hydroxy-8-azabicyclo[3.2.1]octan-8-yl)-chromen-4-one

(346) ##STR00163##

Step 1: Preparation of 8-azabicyclo[3.2.1]octan-3-ol

(347) ##STR00164##

(348) A solution of tert-butyl 3-hydroxy-8-azabicyclo[3.2.1]octane-8-carboxylate (322 mg, 1.41 mmol) in dioxane (4 M HCl solution in Dioxane, 3 mL, 12 mmol) was stirred at 25? C. for 12 hours. After the reaction was completed, the mixture was concentrated in vacuo to give 8-azabicyclo[3.2.1]octan-3-ol (180 mg, quant.) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 128.1.

Step 2: Preparation of 8-chloro-2-(3-hydroxy-8-azabicyclo[3.2.1]octan-8-yl)-chromen-4-one

(349) ##STR00165##

(350) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 385.5 mg, 1.56 mmol), 8-azabicyclo[3.2.1]octan-3-ol (180 mg, 1.42 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-(3-hydroxy-8-azabicyclo[3.2.1]octan-8-yl)-chromen-4-one (40 mg, 9.2%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.874-7.871 (m, 1H), 7.855-7.851 (m, 1H), 7.386-7.347 (m, 1H), 5.538 (s, 1H), 4.465-4.458 (m, 2H), 3.934-3.924 (m, 1H), 2.401-2.331 (m, 2H), 2.080-1.974 (m, 5H), 1.783-1.747 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 306.1.

Example 52

8-chloro-2-((4-methoxybenzyl)amino)-chromen-4-one

(351) ##STR00166##

(352) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 600 mg, 2.42 mmol), (4-methoxyphenyl)methanamine (399 mg, 2.91 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-((4-methoxybenzyl)amino)-chromen-4-one (400 mg, 52.3%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 8.68-8.75 (m, 1H), 7.81-7.88 (m, 1H), 7.73-7.81 (m, 1H), 7.28-7.41 (m, 3H), 6.87-6.99 (m, 2H), 5.20-5.31 (m, 1H), 4.30-4.45 (m, 2H), 3.73 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 316.1.

Example 53

Methyl 3-(4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)benzoate

(353) ##STR00167##

Step 1: Preparation of methyl 3-bromobenzoate

(354) ##STR00168##

(355) To a solution of 3-bromobenzoic acid (1.0 g, 5.0 mmol) in MeOH (20 mL) was added SOCl.sub.2 (5 mL) at room temperature and the resulting mixture was then stirred at 90? C. for 3 hours. After the reaction was completed, the mixture was concentrated in vacuo to give methyl 3-bromobenzoate (1.1 g, quant.) as a colorless oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 215.1&217.1.

Step 2: Preparation of methyl 3-(4-acetylpiperazin-1-yl)benzoate

(356) ##STR00169##

(357) To a solution of methyl 3-bromobenzoate (1.1 g, 5 mmol) and 1-(piperazin-1-yl)ethan-1-one (0.64 g, 5 mmol) in toluene (20 mL) was added Pd(OAc).sub.2 (0.12 g, 0.500 mmol), Xantphos (0.58 g, 1.000 mmol) and Cs.sub.2CO.sub.3 (2.45 g, 7.502 mmol) at 25? C. and the resulting mixture was then stirred at 100? C. for 16 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica (PE/Ethyl acetate=1:1-1:3) to give methyl 3-(4-acetylpiperazin-1-yl)benzoate (1.2 g, 90.9%) as light yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 263.1.

Step 3: Preparation of methyl 3-(4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)benzoate

(358) ##STR00170##

(359) To a solution of methyl 3-(4-acetylpiperazin-1-yl)benzoate (300 mg, 1.14 mmol) in DCE (10.0 mL) was added POCl.sub.3 (380 mg, 2.5 mmol) at 0? C. and the resulting mixture was then stirred at 25? C. for 2 hours. 3-chloro-2-hydroxybenzoic acid (240 mg, 1.37 mmol) was added to the mixture at 0? C. and then the resulting mixture was stirred at 80? C. for 14 hours. After the reaction was completed, the mixture was concentrated in vacuo. The residue was dissolved in DCE (20.0 mL) and NaOAc (1.31 g, 16.0 mmol) was added to the solution. The resulting mixture was stirred at 80? C. for 24 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 3-(4-(8-chloro-4-oxo-chromen-2-yl)piperazin-1-yl)benzoate (7 mg, 1.6%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.891-7.871 (d, 7=8.0 Hz, 1H), 7.838-7.818 (m, 1H), 7.514 (s, 1H), 7.435-7.375 (m, 3H), 7.315 (s, 1H), 5.647 (s, 1H), 3.848 (s, 3H), 3.769-3.745 (m, 4H), 3.399 (s, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 399.1.

Example 54

Methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-3-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylate

(360) ##STR00171##

Step 1: Preparation of 2-(8-chloro-4-oxo-chromen-2-yl)-6-hydroxyisoindolin-1-one

(361) ##STR00172##

(362) To a solution of 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxyisoindolin-1-one (150 mg, 439 ?mol) in DCM (5 mL) was added BBr.sub.3 (1 M solution in DCM, 10 mL, 10 mmol) at room temperature and the resulting mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 2-(8-chloro-4-oxo-chromen-2-yl)-6-hydroxyisoindolin-1-one (130 mg, 90.4%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 328.1.

Step 2: Preparation of methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-3-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylate

(363) ##STR00173##

(364) To a solution of 2-(8-chloro-4-oxo-chromen-2-yl)-6-hydroxyisoindolin-1-one (160 mg, 488 ?mol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 240 mg, 732 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (118 mg, 857 ?mol) at room temperature and the resulting mixture was then stirred at 60? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-3-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylate (100 mg, 42.3%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.95-8.04 (m, 2H), 7.67-7.75 (m, 1H), 7.47-7.57 (m, 1H), 7.33-7.41 (m, 2H), 7.18 (s, 1H), 5.11-5.19 (m, 2H), 3.91-4.23 (m, 3H), 3.65-3.70 (m, 2H), 3.58-3.64 (m, 3H), 2.65-3.08 (m, 1H), 2.37-2.46 (m, 2H), 2.14-2.25 (m, 1H), 1.96-2.07 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 484.1.

Example 55

2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxyisoindolin-1-one

(365) ##STR00174##

(366) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 700 mg, 2.83 mmol), 6-methoxyisoindolin-1-one (553 mg, 3.39 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxyisoindolin-1-one (150 mg, 15.5%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.99 (dd, 7=1.10, 7.95 Hz, 2H), 7.68-7.80 (m, 1H), 7.47-7.56 (m, 1H), 7.37 (s, 2H), 7.15-7.25 (m, 1H), 5.22 (s, 2H), 3.87 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 342.1.

Example 56

3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)(methyl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic acid

(367) ##STR00175##

Step 1: Preparation of 8-chloro-2-((4-methoxybenzyl)(methyl)amino)-chromen-4-one

(368) ##STR00176##

(369) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 700 mg, 2.83 mmol), 1-(4-methoxyphenyl)-N-methylmethanamine (513 mg, 3.39 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 8-chloro-2-((4-methoxybenzyl)(methyl)amino)-chromen-4-one (600 mg, 64.4%) as a yellow foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.1.

Step 2: Preparation of 8-chloro-2-((4-hydroxybenzyl)(methyl)amino)-chromen-4-one

(370) ##STR00177##

(371) To a solution of 8-chloro-2-((4-methoxybenzyl)(methyl)amino)-chromen-4-one (500 mg, 1.52 mmol) in DCM (5 mL) was added BBr.sub.3 (1 M solution in DCM, 10 mL, 10 mmol) at room temperature and the resulting mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 8-chloro-2-((4-hydroxybenzyl)(methyl)amino)-chromen-4-one (480 mg, 100%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 316.1.

Step 3: Preparation of methyl 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)(methyl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylate

(372) ##STR00178##

(373) To a solution of 8-chloro-2-((4-hydroxybenzyl)(methyl)amino)-chromen-4-one (250 mg, 792 ?mol), (1s,3s)-methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 286 mg, 871 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (198 mg, 1.58 mmol) at room temperature and the resulting mixture was then stirred at 60? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)(methyl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylate (225 mg, 60.2%) as a yellow foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 472.1.

Step 4: Preparation of 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)(methyl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic Acid

(374) ##STR00179##

(375) To a solution of methyl 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)(methyl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylate (300 mg, 636 ?mol) in the mixed solvent of MeOH (10 mL) and H.sub.2O (3 mL) was added LiOH*H.sub.2O (70.0 mg, 1.67 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 12 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and then concentrated in vacuo. The residue was purified by preparative HPLC to give 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)(methyl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic acid (124 mg, 42.6%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.09-12.23 (m, 1H), 7.85-7.90 (m, 1H), 7.78-7.83 (m, 1H), 7.34-7.42 (m, 1H), 7.26-7.32 (m, 2H), 6.91-6.97 (m, 2H), 5.39-5.44 (m, 1H), 4.67-4.72 (m, 2H), 3.86-4.18 (m, 3H), 3.56-3.64 (m, 2H), 3.12 (s, 3H), 2.52-2.95 (m, 1H), 2.32-2.47 (m, 2H), 2.08-2.19 (m, 1H), 1.90-2.03 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 458.1.

Example 57

8-chloro-2-(6-hydroxy-1-methyl-3,4-dihydro-1H-isoquinolin-2-yl)chromen-4-one

(376) ##STR00180##

(377) A solution of 8-chloro-2-(1,2,4-triazol-1-yl)chromen-4-one (200 mg, 808 ?mol), 1-methyl-1,2,3,4-tetrahydroisoquinolin-6-ol; Hydrobromide (Int-5, 237 mg, 969 ?mol) and K.sub.2CO.sub.3 (246 mg, 1.78 mmol) in DMF (5 mL) was stirred at 100? C. overnight. The mixture was filtered through sintered glass and the filtrate was concentrated in vacuo. The residue was purified by prep-HPLC to give 8-chloro-2-(6-hydroxy-1-methyl-3,4-dihydro-1H-isoquinolin-2-yl)chromen-4-one (112 mg). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? ppm 9.35 (br s, 1H), 7.87 (dd, 7=7.8, 1.6 Hz, 1H), 7.82 (dd, 7=7.9, 1.5 Hz, 1H), 7.38 (t, 7=7.9 Hz, 1H), 7.07 (d, 7=8.4 Hz, 1H), 6.65 (dd, 7=8.3, 2.5 Hz, 1H), 6.60 (d, 7=2.3 Hz, 1H), 5.62 (s, 1H), 5.22 (br d, 7=6.5 Hz, 1H), 3.95 (br s, 1H), 3.48-3.67 (m, 1H), 2.90 (t, 7=5.8 Hz, 2H), 1.49 (d, 7=6.6 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 342.

Example 58

3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxo-1,2,3,4-tetrahydroisoquinolin-6-yl)oxy)ethoxy)cyclobutanecarboxylic Acid

(378) ##STR00181##

Step 1: Preparation of 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxy-3,4-dihydroisoquinolin-1-one

(379) ##STR00182##

(380) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 800 mg, 3.23 mmol), 6-methoxy-3,4-dihydroisoquinolin-1-one (687 mg, 3.88 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (781 mg, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxy-3,4-dihydroisoquinolin-1-one (200 mg, 17.4%) as a yellow foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 356.1.

Step 2: Preparation of 2-(8-chloro-4-oxo-chromen-2-yl)-6-hydroxy-3,4-dihydroisoquinolin-1-one

(381) ##STR00183##

(382) To a solution of 2-(8-chloro-4-oxo-chromen-2-yl)-6-methoxy-3,4-dihydroisoquinolin-1-one (200 mg, 562 ?mol) in DCM (5 mL) was added BBr.sub.3 (1 M solution in DCM, 5 mL, 5 mmol) at room temperature and the resulting mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 2-(8-chloro-4-oxo-chromen-2-yl)-6-hydroxy-3,4-dihydroisoquinolin-1-one (200 mg, 100%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 342.1.

Step 3: Preparation of methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxo-1,2,3,4-tetrahydroisoquinolin-6-yl)oxy)ethoxy)cyclobutanecarboxylate

(383) ##STR00184##

(384) To a solution of 2-(8-chloro-4-oxo-chromen-2-yl)-6-hydroxy-3,4-dihydroisoquinolin-1-one (200 mg, 585 ?mol), (1s,3s)-methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 211 mg, 644 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (198 mg, 1.58 mmol) at room temperature and the resulting mixture was then stirred at 60? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxo-1,2,3,4-tetrahydroisoquinolin-6-yl)oxy)ethoxy)cyclobutanecarboxylate (200 mg, 68.6%) as a yellow foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 498.1.

Step 4: Preparation of 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxo-1,2,3,4-tetrahydroisoquinolin-6-yl)oxy)ethoxy)cyclobutanecarboxylic Acid

(385) ##STR00185##

(386) To a solution of methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxo-1,2,3,4-tetrahydroisoquinolin-6-yl)oxy)ethoxy)cyclobutanecarboxylate (200 mg, 402 ?mol) in the mixed solvent of MeOH (10 mL) and H.sub.2O (3 mL) was added LiOH*H.sub.2O (70.0 mg, 1.67 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 12 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and then concentrated in vacuo. The residue was purified by preparative HPLC to give 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxo-1,2,3,4-tetrahydroisoquinolin-6-yl)oxy)ethoxy)cyclobutanecarboxylic acid (10 mg, 5.14%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 11.95-12.39 (m, 1H), 7.93-8.00 (m, 3H), 7.47-7.53 (m, 1H), 6.97-7.03 (m, 2H), 6.78-6.80 (m, 1H), 3.92-4.26 (m, 5H), 3.64-3.68 (m, 2H), 3.12-3.18 (m, 2H), 2.58-2.96 (m, 1H), 2.35-2.46 (m, 2H), 2.11-2.20 (m, 1H), 1.94-2.04 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 484.1.

Example 59

4-(benzyloxy)-1-(8-chloro-4-oxo-chromen-2-yl)pyridin-2(1H)-one

(387) ##STR00186##

(388) To a solution of 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 700 mg, 2.83 mmol), 4-(benzyloxy)pyridin-2-one (683 mg, 3.39 mmol) in DMF (5 mL) was added Cs.sub.2CO.sub.3 (1.84 g, 5.65 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 4-(benzyloxy)-1-(8-chloro-4-oxo-chromen-2-yl)pyridin-2(1H)-one (630 mg, 58.7%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 8.00-8.10 (m, 2H), 7.80-7.86 (m, 1H), 7.53-7.61 (m, 1H), 7.35-7.51 (m, 5H), 6.80 (s, 1H), 6.26-6.34 (m, 1H), 6.01-6.08 (m, 1H), 5.19 (s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 380.1.

Example 60

3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic Acid

(389) ##STR00187##

Step 1: Preparation of 8-chloro-2-((4-hydroxybenzyl)amino)-chromen-4-one

(390) ##STR00188##

(391) To a solution 8-chloro-2-((4-methoxybenzyl)amino)-chromen-4-one (200 mg, 633 ?mol) in DCM (5 mL) was added BBr.sub.3 (1 M solution in DCM, 5 mL, 5 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 8-chloro-2-((4-hydroxybenzyl)amino)-chromen-4-one (200 mg, 100%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 302.1.

Step 2: Preparation of methyl 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylate

(392) ##STR00189##

(393) To a solution of 8-chloro-2-((4-hydroxybenzyl)amino)-chromen-4-one (200 mg, 662 ?mol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 240 mg, 730 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (198 mg, 1.58 mmol) at room temperature and the resulting mixture was then stirred at 60? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylate (210 mg, 69%) as a yellow foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 458.1.

Step 3: Preparation of 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic Acid

(394) ##STR00190##

(395) To a solution of methyl 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylate (225 mg, 491 ?mol) in the mixed solvent of MeOH (10 mL) and H.sub.2O (3 mL) was added LiOH*H.sub.2O (70.0 mg, 1.67 mmol) at room temperature and the resulting mixture was then stirred at room temperature for 12 hours. After the reaction was completed, the mixture was adjusted to pH?4 by addition of 4 N HCl and then concentrated in vacuo. The residue was purified by preparative HPLC to give 3-(2-(4-(((8-chloro-4-oxo-chromen-2-yl)amino)methyl)phenoxy)ethoxy)cyclobutanecarboxylic acid (5 mg, 2.3%) as a white foam. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 444.1.

Example 61

8-chloro-2-(4-hydroxypiperidin-1-yl)-3-iodo-chromen-4-one

(396) ##STR00191##

(397) To a solution of 8-chloro-3-iodo-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-4, 452 mg, 1.21 mmol), piperidin-4-ol (159 mg, 1.57 mmol) in DMF (5 mL) was added Cs.sub.2CO.sub.3 (920 mg, 2.8 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 8-chloro-2-(4-hydroxypiperidin-1-yl)-3-iodo-chromen-4-one (90 mg, 18.3%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 7.86-7.93 (m, 2H), 7.37-7.46 (m, 1H), 4.83-4.88 (m, 1H), 3.91-3.99 (m, 2H), 3.74-3.84 (m, 1H), 3.36-3.46 (m, 2H), 1.87-1.97 (m, 2H), 1.52-1.65 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 406.1.

Example 62

Tert-butyl 6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carboxylate

(398) ##STR00192##

(399) A solution of tert-butyl 2,6-diazaspiro[3.3]heptane-2-carboxylate oxalate (419 mg, 1.45 mmol), 8-chloro-2-(1,2,4-triazol-1-yl)-chromen-4-one (Int-3, 300 mg, 1.21 mmol) and K.sub.2CO.sub.3 (335 mg, 2.42 mmol) in DMF (10 mL) was stirred at 80? C. for 1 hour. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica-gel chromatography (MeOH:DCM=0 to 10%) to give tert-butyl 6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carboxylate (400 mg, 87.6%) as a yellow foam/H NMR (DMSO-76, 400 MHz): ? 7.87 (dd, 7=1.53, 7.89 Hz, 1H), 7.79 (dd, 7=1.53, 7.89 Hz, 1H), 7.37 (t, 7=7.83 Hz, 1H), 5.09 (s, 1H), 4.30 (s, 4H), 4.06 (s, 4H), 1.38 (s, 9H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 377.1.

Example 63

Methyl 3-[6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carbonyl]benzoate

(400) ##STR00193##

Step 1: Preparation of 8-chloro-2-(2,6-diazaspiro[3.3]heptan-2-yl)chromen-4-one

(401) ##STR00194##

(402) A solution of tert-butyl 6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carboxylate (400 mg, 1.06 mmol) in trifluoroacetic acid (10 mL) was stirred at room temperature for 3 hours. After the reaction was completed, the mixture was concentrated in vacuo to give 8-chloro-2-(2,6-diazaspiro[3.3]heptan-2-yl)chromen-4-one (300 mg, 100%) as a yellow oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:277.1.

Step 2: Preparation of methyl 3-[6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carbonyl]benzoate

(403) ##STR00195##

(404) A solution of 8-chloro-2-(2,6-diazaspiro[3.3]heptan-2-yl)-chromen-4-one (100 mg, 0.36 mmol), 3-(methoxycarbonyl)benzoic acid (78.1 mg, 434 ?mol), HATU (275 mg, 0.72) and TEA (182 mg, 1.81 mmol) in DCM (10 mL) was stirred at room temperature for 16 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give methyl 3-[6-(8-chloro-4-oxo-chromen-2-yl)-2,6-diazaspiro[3.3]heptane-2-carbonyl]benzoate (10 mg, 6.3%) as yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ? 8.18 (t, 7=1.53 Hz, 1H), 8.09 (td, 7=1.34, 7.82 Hz, 1H), 7.84-7.93 (m, 2H), 7.80 (dd, 7=1.53, 7.89 Hz, 1H), 7.64 (t, 7=7.70 Hz, 1H), 7.37 (t, 7=7.83 Hz, 1H), 5.12 (s, 1H), 4.55 (s, 2H), 4.36 (s, 4H), 4.31 (s, 2H), 3.89 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 439.1.

Example 64

3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylic Acid

(405) ##STR00196##

Step 1: Preparation of 2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxyisoindolin-1-one

(406) ##STR00197##

(407) To a solution of 2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxyisoindolin-1-one (200 mg, 585 ?mol) in DCM (5 mL) was added BBr.sub.3 (1 M solution in DCM, 10 mL, 10 mmol) at room temperature and the resulting mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give 2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxyisoindolin-1-one (150 mg, 78.2%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 328.1.

Step 2: Preparation of methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylate

(408) ##STR00198##

(409) To a solution of 2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxyisoindolin-1-one (120 mg, 366 ?mol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-8, 180 mg, 549 ?mol) in DMF (5 mL) was added K.sub.2CO.sub.3 (118 mg, 857 ?mol) at room temperature and the resulting mixture was then stirred at 60? C. for 12 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylate (177 mg, 99.9%) as a yellow foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 484.1.

Step 3: Preparation of 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylic Acid

(410) ##STR00199##

(411) To a solution of methyl 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylate (100 mg, 207 ?mol) in THF (4 mL) was added 3.0 M hydrogen chloride (1 mL, 3 mmol) and the resulting mixture was then stirred at 50? C. for 2 hours. After the reaction was completed, the mixture was then concentrated in vacuo and the residue was purified by preparative HPLC to give 3-(2-((2-(8-chloro-4-oxo-chromen-2-yl)-1-oxoisoindolin-5-yl)oxy)ethoxy)cyclobutanecarboxylic acid (5 mg, 5.15%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.07-12.42 (m, 1H), 7.96-8.00 (m, 2H), 7.78-7.82 (m, 1H), 7.48-7.54 (m, 1H), 7.37-7.41 (m, 1H), 7.13-7.18 (m, 2H), 5.17-5.20 (m, 2H), 3.92-4.25 (m, 3H), 3.66-3.71 (m, 2H), 2.86-2.96 (m, 1H), 2.35-2.45 (m, 2H), 2.11-2.20 (m, 1H), 1.94-2.04 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 470.1.

Example 65

2-(8-chloro-4-oxo-chromen-2-yl)-7-methoxy-3,4-dihydroisoquinolin-1-one

(412) ##STR00200##

(413) To a solution of 8-chloro-2-(1H-1,2,4-triazol-1-yl)-chromen-4-one (800 mg, 3.23 mmol), 7-methoxy-3,4-dihydroisoquinolin-1-one (700 mg, 3.95 mmol) in DMF (5 mL) was added Cs.sub.2CO.sub.3 (2.11 g, 6.46 mmol) at room temperature and the resulting mixture was then stirred at 80? C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by preparative HPLC to give 2-(8-chloro-4-oxo-chromen-2-yl)-7-methoxy-3,4-dihydroisoquinolin-1-one (800 mg, 69.6%) as a yellow foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ? 12.07-12.42 (m, 1H), 7.96-8.00 (m, 2H), 7.78-7.82 (m, 1H), 7.48-7.54 (m, 1H), 7.37-7.41 (m, 1H), 7.13-7.18 (m, 2H), 5.17-5.20 (m, 2H), 3.92-4.25 (m, 3H), 3.66-3.71 (m, 2H), 2.86-2.96 (m, 1H), 2.35-2.45 (m, 2H), 2.11-2.20 (m, 1H), 1.94-2.04 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 356.1.

BIOLOGICAL EXAMPLES

Example 66: Engineered HepDES19 primary screen assay

(414) The assay was employed to screen for novel cccDNA inhibitors. HepDES19 is a cccDNA-producing cell line. In this cell line, HBeAg in the cell culture supernatant as surrogate marker, as HBeAg production depends on cccDNA level and activity. HepDES19 is an engineered cell line which contains a 1.1 unit length HBV genome, and pgRNA transcription from the transgene is controlled by Tetracycline (Tet). In the absence of Tet, pgRNA transcription will be induced, but HBV e antigen (HBeAg) could not be produced from this pgRNA due to very short leader sequence before the HBeAg start codon and the start codon is disrupted. Only after cccDNA is formed, the missing leader sequence and start codon mutation would be restored from the 3-terminal redundancy of pgRNA, and then HBeAg could be synthesized. Therefore, HBeAg could be used as a surrogate marker for cccDNA (Zhou, T. et al., Antiviral Res. (2006), 72(2), 116-124; Guo, H. et al., J. Virol. (2007), 81(22), 12472-12484).

(415) HepDES19 cells were seeded at 2?10.sup.6 cells per T150 flask and cultured with the culture medium (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 [DMEM-F12, Gibco Cat. 11320-82], 10% Fetal Bovine Serum [FBS, Clontech Cat. 631101], 0.1 mM Non-Essential Amino Acids Solution [NEAA, Gibco Cat. 11140-050], 50 ?g/mL Penicillin-Streptomycin [PS, Invitrogen Cat. 15140-163], 500 ?g/mL Geneticin [G418, Invitrogen Cat. 10131-027]) containing 3 ?g/mL Tet (Sigma, Cat. 87128) for 5 days. Cells were then seeded at 4?10.sup.6 cells per T150 in the same culture medium as described above in the absence of Tet for 8 days. Cells were then harvested and frozen at density of 2?10.sup.6 cells per mL. For compound testing, the frozen cells were thawed and seeded into 96-well plates at a density of 6?10.sup.4 cells per well. At 24 hours after seeding, half log serial dilutions of compounds made with Dimethyl sulfoxide (DMSO, Sigma, Cat. D2650) were further diluted with the same culture medium as described above before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. Plates were then incubated at 37? C. for another 5 days before measurement of HBeAg level and cell viability. Intracellular HBeAg level were measured with enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Kehua Diagnostic Medical Products Co., Ltd). Cell viability was assessed using Cell Counting Kit-8 (Donjindo, Cat. CK04-20). IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method.

(416) The compounds of the present invention were tested for their capacity to inhibit extracellular HBeAg level as described herein. The compounds of this invention were found to have IC.sub.50 below 50 ?M. Particular compounds of formula (I) were found to have IC.sub.50 below 5.0 ?M. Results of HepDES19 primary screen assay are given in Table 1.

(417) TABLE-US-00001 TABLE 1 Activity data in HepDES19 primary screen assay Example No. IC.sub.50 (?M) 3 0.64 4 3.60 7 1.66 8 0.32 11 3.12 17 10.75 20 50 21 11.03 22 11.90 23 11.94 24 13.86 25 16.19 26 20.60 27 23.44 28 24.30 29 24.86 30 25.90 31 26.83 32 33.73 33 35.32 34 44.58 35 44.60 41 3.99 42 4.34 43 4.78 44 5.44 45 8.58 46 9.66 47 10.72 48 12.12 49 12.38 50 14.06 51 14.76 52 14.96 53 15.02 54 15.99 55 16.68 56 19.62 57 19.96 58 23.42 59 24.41 60 30.79 61 30.86 62 33.19 63 31.67 64 36.63 65 37.59

Example 67: Cryopreserved Primary Human Hepatocytes (PHH) Assay

(418) This assay is used to confirm the anti-HBV effect of the compounds in HBV PHH infection assay. Cryopreserved PHH (BioreclamationIVT, Lot YJM) was thawed at 37? C. and gently transferred into pre-warmed InVitroGRO HT medium (BioreclamationIVT, Cat. S03317).

(419) The mixture was centrifuged at 70 relative centrifugal force (RCF) for 3 mins at RT, and the supernatant was discarded. Pre-warmed InVitroGRO CP medium (BioreclamationIVT, Cat #S03316) was added to the cell pellet to gently re-suspend cells. The cells were seeded at the density of 5.8?10.sup.4 cells per well to collagen I coated 96-well plate (Gibco, Cat. A1142803) with the InVitroGRO CP medium. All plates were incubated at 37? C. with 5% CO.sub.2 and 85% humidity.

(420) At 20 hours after plating, the medium was changed to PHH culture medium (Dulbecco's Modified Eagle Medium (DMEM)/F12 (1:1) (Gibco, Cat. 11320-033), 10% fetal bovine serum (Gibco Cat. 10099141), 100 U/mL penicillin, 100 ?g/mL streptomycin (Gibco, Cat. 151401-122), ng/mL human epidermal growth factor (Invitrogen Cat. PHG0311L), 20 ng/mL dexamethasone (Sigma, Cat. D4902) and 250 ng/mL human recombinant insulin (Gibco, Cat. 12585-014)). And the cells were incubated at 37? C. with 5% CO.sub.2 and 85% humidity for 4 hours. The medium was then changed to pre-warmed PHH culture medium containing 4% polyethylene glycol (PEG) MW8000 (Sigma, Cat. P1458-50ML) and 1% DMSO (Sigma, Cat. D2650). 5.8?10.sup.6 genomic equivalents of HBV were added into the medium.

(421) At 24 hours post-infection, the cells were gently washed with PBS and refreshed with PHH culture medium supplemented with 1% DMSO, and 0.25 mg/mL Matrix gel (Corning, Cat. 356237) at 200 ?L per well. All plates were immediately placed in at 37? C. CO.sub.2 incubator. 24 hours later, serial dilutions of compounds made with DMSO were further diluted with the same culture medium (PHH culture medium supplemented with 1% DMSO and 0.25 mg/mL Matrix gel as described above) before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. The medium containing the compounds were refreshed every three days.

(422) At 9 days post-compound treatment, extracellular HBsAg level were measured with Chemiluminescence Immuno Assay (CLIA) kit (Autobio, HBsAg Quantitative CLIA). Extracellular HBV DNA was extracted by MagNA Pure 96 system (Roche) and then determined by quantitative PCR with the following primers and probe:

(423) TABLE-US-00002 HBV-ForwardPrimer(SEQIDNO:1): AAGAAAAACCCCGCCTGTAA(5to3); HBV-ReversePrimer(SEQIDNO:2): CCTGTTCTGACTACTGCCTCTCC(5to3); HBV-Probe: 5+tetramethylrhodamine+SEQIDNO:3+black holequencher2-3,
wherein SEQ ID NO: 3 is CCTGATGTGATGTTCTCCATGTTCAGC.

(424) HBsAg IC.sub.50 and HBV DNA IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method. Test results of the compounds in Cryopreserved PHH assay are given in Table 2.

(425) TABLE-US-00003 TABLE 2 HBsAg IC.sub.50 data in Cryopreserved PHH assay Example HBsAg IC.sub.50 No. (?M) 1 2.86 2 4.36 3 6.47 4 6.58 5 7.42 6 9.53 7 10.01 9 14.14 10 24.33 12 34.24 13 36.33 14 36.34 15 37.57 16 40.32 18 42.95 19 31.63 36 0.61 37 1.06 38 38.46 39 38.52 40 34.59