Methods for the treatment of corneal dystrophies

11987809 ยท 2024-05-21

Assignee

Inventors

Cpc classification

International classification

Abstract

Methods and compositions for the treatment of a corneal dystrophy in a subject in need thereof are provided. In one aspect, the method includes the step of obtaining a plurality of stem cells comprising a nucleic acid mutation in a corneal dystrophy target nucleic acid from the subject and manipulating the nucleic acid mutation in one or more stem cells of the plurality of stem cells to correct the nucleic acid mutation, thereby forming one or more manipulated stem cells. The manipulated stem cells are isolated and then transplanted into the subject. In some embodiments, the nucleic acid mutation is manipulated using CRISPR system.

Claims

1. A method of ameliorating or treating corneal dystrophy in a subject in need thereof, the method comprising: manipulating a nucleic acid mutation in a corneal dystrophy target nucleic acid in a limbal epithelial stem cell to correct the nucleic acid mutation, thereby forming a manipulated limbal epithelial stem cell, wherein the manipulating comprises introducing an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system into the limbal epithelial stem cell, wherein the CRISPR/Cas9 system comprises at least one vector comprising a nucleotide molecule encoding Cas9 nuclease and an single guide RNA (sgRNA), and the Cas9 nuclease and said sgRNA do not naturally occur together, wherein the sgRNA comprises (i) CRISPR targeting RNA (crRNA) sequence, and (ii) a trans-activating crRNA (tracrRNA) sequence, wherein the tracrRNA comprises a nucleotide sequence having the nucleotide sequence of SEQ ID NO: 6, wherein the crRNA sequence and tracrRNA sequence do not naturally occur together; and transplanting the manipulated limbal epithelial stem cell into the subject.

2. The method according to claim 1, comprising: manipulating the nucleic acid mutation in a plurality of limbal epithelial stem cells to correct the nucleic acid mutation, thereby forming one or more manipulated limbal epithelial stem cells; isolating the one or more manipulated limbal epithelial stem cells; and transplanting the one or more manipulated limbal epithelial stem cells into the subject.

3. The method according to claim 2, further comprising culturing the one or more manipulated limbal epithelial stem cells prior to transplanting, thereby forming a plurality of manipulated limbal epithelial stem cells, wherein the transplanting comprises transplanting the plurality of manipulated limbal epithelial stem cells.

4. The method according to claim 3, wherein the culturing comprises establishing a stable cell line.

5. The method according to claim 1, further comprising culturing the manipulated limbal epithelial stem cell prior to transplanting, thereby forming a plurality of manipulated limbal epithelial stem cells, wherein the transplanting comprises transplanting the plurality of manipulated limbal epithelial stem cells.

6. The method according to claim 1, wherein the limbal epithelial stem cell is obtained from an autologous or homologous donor.

7. The method according to claim 1, wherein the limbal epithelial stem cells that include the nucleic acid mutation in a corneal dystrophy target nucleic acid are obtained from the subject.

8. The method according to claim 1, wherein the corneal dystrophy target nucleic acid is a TGF?I target nucleic acid, and wherein the nucleic acid mutation encodes for an amino acid substitution of R124, R555, or H626 of the TGF?I polypeptide.

9. The method according to claim 1, wherein the corneal dystrophy target nucleic acid is a TGF?I, KRT3, KRT12, GSN or UBIAD1 target nucleic acid.

10. The method according to claim 1, wherein the corneal dystrophy occurs following laser eye surgery.

11. The method according to claim 1, further comprising repeating the transplanting at one or more predetermined frequencies.

12. The method according to claim 1, wherein the sgRNA comprises a detectable label.

13. The method according to claim 12, wherein the detectable label of the sgRNA is a nucleic acid barcode or fluorescent barcode label.

14. The method according to claim 1, wherein the manipulating further comprises introducing into the limbal epithelial stem cell: a repair nucleic acid comprising a wild type version of the corneal dystrophy target nucleic acid or fragment thereof, whereby the sgRNA targets the target nucleic acid and the nuclease cleaves the target nucleic acid thereby creating a target nucleic acid cleavage site and whereby the repair nucleic acid is capable of homologously recombining with the corneal dystrophy target nucleic acid after the creation of the target nucleic cleavage site.

15. The method according to claim 14, wherein the repair nucleic acid comprises a detectable label.

16. The method according to claim 15, wherein the detectable label of the repair nucleic acid is a nucleic acid barcode or fluorescent barcode label.

17. The method according to claim 14, wherein CRISPR/nuclease system reagents further comprise one or more agents that increase frequency of homologous recombination in the plurality of limbal epithelial stem cells by repressing genes involved in non-homologous end-joining (NHEJ) pathway.

18. The method according to claim 1, wherein the Cas9 nuclease is a Streptococcus Cas9, a Staphylococcus Cas9, or variants thereof.

19. The method according to claim 1, wherein the Cas9 nuclease comprises an amino acid sequence having at least 85% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 4 or 8.

20. The method according to claim 1, wherein the sgRNA and the Cas9 nuclease are included on the same vector.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) For a better understanding of the aforementioned implementations of the subject systems and methods as well as additional implementations thereof, reference should be made to the Description of Implementations below, in conjunction with the following drawings in which like reference numerals refer to corresponding parts throughout the figures.

(2) FIG. 1 is a diagram showing a schematic of one particular embodiment of the subject methods described herein.

(3) FIG. 2 is a chart showing exemplary mutations that can be repaired using the subject methods provided herein.

(4) FIG. 3 shows positions of variants for novel PAM.

(5) FIG. 4 illustrates exemplary vectors for CRISPR/Cas9 system, including pSpCas9(BB)-2A-Puro (PX459) using Streptococcus pyogenes Cas9 nuclease.

(6) FIG. 5 illustrates exemplary design of sgRNAs for targeting wild-type and mutant keratin 12 (K12) alleles. An sgRNA to use the SNP-derived PAM found on the K12-L132P allele was designed (red). PAM is absent from the wild-type allele. A second sgRNA to target both wild-type and mutant K12 alleles (green) was also designed and used as a positive control. Figure discloses SEQ ID NOS 16-17, 9, 16, 18, and 9 respectively, in order of appearance.

(7) FIG. 6 illustrates evaluation of allele specificity and potency of sgK12LP using exogenous expression constructs. Exogenous expression constructs for wild-type and mutant K12 were employed to test the allele-specificity and potency of sgK12LP. (a) A dual luciferase assay demonstrated the allele-specificity of the sgK12LP plasmid, whereas potency was shown to be comparable to that of the sgK12 construct. N=8 (b) Western blotting further demonstrated these attributes with a noticeable reduction in K12-L132P protein in cells treated with sgK12LP in comparison with cells treated but expressing K12 wild-type protein. ?-Actin was used as a loading control. (c) Quantitative reverse transcriptase-PCR for total K12 in cells expressing both wild-type and mutant alleles demonstrated a knockdown in mRNA expression. N=4 (d) Allele proportions of mRNA knockdown were then quantified by pyrosequencing, confirming an allele knockdown of the mutant allele in cells co-expressing both KRT12 alleles and treated with sgK12LP. N=4, *P<0.05, **P<0.01, ***P<0.001.

(8) FIG. 7 illustrates sgK12LP-induced NHEJ in vivo. GFP expression was observed in the corneal epithelium of mice at 24 h post intrastromal injection, demonstrating the efficacy of an intrastromal plasmid injection for transfecting the corneal epithelium (a; N=2). No GFP expression was observed at 48 h post injection. Sequencing of the gDNA from human K12-L132P heterozygous mice injected with the sgK12LP construct demonstrated large deletions and the induction of NHEJ due to cleavage of the KRT12-L132P allele. Of 13 clones sequenced, 5 were found to have undergone NHEJ (b). Figure discloses SEQ ID NOS 19-24, respectively, in order of appearance.

(9) FIG. 8 shows results using SNP derived PAM guide RNAs designed for TGFBI mutations R514P (A), L518R (B), and L509R (C), and luciferase expression was used to assess wild type and mutant allele expression. A positive control (sgW or sgWT) guide was designed to cut both WT (blue bar) and MUT (red bar) allele and as shown above cuts both alleles as expected. The guide used for L518R (sgM or sgMUT) shows the greatest allele specificity with minimal cutting of the mutant allele (red bar). The negative control guide (sgN or sgNSC) as expected did not cut either of the WT nor MUT DNA. FIG. 8A discloses SEQ ID NOS 25-28, respectively, in order of appearance. FIG. 8B discloses SEQ ID NOS 29-32, respectively, in order of appearance. FIG. 8C discloses SEQ ID NOS 33 36, respectively, in order of appearance

(10) FIG. 9 shows results using mutant allele specific guide RNAs designed for R124. TGFBI mutations and luciferase expression was used to assess wild type and mutant allele expression. A positive control sgWT guide was designed to cut both WT and MUT allele and as shown above cuts both alleles as expected (middle bars in each graph blue and red bars). The guides with the 20 mer length showed more WT allele DNA editing. The assay was repeated with allele specific RNA guides shortened to 18 mer. reduced the amount of WT DNA cutting (right hand panel of graphs and right side bars on graph (blue bars). FIG. 9A discloses SEQ ID NOS 37-38, FIG. 9B discloses SEQ ID NOS 37 and 39, FIG. 9C discloses SEQ ID NOS 40-41, FIG. 9D discloses SEQ ID NOS 40 and 42, FIG. 9E discloses SEQ ID NOS 43-44, and FIG. 9F discloses SEQ ID NOS 43 and 45, respectively, in order of appearance.

(11) FIG. 10 shows that the left eye was transfected with a non-specific negative control sgRNA, while the right eye was transfected with a sgRNA targeting Luc2.

(12) FIG. 11 illustrates exemplary sgRNA sequence, nucleotide and amino acid sequences of Cas9 nuclease from Streptococcus pyogenes (Spy) and Staphylococcus aureus (Sau).

DETAILED DESCRIPTION

(13) I. Introduction

(14) Corneal dystrophies are a group of hereditary disorders characterized by bilateral abnormal deposition of substances in the cornea, the transparent front part of the eye. A subset of such corneal dystrophies, epithelial-stromal corneal dystrophies, is known to be associated with mutations in transforming growth factor beta induced (TGF?I) gene. The TGF?I gene encodes an RGD-containing protein that binds to type I, II and IV collagens.

(15) In some cases, epithelial-stromal corneal dystrophies are distinguished from each other and are divided into subtypes on the basis of the clinical appearance of the opacities, clinical features of the disease, and on histopathological staining properties of the deposits. Without being bound by any particular theory of operation it is believed that specific mutations in the TGF?I gene account for the specific phenotypes associated with such corneal dystrophies and that the corneal opacities that account for the clinical features of the different phenotypes result from the deposition of all or part of the mutated encoded TGF?I protein.

(16) Stem cell-based therapy for tissue repair and regeneration provides promising treatments for a number of ocular disorders, include corneal dystrophies. Stem cells are capable of self-renewal and differentiation to generate a variety of mature cell lineages. Transplantation of such cells can be utilized as a clinical tool for reconstituting a target tissue (e.g., corneal tissue), thereby restoring physiological and anatomic functionality.

(17) Advances in the development of nucleic acid manipulation reagents have allowed for simple and efficient manipulation of nucleic acids (e.g., DNA and RNA) in stem cells. The development of CRISPR reagents have provide DNA-encoded, RNA mediated, DNA- or RNA-targeting sequence specific targeting. CRISPR systems can be used, for example, for the precise insertion of donor DNA into a target cell genome. Such nucleic acid manipulation reagents have enabled researchers to precisely manipulate specific genomic elements.

(18) The present disclosure is based at least in part on the discovery of methods for the treatment of ocular diseases using a stem cell based approach. In particular embodiments, stem cells isolated from a subject undergoing a treatment for an ocular dystrophy are obtained and genetically modified using CRISPR system reagents to correct a mutant allele associated with the ocular disease.

(19) In one aspect, provided herein is a method for the treatment of a corneal dystrophy (e.g., FIG. 1). The method, for example, includes manipulating a nucleic acid mutation in a corneal dystrophy target nucleic acid in a stem cell from the subject to correct the nucleic acid mutation, thereby forming a manipulated stem cell; and transplanting the manipulated stem cell into the subject. In some embodiments, the method may include the steps of obtaining a plurality of stem cells that include nucleic acid mutation in a target corneal dystrophy nucleic acid from the subject; b) manipulating the nucleic acid mutation in one or more stem cells of the plurality of stem cells to correct the nucleic acid mutation, thereby forming one or more manipulated stem cells; c) isolating the one or more manipulated stem cells; and d) transplanting the one or more manipulated stem cells into the subject. Features of the subject method are discussed further in detail below.

(20) II. Corneal Dystrophies

(21) The methods provided herein are for the treatment of one or more corneal dystrophies in a subjects in need thereof.

(22) Subjects that can be treated with the methods include, but are not limited to, mammalian subjects such as a mouse, rat, dog, baboon, pig or human. In some embodiments, the subject is a human. The methods can be used to treat subjects at least 1 year, 2 years, 3 years, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years, 35 years, 40 years, 45 years, 50 years, 55 years, 60 years, 65 years, 70 years, 75 years, 80 years, 85 years, 90 years, 95 years or 100 years of age.

(23) As used herein, a corneal dystrophy refers to any one of a group of hereditary disorders in the outer layer of the eye (cornea). For example, the corneal dystrophy may be characterized by bilateral abnormal deposition of substances in the cornea. Corneal dystrophies include, but are not limited to the following four IC3D categories of corneal dystrophies (see, e.g., Weiss et al., Cornea 34(2): 117-59 (2015)): epithelial and subepithelial dystrophies, epithelial-stromal TGF?I dystrophies, stromal dystrophies and endothelial dystrophies. In some embodiments, the corneal dystrophy is selected from the group consisting of Epithelial basement membrane dystrophy (EBMD), Meesmann corneal dystrophy (MECD), Thiel-Behnke corneal dystrophy (TBCD), Lattice corneal dystrophy (LCD), Granular corneal dystrophy (GCD), and Schnyder corneal dystrophy (SCD). In additional embodiments, the corneal dystrophy herein excludes MECD.

(24) In additional embodiments, the corneal dystrophy is caused by one or more mutations, such as SNP, for example, including those located in a gene selected from the group consisting of Transforming growth factor, beta-induced (TGFBI), keratin 3 (KRT3), keratin 12 (KRT12), GSN, and UbiA prenyltransferase domain containing 1 (UBIAD1). In further embodiments, the SNP site results in encoding a mutant amino acid in a mutant protein as shown herein. In further embodiments, a mutant sequence comprising the SNP site encodes a mutant protein selected from the group consisting of (i) mutant TGFBI proteins comprising a mutation corresponding to Leu509Arg, Arg666Ser, Gly623Asp, Arg555G1n, Arg124Cys, Val505Asp, Ile522Asn, Leu569Arg, His572Arg, Arg496Trp, Pro501Thr, Arg514Pro, Phe515Leu, Leu518Pro, Leu518Arg, Leu527Arg, Thr538Pro, Thr538Arg, Val539Asp, Phe540del, Phe540Ser, Asn544Ser, Ala546Thr, Ala546Asp, Phe547Ser, Pro551G1n, Leu558Pro, His572del, Gly594Val, Val613del, Val613Gly, Met619Lys, Ala620Asp, Asn622His, Asn622Lys, Asn622Lys, Gly623Arg, Gly623Asp, Val624 Val625del, Val624Met, Val625Asp, His626Arg, His626Pro, Val627SerfsX44, Thr629_Asn630insAsnValPro, Val631Asp, Arg666Ser, Arg555Trp, Arg124Ser, Asp123delins, Arg124His, Arg124Leu, Leu509Pro, Leu103_Ser104del, Val113Ile, Asp123His, Arg124Leu, and/or Thr125_Glu126del in TGFBI, for example, of Protein Accession No. Q15582; (ii) mutant KRT3 proteins comprising a mutation corresponding to Glu498Val, Arg503Pro, and/or Glu509Lys in Keratin 3 protein, for example, of Protein Accession No. P12035 or NP 476429.2; (iii) mutant KRT12 proteins with Met129Thr, Met129Val, Gln130Pro, Leu132Pro, Leu132Va, Leu132His, Asn133Lys, Arg135Gly, Arg135Ile, Arg135Thr, Arg135Ser, Ala137Pro, Leu140Arg, Val143Leu, Va1143Leu, Lle391Leu399dup, Ile426Val, Ile 426Ser, Tyr429Asp, Tyr429Cys, Arg430Pro, and/or Leu433Arg in KRT12, for example, of Protein Accession No. Q99456.1 or NP 000214.1; (iv) mutant GSN proteins with Asp214Tyr in GSN, for example, of Protein Accession No. P06396; and (v) mutant UBIAD1 proteins comprising a mutation corresponding to Ala97Thr, Gly98Ser, Asn102Ser, Asp112Asn, Asp112Gly, Asp118Gly, Arg119Gly, Leu121Val, Leu121Phe, Val122Glu, Val122Gly, Ser171Pro, Tyr174Cys, Thr175Ile, Gly177Arg, Lys181Arg, Gly186Arg, Leu188His, Asn232Ser, Asn233His, Asp236Glu, and/or Asp240Asn in UBIAD1, for example, of Protein Accession No. Q9Y5Z9. For example, a mutant sequence comprising the SNP site encodes at least a part of mutant TGFBI protein mutated by replacing Leu with Arg at amino acid position corresponding to the amino acid position 509 of Protein Accession No. Q15582. In case, a mutation at the SNP site may be responsible for encoding the mutant amino acid at amino acid position corresponding to the amino acid position 509 of Protein Accession No. Q15582. As used herein, a mutation corresponding to a particular mutation in a human protein may include a mutation in a different species that occur at the corresponding site of the particular mutation of the human protein. Also as used herein, when a mutant protein is described to include a particular mutant, for example, of Leu509Arg, such a mutant protein may comprise any mutation that occurs at a mutant site corresponding to the particular mutant in a relevant human protein, for example, in TGFBI protein of Protein Accession No. Q15582 as described herein.

(25) In some embodiments, the mutant described herein excludes any mutant in KRT12 protein. In some embodiments, the mutant described herein excludes a mutation corresponding to Leu132Pro in KRT12, for example, of Protein Accession No. Q99456.1. In further embodiments, the SNP described herein excludes any SNP that occurs in KRT12 gene. In yet further embodiments, the SNP described herein excludes any SNP that results in the Leu132Pro mutation in KRT12 protein. The SNP may further exclude the SNP at a PAM site (AAG>AGG) that results in the Leu132Pro mutation in KRT12 protein.

(26) Epithelial-stromal corneal dystrophies include Reis-Bucklers corneal dystrophy, Thiel-Behnke corneal dystrophy, lattice corneal dystrophy type 1, granular corneal dystrophy type 1, and granular corneal dystrophy type 2. Stromal corneal dystrophies include macular corneal dystrophy, Schnyder corneal dystrophy, congenital stromal corneal dystrophy, posterior amorphous corneal dystrophy, central cloudy dystrophy of Francois, and pre-Descemet corneal dystrophy. In some embodiments, the methods are for the treatment of an epithelial-stromal corneal dystrophy. In some embodiments, the corneal dystrophy is Reis-Bucklers corneal dystrophy. In certain embodiments, the corneal dystrophy is Thiel-Behnke corneal dystrophy. In certain embodiments, the corneal dystrophy is lattice corneal dystrophy type 1. In certain embodiments, the corneal dystrophy is granular corneal dystrophy type 1. In certain embodiments, the corneal dystrophy is granular corneal dystrophy type 2. Epithelial-stromal dystrophies are caused by mutations in TGF?I. As used herein Transforming growth factor, beta-induced, TGFBI, TGF?I, BIGH3, CDB1, CDG2, CDG1, CSD, CSD1, CSD2, CSD3, EBMD, and LCD1 all refer to an RGD-containing protein that binds to type I, II, and IV collagens (Accession Numbers: NM_00358 and MP 000349 (human) and NM_009369 and MP 033395 (mouse)). In humans, TGF?I is encoded by the TGFBI gene, locus 5q31. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. TGF?I is induced by transforming growth factor-beta and acts to inhibit cell adhesion. In epithelial-stromal dystrophies, mutations in the TGFBI gene, the TGF?I structure is abnormal and accumulation of the insoluble mutant TGF?I or its proteolytic fragment occurs in the cornea.

(27) In other embodiments, the subject has granular corneal dystrophy type II. As used herein, granular corneal dystrophy type II, Avellino corneal dystrophy, granular corneal dystrophy type 2 and combined granular-lattice corneal dystrophy all refer to an autosomal dominant form of granular corneal dystrophy that is caused by a mutation in the TGFBI gene, local on chromosome 5q31. In some cases, granular corneal dystrophy type II is characterized by irregular-shaped well-demarcated granular deposits in the superficial central corneal stroma, and progressive visual impairment. Heterozygous patients suffering from granular corneal dystrophy type II have increasing loss in vision with age, becoming severe in the later years of life. Lesions appear within the first decade of life and may be evident by 3 years of age. Onset of granular corneal dystrophy type II is generally earlier in homozygous patients and may accompany mild corneal erosions. Visual acuity usually remains good until late in the course of the condition. Opacities are initially small superficial whitish dots. Subsequently, ring or stellate-shaped stromal opacities develop. Final-stage opacities are more superficial and translucent, and may coalesce in the anterior stroma.

(28) In some embodiments, the subject has keratoconus. Keratoconus (KTCN) is the most common corneal ectatic disorder with approximately 6-23.5% of subjects carrying a positive family history (Wheeler, J., Hauser, M. A., Afshari, N. A., Allingham, R. R., Liu, Y., Reproductive Sys Sexual Disord 2012; S: 6). The reported prevalence of KTCN ranges from 8.8 to 54.4 per 100,000. variation in prevalence is partly due to the different criteria used to diagnose the disease. (Wheeler, J., Hauser, M. A., Afshari, N. A., Allingham, R. R., Liu, Y., Reproductive Sys Sexual Disord 2012; S: 6; and Nowak, D., Gajecka, M., Middle East Afr J Ophthalmol 2011; 18(1): 2-6). Many studies exist within the literature that attempt to define the genetic causes of KTCN. These studies have uncovered numerous possible genetic variants or SNPs that are believed to contribute to the etiology of the disease depending on the experimental parameters.

(29) Previously, it was discovered that heterozygous individuals were highly susceptible to accelerating loss of vision following LASIK laser eye surgery. Notably, two years after surgery increased opacity of the cornea was observed in these patients with increasing aggressiveness, eventually resulting in complete loss of vision (Jun, R. M. et al., Opthalmology, 111:463, 2004). Previously, eye surgery has been performed with an expectation that LASIK or Excimer Laser surgery would get rid of vision blurriness of a patient suffering from corneal dystrophy. For a hypothetical number of three hundred thousand cases of LASIK surgery, 300 people would have lost their vision, based on 1/1000 of minimum estimation of heterozygous patients suffering from granular corneal dystrophy type II. Patients who have undergone LASIK surgery are mainly in their 20's and 30's carrying out productive activities. In addition, after approval of LASIK surgery in year 2000 in USA, African American patients suffering from granular corneal dystrophy type II who underwent LASIK surgery have been found to lose eye sight, which infers that plenty of similar cases might be occurring throughout the world.

(30) In some embodiments, the subject having granular corneal dystrophy type II is homozygous for a mutation in TGF?I. In other embodiments, the subject having granular corneal dystrophy type II is heterozygous for a mutation in TGF?I. In some embodiments, the subject has a mutation that encodes for a substitution of arginine 124, arginine 555, or histidine 626 in a TGF?I polypeptide. In particular embodiments, the nucleic acid mutation encodes for an amino acid substitution selection from R124C, R124H, R124L, R555W, R555Q, and H626P.

(31) In certain embodiments, the subject undergoing treatment has granular corneal dystrophy type I and is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 years old. In some embodiments, the subject undergoing treatment has granular corneal dystrophy type I and is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, or 100 years old.

(32) In certain embodiments, the subject undergoing treatment has granular corneal dystrophy type II and is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 years old. In some embodiments, the subject undergoing treatment has granular corneal dystrophy type II and is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, or 100 years old.

(33) In certain embodiments, the subject undergoing treatment has lattice corneal dystrophy type 1 and is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 years old. In some embodiments, the subject undergoing treatment has lattice corneal dystrophy type 1 and is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, or 100 years old.

(34) In certain embodiments, the subject undergoing treatment has Reis-Bucklers corneal dystrophy and is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 years old. In some embodiments, the subject undergoing treatment has Reis-Bucklers corneal dystrophy and is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, or 100 years old.

(35) In certain embodiments, the subject undergoing treatment has Thiel-Behnke corneal dystrophy and is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 years old. In some embodiments, the subject undergoing treatment has Thiel-Behnke corneal dystrophy and is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, or 100 years old.

(36) In some embodiments, the subject has keratoconus and is homozygous for a mutation in one of the following corneal target nucleic acids: COL4A1-4, LOX, SPARC, LRRN1, HGF, AKAP13, ZNF469, ATG12P2, GS1-256O22.5, PLEKHA6, APOL4, SLC44A3, SLC6A18, SLC29A3, RANBP3L, KCNMA1, MUC5AC, CROCC, ATHL1, or PLP1. In other embodiments, the subject has keratoconus and is heterozygous for a mutation in one of the following corneal target nucleic acids: COL4A1-4, LOX, SPARC, LRRN1, HGF, AKAP13, ZNF469, ATG12P2, GS1-256O22.5, PLEKHA6, APOL4, SLC44A3, SLC6A18, SLC29A3, RANBP3L, KCNMA1, MUC5AC, CROCC, ATHL1, or PLP1.

(37) In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution Q1334H in COL4A1. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution G683A in COL4A2. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution P718S in COL4A2. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution R517K in COL4A2. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution D326Y in COL4A3. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution H451R in COL4A3. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution V1327M in COL4A4. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution R158Q in LOX. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution A1046T in AKAP13. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution G624V in AKAP13. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution G2358R in ZNF469. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution S158F in SLC29A3. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution P4493S in MUC5AC. In some embodiments, the subject has a nucleic acid mutation that encodes for amino acid substitution P370S in CROCC.

(38) In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs3742207 (e.g., SNP identified by rs3742207 in the National Center for Biotechnology Information's dbSNP database). In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs3803230. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs9583500. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs7990383. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs55703767. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs11677877. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs2229813. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs1800449. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs1053411. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs2116780. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs3749350. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs2286194. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs12536657. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs2614668. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs745191. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs12598474. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs10932976. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs5908678. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs35803438. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs132728. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs132729. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs132730 In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs859063. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs2893276. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs6687749. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs13189855. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs6876514. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs6876515. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs13361701. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs883764. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs780667. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs780668. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs13166148. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs10941287. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs7907270. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs200922784. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs9435793. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs116300974. In some embodiments, the subject has a nucleic acid mutation that corresponds to reference SNP cluster identifier rs2233696.

(39) In certain embodiments, the subject undergoing treatment has keratoconus and is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 years old. In some embodiments, the subject undergoing treatment has keratoconus and is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, or 100 years old.

(40) In certain embodiments, the subject undergoing the subject treatment has granular corneal dystrophy type II and has also undergone laser eye surgery. In some embodiments, the treatment is performed 6 months or less, 1 year or less, 1.5 years or less, 2 years or less, 2.5 years or less, 3 years or less, 3.5 years or less, 4 years or less, 4.5 years or less, 5 years or less, 5.5 years or less, 6 years or less, 6.5 years or less, 7 years or less, 7.5 years or less, 8 years or less, 8.5 years or less, 9 years or less, 9.5 years or less, 10 years or less, 15 years or less, 20 years or less 25 years or less, 30 years or less, 35 years or less, 40 years or less, 45 years or less, 50 years or less, 55 years or less, 60 years or less, 65 years or less, 70 years or less, 75 years or less, 80 years or less, 85 years or less, 90 years or less, 95 years or less or 100 years or less following laser eye surgery.

(41) In some embodiments of the methods provided herein, therapy is used to provide a positive therapeutic response with respect to a disease or condition (e.g., a corneal dystrophy). By positive therapeutic response is intended an improvement in the disease or condition, and/or an improvement in the symptoms associated with the disease or condition. The therapeutic effects of the subject methods of treatment can be assessed using any suitable method. In certain embodiments, treatment is assessed by the reduction of protein deposition on the cornea of the subject after treatment as compare to a control (e.g., the amount of protein deposition prior to treatment). In some embodiments, the subject methods reduce the amount of corneal protein deposition in the subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to the cornea prior to undergoing treatment. Corneal opacity can also be used to assess the therapeutic effect using the subject methods. Further, in some embodiments, treatment is assessed by visual function. Assessment of visual function in the subject can be carried out using any suitable test known in the art including, but not limited to, assessments of uncorrected visual acuity (UCVA), best-corrected visual acuity (BCVA) and brightness acuity test (BAT). See, e.g., Awaad et al., Am J Ophthalmol. 145(4): 656-661 (2008) and Sharhan et al., Br J Ophthalmol 84:837-841 (2000), which are incorporated by reference in their entirety for all purposes, and particularly for all teachings relating to standards for assessing visual acuity. In certain embodiments, the subject's visual acuity improves by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% as compared prior to undergoing treatment.

(42) In some embodiments, the subject is tested for one or more corneal dystrophies. In some embodiments, the subject is tested for a nucleic acid mutation, such as SNP, associated with corneal dystrophy described herein.

(43) For example, the subject is tested for a nucleic acid mutation in a target TGF?I nucleic acid. In certain embodiments, the subject is tested for a nucleic acid mutation encoding for an amino acid substitution of arginine 124, arginine 555, or histidine 626 in a TGF?I polypeptide. In some embodiments, the nucleic acid mutation encodes for an amino acid substitution selection from R124C, R124H, R124L, R555W, R555Q, and H626P. For example, buccal cells of the subject are collected using a buccal swab. The collected buccal cells are analyzed for the presence of one or more nucleic acid mutations encoding for an amino acid substitution of arginine 124, arginine 555, or histidine 626 in a TGF?I polypeptide. In some embodiments, corneal dystrophy is detected, for example, through detection of Avellino corneal dystrophy-related single nucleotide polymorphisms (SNPs), such as those that result in R124 mutations in the TGF?I gene (including for example but not limited to an R124H mutation caused by a G to A transition at nucleotide 418 of TGF?I gene also referred to as a C(G/A)C SNP). In some embodiments, corneal dystrophy is detected for example through detection of granular corneal dystrophy-related SNPs, such as those that result in R555 mutations in the TGF?I gene (including for example but not limited to an R555W mutation caused by a C to T transition at nucleotide 1663 of TGF?I gene also referred to as a (C/T)GG SNP). In some embodiments, corneal dystrophy is detected for example through detection of lattice dystrophy-related SNPs, such as those that result in R124 and/or 626 mutations in the TGF?I gene (including for example but not limited to an R124C mutation caused by a C to T transition at nucleotide 417 of TGF?I gene also referred to as a (C/T)GC SNP or a H626P mutation caused by an A to C transition at nucleotide 1924 of TGF?I gene. In some embodiments, corneal dystrophy is detected for example through detection of Reis-Buckler corneal dystrophy-related SNPs, such as those that result in R124 mutations in the TGF?I gene (including for example but not limited to an R124L mutation caused by a G to T transition at nucleotide 418 of TGF?I gene also referred to as a C(G/T)C SNP). In some embodiments, corneal dystrophy is detected for example through detection of Thiel-Behnke corneal dystrophy-related SNPs, such as those that result in R555 mutations in the TGF?I gene (including for example but not limited to an R555Q mutation caused by a G to A transition at nucleotide 1664 of TGF?I gene also referred to as a C(G/A)G SNP). In some embodiments, the subject is tested for a nucleic acid mutation in a corneal dystrophy target nucleic acid associated with keratoconus. In certain embodiments, the corneal dystrophy target nucleic acid is COL4A1-4, LOX, SPARC, LRRN1, HGF, AKAP13, ZNF469, ATG12P2, GS1-256O22.5, PLEKHA6, APOL4, SLC44A3, SLC6A18, SLC29A3, RANBP3L, KCNMA1, MUC5AC, CROCC, ATHL1, or PLP1.

(44) In some embodiments, the subject is tested for one or more corneal dystrophies prior to transplanting one or more manipulated stem cells into the subject.

(45) III. Stem Cells

(46) The subject methods include obtaining a plurality of stem cells. Any suitable stem cells can be used for the subject method, depending on the type of corneal dystrophy to be treated. In certain embodiments, the stem cell is obtained from an autologous, homologous or heterologous donor. When the stem cell is obtained from the heterologous donor, the stem cells of the heterologous donor and the subject to be treated are donor-recipient histocompatible. In certain embodiments, autologous stem cells are obtained from the subject in need of the treatment for corneal dystrophy. Obtained stem cells carry a mutation in a gene associated with the particular corneal dystrophy to be treated (e.g., stem cells having a mutation in a TGFBI gene of a subject having an epithelial-stromal dystrophy, as discussed above). Suitable stem cells include, but are not limited to, dental pulp stem cells, hair follicle stem cells, mesenchymal stem cells, umbilical cord lining stem cells, embryonic stem cells, oral mucosal epithelial stem cells and limbal epithelial stem cells.

(47) In some embodiments, the plurality of stem cells includes limbal epithelial stem cells. Limbal epithelial stem cells (LESCs) are located in the limbal region of the cornea and are responsible for the maintenance and repair of the corneal surface. Without being bound by any particular theory of operation, it is believed that LESCs undergo asymmetric cell division producing a stem cell that remains in the stem cell niche to repopulate the stem cell pool, and a daughter early transient amplifying cell (eTAC). more differentiated eTAC is removed from the stem cell niche and is able to divide to further produce transient amplifying cells (TAC), eventually giving rise to terminally differentiated cells (DC). LESCs can be obtained, for example, by taking a biopsy from the subject's eye. See, e.g., Pellegrini et al., Lancet 349: 990-993 (1997). LESCs obtained from limbal biopsies can be isolated and sorted for use in the subject methods using any suitable technique including, but not limited to, fluorescence activated cell sorting (FACS) and centrifugation techniques. LESCs can be sorted from biopsies using positive expression of stem cell associated markers and negative expression of differentiation markers. Positive stem cell markers include, but are not limited to, transcription factor p63, ABCG2, C/EBP? and Bmi-1. Negative corneal specific markers include, but are not limited to, cytokeratin 3 (CK3), cytokeratin 12 (CK12), connexin 43, and involucrin. In some embodiments, the plurality of stem cells is positive for expression of p63, ABCG2 or combinations thereof. In certain embodiments, at least 65%, 70%, 75%, 80%. 85%, 86%. 88%. 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the cells in the plurality of stem cells express p63, ABCG2, C/EBP? and Bmi-1 or combinations thereof. In some embodiments, the plurality of stem cells is negative for expression of CK3, CK12, connexin 43, involucrin or combinations thereof. In certain embodiments, at least 65%, 70%, 75%, 80%. 85%, 86%. 88%. 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the cells in the plurality of stem cells do not express CK12, connexin 43, involucrin or combinations thereof. Other markers useful for LESC are described, for example, in Takacs et al., Cytometry A 75: 54-66 (2009), which is incorporated by reference in its entirety for all purposes, and particularly for all teachings relating to LESC markers. Stem cell features such as cell size and high nuclear to cytoplasmic ratio can also be used to aid in the identification of LESCs.

(48) In addition to LESCs, other stem cells isolated from the subject's cornea can also be used with the subject methods. Exemplary corneal stem cells include, but are not limited to, stromal stem cells, stromal fibroblast-like cells, stromal mesenchymal cells, neural crest derived corneal stem cells, and putative endothelial stem cells.

(49) In some embodiments, the cells used with the methods described herein are stromal stem cells obtained from a subject's cornea. For example, stromal stem cells can be isolated using any suitable method including, but not limited to, those described in Funderburgh et al., FASEB J 19: 1371-1373 (2005); Yoshida et al., Invest Ophtalmol Vis Sci 46: 1653-1658 (2005); Du et al. Stem Cells 1266-1275 (2005); Dravida et al., Brain Res Dev Brain Res 160:239-251 (2005); and Polisetty et al. Mol Vis 14: 431-442 (2008), which are incorporated by reference in their entirety for all purposes, and particularly for all teaching relating to the isolation and culturing of various stromal stem cells.

(50) Markers that are characteristic of these stromal stem cells include, but are not limited to, Bmi-1, Kit, Notch-1, Six2, Pax6, ABCG2, Spag10, and p62/OSIL. In some embodiments, at least 65%, 70%, 75%, 80%. 85%, 86%. 88%. 89%, 90%, 91% 92%, 93%, 94%, >95%, 96%, 97%, 98% or 99% of cells in the plurality of stem cells express Bmi-1, Kit, Notch-1, Six2, Pax6, ABCG2, Spag10, or p62/OSIL or combinations thereof. In certain embodiments, the stromal stem cells are positive for CD31, SSEA-4, CD73, CD105 and negative for CD34, CD45, CD123, CD133, CD14, CD106 and HLA-DR. In certain embodiments, at least 65%, 70%, 75%, 80%. 85%, 86%. 88%. 89%, 90%, 91% 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of cells in the plurality of stem cells are positive for CD31, SSEA-4, CD73, CD105 and negative for CD34, CD45, CD123, CD133, CD14, CD106 and HLA-DR. In yet other embodiments, the stromal step cells are positive for CD105, CD106, CD54, CD166, CD90, CD29, CD71, Pax6 and negative for SSEA-1, Tra1-81, Tra1-61, CD31, CD45, CD11a, CD11c, CD14, CD138, Flk1, Flt1, and VE-cadherin. In certain embodiments, at least 65%, 70%, 75%, 80%. 85%, 86%. 88%. 89%, 90%, 91% 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of cells in the plurality of stem cells are positive for CD105, CD106, CD54, CD166, CD90, CD29, CD71, Pax6 and negative for SSEA-1, Tra1-81, Tra1-61, CD31, CD45, CD11a, CD11c, CD14, CD138, Flk1, Flt1, and VE-cadherin.

(51) In certain embodiments, the cells used with the subject methods are endothelial stem cells isolated from the subject's cornea. Methods of isolating such stem cells are described, for instance, in Engelmann et al., Invest Ophthalmol Vis Sci 29: 1656-1662 (1988), which is incorporated by reference in their entirety for all purposes, and particularly for all teachings relating to the isolating and culturing of corneal endothelial stem cells.

(52) After isolation, the plurality of stem cells (e.g., LESCs) can be cultured using any suitable method to produce a stable cell line. The stem cells may be cultured before and/or after the manipulation of a nucleic acid mutation described herein. For instance, cultures can be maintained in the presence or absence of fibroblast cells (e.g., 3T3) as feeder cells. In other instances, human amniotic epithelial cells or human embryonic fibroblasts are used as feeder layers for cultures. Suitable techniques for the culturing of LESCs are further described in Takacs et al. Cytometry A 75: 54-66 (2009), Shortt et al., Surv Opthalmol Vis Sci 52: 483-502 (2007); and Cauchi et al. Am J Ophthalmol 146: 251-259 (2008), which are incorporated by reference in their entirety for all purposes, and particularly for all teachings relating to the culturing of LESCs.

(53) IV. Nucleic Acid Manipulation Reagents

(54) In one aspect, a nucleic acid mutation in a stem cell is manipulated to correct the nucleic acid mutation in a corneal dystrophy target nucleic acid. As used herein, a corneal dystrophy target nucleic acid refers to a nucleic acid that includes a mutation associated with one or more of the corneal dystrophies.

(55) In some embodiments, the corneal dystrophy target nucleic acid is located in TGFBI, KRT3, KRT12, GSN, and UBIAD1 gene. In some embodiments, the corneal dystrophy target nucleic acid is associated with a SNP site resulting in encoding a mutant amino acid in a mutant protein as shown herein. In further embodiments, a mutant sequence comprising the SNP site encodes a mutant protein selected from the group consisting of (i) mutant TGFBI proteins comprising a mutation corresponding to Leu509Arg, Arg666Ser, Gly623Asp, Arg555G1n, Arg124Cys, Val505Asp, Ile522Asn, Leu569Arg, His572Arg, Arg496Trp, Pro501Thr, Arg514Pro, Phe515Leu, Leu518Pro, Leu518Arg, Leu527Arg, Thr538Pro, Thr538Arg, Val539Asp, Phe540del, Phe540Ser, Asn544Ser, Ala546Thr, Ala546Asp, Phe547Ser, Pro551G1n, Leu558Pro, His572del, Gly594Val, Val613del, Val613Gly, Met619Lys, Ala620Asp, Asn622His, Asn622Lys, Asn622Lys, Gly623Arg, Gly623Asp, Val624 Val625del, Val624Met, Val625Asp, His626Arg, His626Pro, Val627SerfsX44, Thr629_Asn630insAsnValPro, Val631Asp, Arg666Ser, Arg555Trp, Arg124Ser, Asp123delins, Arg124His, Arg124Leu, Leu509Pro, Leu103Ser104del, Val113Ile, Asp123His, Arg124Leu, and/or Thr125_Glu126del in TGFBI, for example, of Protein Accession No. Q15582; (ii) mutant KRT3 proteins comprising a mutation corresponding to Glu498Val, Arg503Pro, and/or Glu509Lys in Keratin 3 protein, for example, of Protein Accession No. P12035 or NP 476429.2; (iii) mutant KRT12 proteins with Met129Thr, Met129Val, Gln130Pro, Leu132Pro, Leu132Va, Leu132His, Asn133Lys, Arg135Gly, Arg135Ile, Arg135Thr, Arg135Ser, Ala137Pro, Leu140Arg, Val143Leu, Va1143Leu, Lle391Leu399dup, Ile 426Val, Ile 426Ser, Tyr429Asp, Tyr429Cys, Arg430Pro, and/or Leu433Arg in KRT12, for example, of Protein Accession No. Q99456.1 or NP 000214.1; (iv) mutant GSN proteins with Asp214Tyr in GSN, for example, of Protein Accession No. P06396; and (v) mutant UBIAD1 proteins comprising a mutation corresponding to Ala97Thr, Gly98Ser, Asn102Ser, Asp112Asn, Asp112Gly, Asp118Gly, Arg119Gly, Leu121Val, Leu121Phe, Val122Glu, Val122Gly, Ser171Pro, Tyr174Cys, Thr175Ile, Gly177Arg, Lys181Arg, Gly186Arg, Leu188His, Asn232Ser, Asn233His, Asp236Glu, and/or Asp240Asn in UBIAD1, for example, of Protein Accession No. Q9Y5Z9.

(56) In certain embodiments, the corneal dystrophy target nucleic acid is associated with granular corneal dystrophy type II (e.g., TGF?I). In other embodiments, the corneal dystrophy target nucleic acid is associated with keratoconus. Without being bound by any particular theory of operation, it is believed that the mutations depicted in FIG. 2 are associated with keratoconus. In certain embodiments, the corneal dystrophy target nucleic acid includes one or more of the mutations depicted in FIG. 2.

(57) Stem cells to be manipulated include individual isolated stem cells or stem cells from a stem cell line established from the isolated stem cells. Any suitable genetic manipulation method may be used to correct the nucleic acid mutation in the stem cells.

(58) In certain embodiments, nucleic acid manipulation reagents are introduced into the stem cells. Such nucleic acid manipulation reagents subsequently correct the nucleic acid mutation in the stem cell to form manipulated stem cells. Nucleic acid manipulation reagents include, but are not limited to Zing-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system reagents. See, e.g., Gaj et al., Trends Biotechnol 31(7): 397-405 (2013), which is incorporated by reference in its entirety for all purposes, and particularly for all teaching relating to nucleic acid manipulation reagents. Such reagents work by enabling efficient and precise modification of a target nucleic acid by inducing target DNA double-strand breaks (DSBs) that stimulate the cellular DNA repair mechanism, including error-prone non-homologous end joining (NHEJ) and/or homology directed repair (HDR) pathways. In the presence of a homology repair nucleic acid that contains a wild type allele of the nucleic acid mutation (e.g., a wild-type TGFBI or fragment thereof), the nicked target nucleic acid undergoes homologous recombination, thereby replacing the mutant allele with the wild type allele and correcting the nucleic acid mutation in the manipulated stem cell.

(59) In some instances, the target nucleic acid manipulation reagents used with the subject methods provided herein include CRISPR system reagents. CRISPR system reagents used with the subject methods include, for example, a nucleic acid encoding a Type II nuclease (e.g., Cas9 nuclease or a CpfI nuclease), a nucleic acid encoding a guide RNA (gRNA) and a repair nucleic acid that includes a wild type allele of the gene of interest or fragment thereof. The guide RNA includes a CRISPR RNA (crRNA) in combination with a trans-activating CRISPR RNA (tracrRNA). In some embodiments that utilize CRISPR system reagents, the crRNA and tracrRNA are included as separate reagents in lieu of a guide RNA.

(60) In some embodiments, the repair nucleic acid is capable of undergoing homologous recombination by the HDR pathway at a region of a stem cell genome that includes a mutation associated with a corneal dystrophy as described herein (i.e., a corneal dystrophy target nucleic acid). In certain embodiments, the repair nucleic acid is able to homologously recombine with a target nucleic acid within the TGFBI, KRT3, KRT12, GSN, and UBIAD1 gene. In particular embodiments, the repair nucleotide molecule is able to homologously recombine with a nucleic acid in the TGFBI gene encoding a mutant amino acid described herein (e.g. Leu132Pro). In some embodiments, the at least one vector includes multiple repair nucleic acids. The repair nucleic acid may further include a label for identification and sorting of cells described herein containing the specific mutation. Exemplary labels that can be included with the repair nucleotide molecule include fluorescent labels and nucleic acid barcodes that are identifiable by length or sequence.

(61) Nucleic acids encoding the Type II nuclease and guide RNA may each be operably linked to a regulatory element and may be included on a single vector or on different vectors. In some embodiments, the guide RNA and the Type II nuclease are included on the same vector. In some embodiments, the guide RNA and Type II nuclease are included on different vectors.

(62) In some exemplary embodiments, the vectors that include the nucleic acids encoding the guide RNA and/or Type-II nuclease are capable of stable integration into the cellular genome of one or more cells of the plurality of stem cells. In some examples, the Type-II nuclease and guide RNA do not occur in nature together. Exemplary CRISPR system reagents and methods of use in the present invention are described in further detail, for example, in Shalem et al., Nature Reviews Genetics 16: 299-311 (2013); Zhang et al., Human Molecular Genetics 23(R1): R40-6 (2014); Zetsche et al. dx.doi.org/10.1016/j.ce11.2015.09.038 (2015) and Zhu et al. Cell 157: 1262-1278 (2014), which are herein incorporated by reference in their entirety for all purposes, and particularly for all teachings relating to CRISPR system reagents.

(63) In the CRISPR system, a gRNA/Type II nuclease complex is recruited to a genomic target sequence by the base-pairing between the gRNA sequence and the complement to the target nucleic acid. The binding of the gRNA/Type II nuclease complex localizes the Type II nuclease to the genomic target sequence so that the Type II nuclease can cut both strands of DNA causing a Double Strand Break (DSB).

(64) Repair of the DSB can occur through either (1) the Non-Homologous End Joining (NHEJ) DNA repair pathway or (2) the Homology Directed Repair (HDR) pathway. The NHEJ repair pathway often results in inserts/deletions (InDels) at the DSB site that can lead to frameshifts and/or premature stop codons, effectively disrupting the open reading frame (ORF) of the target nucleic acid, thereby decreasing the expression of the gene product encoded by the target nucleic acid. The HDR pathway requires the presence of a repair nucleic acid, which is used to fix the DSB. Specific nucleotide changes (e.g., a wild type allele) can be introduced into a targeted mutant gene by the use of HDR with a repair nucleic acid. The HDR pathway can be used, for example, to correct a mutation in a stem cell, where the mutation is linked to a corneal disorder described herein (e.g., TGFBI gene).

(65) In some embodiments, the nucleic acid manipulation reagents include a repair nucleic acid. The repair nucleic acid introduces a specific allele (e.g., a wild-type allele) into the genome of one or more cells of the plurality of stem cells upon repair of a Type II nuclease induced DSB through the HDR pathway. In some embodiments, the repair nucleic acid is a single stranded DNA (ssDNA). In other embodiments, the repair nucleic acid is introduced into the cell as a plasmid vector. In some embodiments, the repair nucleic acid is 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 50 to 55, 55 to 60, 60 to 65, 65 to 70, 70 to 75, 75 to 80, 80 to 85, 85 to 90, 90 to 95, 95 to 100, 100 to 105, 105 to 110, 110 to 115, 115 to 120, 120 to 125, 125 to 130, 130 to 135, 135 to 140, 140 to 145, 145 to 150, 150 to 155, 155 to 160, 160 to 165, 165 to 170, 170 to 175, 175 to 180, 180 to 185, 185 to 190, 190 to 195, or 195 to 200 nucleotides in length. In some embodiments, the repair nucleic acid is 200 to 300, 300, to 400, 400 to 500, 500 to 600, 600 to 700, 700 to 800, 800 to 900, 900 to 1,000 nucleotides in length. In other embodiments, the repair nucleic acid is 1,000 to 2,000, 2,000 to 3,000, 3,000 to 4,000, 4,000 to 5,000, 5,000 to 6,000, 6,000 to 7,000, 7,000 to 8,000, 8,000 to 9,000, or 9,000 to 10,000 nucleotides in length. In some embodiments, the repair nucleic acid is capable of undergoing homologous recombination by the HDR pathway at a region of a stem cell genome that includes a mutation associated with a corneal dystrophy as described herein (i.e., a corneal dystrophy target nucleic acid). In certain embodiments, the repair nucleic acid is able to homologously recombine with a target nucleic acid within the TGFBI gene. In particular embodiments, the repair nucleic acid is able to homologously recombine with a nucleic acid in the TGFBI gene that encodes for arginine 124, arginine 555, or histidine 626 in a TGF?I polypeptide. In certain embodiments, the repair nucleic acid is able to homologously recombine with a nucleic acid in the TGFBI gene that encodes for an amino acid substitution selection from R124C, R124H, R124L, R555W, R555Q, and H626P. In some embodiments, the repair nucleic acid comprises a nucleic acid encoding for arginine 124 of a TGF?I polypeptide. For example, the repair nucleic acid is used to insert cytosine at nucleotide 417 of a TGF?I gene (e.g., to correct a C to T transition at nucleotide 417 of TGF?I gene), guanine at nucleotide 418 of a TGF?I gene (e.g., to correct a G to A or G to T transition at nucleotide 418 of TGF?I gene). In certain embodiments, the repair nucleic acid comprises a nucleic acid encoding for arginine 555 of a TGF?I polypeptide. For example, the repair nucleic acid is used to insert cytosine at nucleotide 1663 of TGF?I gene (e.g., to correct a C to T transition at nucleotide 1663 of TGF?I gene) and to insert guanine at nucleotide 1664 of a TGF?I gene (e.g., to correct a G to A transition at nucleotide 1663 of TGF?I gene). In certain embodiments, the repair nucleic acid comprises a nucleic acid encoding for histidine 626 of a TGF?I polypeptide. For example, the repair nucleic acid is used to insert adenine to nucleotide 1924 of a TGF?I gene (e.g., to correct an A to C transition at nucleotide 1924 of TGF?I gene). In yet other embodiments, the repair nucleic acid comprises a nucleic acid encoding for arginine 124, arginine 555, and histidine 626 of a TGF?I polypeptide.

(66) In other embodiments, the repair nucleic acid is able to homologously recombine with a corneal dystrophy target nucleic acid is associated with keratoconus (e.g., a target nucleic acid that includes one or more of the mutations depicted in FIG. 2). In some embodiments, the corneal dystrophy target nucleic acid includes a mutation in COL4A1-4, LOX, SPARC, LRRN1, HGF, AKAP13, ZNF469, ATG12P2, GS1-256O22.5, PLEKHA6, APOL4, SLC44A3, SLC6A18, SLC29A3, RANBP3L, KCNMA1, MUC5AC, CROCC, ATHL1, or PLP1. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs3742207 (e.g., SNP identified by rs3742207 in the National Center for Biotechnology Information's dbSNP database). In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs3803230. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs9583500. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs7990383. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs55703767. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs11677877. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs2229813. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs1800449. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs1053411. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs2116780. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs3749350. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs2286194. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs12536657. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs2614668. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs745191. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs12598474. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs10932976. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs5908678. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs35803438. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs132728. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs132729. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs132730 In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs859063. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs2893276. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs6687749. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs13189855. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs6876514. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs6876515. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs13361701. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs883764. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs780667. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs780668. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs13166148. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs10941287. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs7907270. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs200922784. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs9435793. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs116300974. In some embodiments, the corneal dystrophy target nucleic acid includes a mutation that corresponds to reference SNP cluster identifier rs2233696.

(67) In some embodiments, the nucleic acid manipulation reagents include multiple repair nucleic acids. In certain embodiments, the repair nucleic acids comprise a nucleic acid encoding for arginine 124 of a TGF?I polypeptide and a nucleic acid encoding for arginine 555 of the TGF?I polypeptide. In some embodiments, the repair nucleic acids further comprise a nucleic acid encoding for histidine 626 of a TGF?I polypeptide. In some embodiments, the CRISPR system reagents used with the subject methods include a first nucleic acid encoding a first guide RNA for the nucleic acid encoding for arginine 124 of a TGF?I polypeptide and a second nucleic acid encoding a second guide RNA for the nucleic acid encoding for arginine 555 of a TGF?I polypeptide. In some embodiments, the CRISPR system reagents further include a third nucleic acid encoding a third guide RNA for the nucleic acid encoding for histidine 626. In some embodiments, the CRISPR system reagents further include any combination of the first nucleic acid, the second nucleic acid, and the third nucleic acid (e.g., a combination of the first nucleic acid and the third nucleic acid, or a combination of the second nucleic acid and the third nucleic acid). In some embodiments, the repair nucleic acid is capable of repairing a corneal dystrophy target nucleic acid that encodes for one or more amino acid substitutions that includes Q1334H in COL4A1, G683A in COL4A2, P718S in COL4A2, R517K in COL4A2, D326Y in COL4A3, H451R in COL4A3, V1327M in COL4A4, R158Q in LOX, A1046T in AKAP13, G624V in AKAP13, G2358R in ZNF469, S158F in SLC29A3, P4493S in MUC5AC, P370S in CROCC or combinations thereof.

(68) The repair nucleic acid may further include a label for identification and sorting of stem cells containing the specific mutation. Exemplary labels that can be included with the repair nucleic acid include fluorescent labels and nucleic acid barcodes that are identifiable by length or sequence.

(69) In further embodiments, the nucleic acid manipulation reagents also include one or more reagents that promote the HDR pathway over HNEJ repair of DSBs. Such reagents advantageously allow for the homologous recombination of the repair nucleic acid by the HDR pathway. Reagents that promote the HDR pathway over HNEJ repair of DSBs include, but are not limited to, agents that repress genes involved in HNEJ repair, for example, DNA ligase IV. See, e.g., Maruyana et al. Nat Biotechnol. 33(5): 538-42 (2015), which is herein incorporated by reference in its entirety for all purposes, and particularly for all teachings relating to agents that repress genes involved in HNEJ repair of DSBs.

(70) The Type II nuclease used with the subject methods provided herein may be an inducible Type II nuclease that is optimized for expression in a temporal or cell-type dependent manner. Inducible promoters that can be linked to the Type II nuclease include, but are not limited to tetracycline-inducible promoters, metallothionein promoters; tetracycline-inducible promoters, methionine-inducible promoters (e.g., MET25, MET3 promoters); and galactose-inducible promoters (GAL1, GAL7 and GAL10 promoters). Other suitable promoters include the ADH1 and ADH2 alcohol dehydrogenase promoters (repressed in glucose, induced when glucose is exhausted and ethanol is made), the CUP1 metallothionein promoter (induced in the presence of Cu.sup.2+, Zn.sup.2+), the PHO5 promoter, the CYC1 promoter, the HIS3 promoter, the PGK promoter, the GAPDH promoter, the ADC1 promoter, the TRP1 promoter, the URA3 promoter, the LEU2 promoter, the ENO promoter, the TP1 promoter, and the AOX1 promoter.

(71) Mutant Type II nucleases that exhibit improved specificity may also be used (see, e.g., Ann Ran et al. Cell 154(6) 1380-89 (2013), which is herein incorporated by reference in its entirety for all purposes, and particularly for all teachings relating to mutant Cas9 nucleases with improved specificity for target nucleic acids). The nucleic acid manipulation reagents can also include a deactivated Type II nuclease (e.g., dCas9). Deactivated Cas9 binding to nucleic acid elements alone may repress transcription by sterically hindering RNA polymerase machinery. Further, deactivated Cas may be used as a homing device for other proteins (e.g., transcriptional repressor, activators and recruitment domains) that affect gene expression at the target site without introducing irreversible mutations to the target nucleic acid. For example, dCas9 can be fused to transcription repressor domains such as KRAB or SID effectors to promote epigenetic silencing at a target site. Cas9 can also be converted into a synthetic transcriptional activator by fusion to VP16/VP64 or p64 activation domains.

(72) Nucleic acid manipulation reagents can be introduced into stem cells using any suitable method. Exemplary methods for introducing the nucleic acid manipulation reagents include, but are not limited to, transfection, electroporation and viral-based methods.

(73) In some cases, the one or more cell uptake reagents are transfection reagents. Transfection reagents include, for example, polymer based (e.g., DEAE dextran) transfection reagents and cationic liposome-mediated transfection reagents. Electroporation methods may also be used to facilitate uptake of the nucleic acid manipulation reagents. By applying an external field, an altered transmembrane potential in a cell is induced, and when the transmembrane potential net value (the sum of the applied and the resting potential difference) is larger than a threshold, transient permeation structures are generated in the membrane and electroporation is achieved. See, e.g., Gehl et al., Acta Physiol. Scand. 177:437-447 (2003).

(74) Nucleic acid manipulation reagents may also be delivered through viral transduction into the stem cells. Suitable viral delivery systems include, but are not limited to, adeno-associated virus (AAV) retroviral and lentivirus delivery systems. Such viral delivery systems are particularly useful in instances where the stem cell is resistant to transfection. Methods that use a viral-mediated delivery system may further include a step of preparing viral vectors encoding the nucleic acid manipulation reagents and packaging of the vectors into viral particles. Other method of delivery of nucleic acid reagents include, but are not limited to, lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of nucleic acids. See, also Neiwoehner et al., Nucleic Acids Res. 42:1341-1353 (2014), which is herein incorporated by reference in its entirety for all purposes, and particularly for all teachings relating to reagent delivery systems.

(75) In one aspect, the nucleic acid mutation in a corneal dystrophy target nucleic acid in a stem cell is manipulated by introducing an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system into the stem cell, wherein the CRISPR/Cas9 system comprises at least one vector comprising a nucleotide molecule encoding Cas9 nuclease and an single guide RNA (sgRNA), and the Cas9 nuclease and said sgRNA do not naturally occur together.

(76) The terms non-naturally occurring or engineered are used interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature. In some embodiments, the Cas9 nuclease and the sgRNA do not naturally occur together.

(77) The engineered CRISPR/Cas9 system can be introduced into cells using any suitable method known in the art and those described herein. In some embodiments, the introducing may comprise administering the engineered CRISPR/Cas9 system described herein to stem cells in culture, or in a host organism. As discussed above, exemplary methods for introducing the engineered CRISPR/Cas9 system include, but are not limited to, transfection, electroporation and viral-based methods. In some cases, the one or more cell uptake reagents are transfection reagents. Transfection reagents include, for example, polymer based (e.g., DEAE dextran) transfection reagents and cationic liposome-mediated transfection reagents. Electroporation methods may also be used to facilitate uptake of the nucleic acid manipulation reagents. By applying an external field, an altered transmembrane potential in a cell is induced, and when the transmembrane potential net value (the sum of the applied and the resting potential difference) is larger than a threshold, transient permeation structures are generated in the membrane and electroporation is achieved. See, e.g., Gehl et al., Acta Physiol. Scand. 177:437-447 (2003). The engineered CRISPR/Cas9 system also be delivered through viral transduction into the cells. Suitable viral delivery systems include, but are not limited to, adeno-associated virus (AAV), retroviral and lentivirus delivery systems. Such viral delivery systems are useful in instances where the cell is resistant to transfection. Methods that use a viral-mediated delivery system may further include a step of preparing viral vectors encoding the nucleic acid manipulation reagents and packaging of the vectors into viral particles. Other method of delivery of nucleic acid reagents include, but are not limited to, lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of nucleic acids. See, also Neiwoehner et al., Nucleic Acids Res. 42:1341-1353 (2014), and U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355, which are herein incorporated by reference in its entirety for all purposes, and particularly for all teachings relating to reagent delivery systems. In some embodiments, the introduction is performed by non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).

(78) In general, CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (Cas) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a direct repeat and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as crRNA herein, or a spacer in the context of an endogenous CRISPR system), and/or other sequences and transcripts from a CRISPR locus. As described above, sgRNA is a combination of at least tracrRNA and crRNA. In some embodiments, one or more elements of a CRISPR system is derived from a type II CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes or Staphylococcus aureus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, target sequence refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. In disclosure, target site refers to a site of the target sequence including both the target sequence and its complementary sequence, for example, in double stranded nucleotides. In some embodiments, the target site described herein may mean a first target sequence hybridizing to sgRNA or crRNA of CRISPR/Cas9 system, and/or a second target sequence adjacent to the 5-end of a PAM. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence is located within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast.

(79) The sgRNA may be artificial, man-made, synthetic, and/or non-naturally occurring. In some embodiments, the sgRNA comprises (i) CRISPR targeting RNA (crRNA) sequence and (ii) a trans-activating crRNA (tracrRNA) sequence, which also may be called sgRNA scaffold. In some embodiments, the crRNA sequence and tracrRNA sequence do not naturally occur together. As used herein, the term sgRNA may refer to a single guide RNA containing (i) a guide sequence (crRNA sequence) and (ii) a Cas9 nuclease-recruiting sequence (tracrRNA). The crRNA sequence may be a sequence that is homologous to a region in your gene of interest and may direct Cas9 nuclease activity. The crRNA sequence and tracrRNA sequence do not naturally occur together. The sgRNA may be delivered as RNA or by transforming with a plasmid with the sgRNA-coding sequence (sgRNA gene) under a promoter.

(80) In some embodiments, the sgRNA or the crRNA hybridizes to at least a part of a target sequence (e.g. target genome sequence), and the crRNA may have a complementary sequence to the target sequence. Complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. Substantially complementary as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%. 85%, 90%, 95%. 97%, 98%. 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions. As used herein, stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence, Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part 1, Second Chapter Overview of principles of hybridization and the strategy of nucleic acid probe assay, Elsevier, N.Y. Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self 17 hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the complement of the given sequence. As used herein, the term about may refer to a range of values that are similar to the stated reference value. In certain embodiments, the term about refers to a range of values that fall within 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 percent or less of the stated reference value. In additional embodiments, the crRNA or the guide sequence is about 17, 18, 19, 20, 21, or 22 nucleotide long. In further embodiments, the crRNA includes the nucleotide sequences of TAGGAAGCTAATCTATCATT (SEQ ID NO: 9). In additional embodiments, the crRNA excludes crRNA sequences having the nucleotide sequences of SEQ ID NO: 9. In yet further embodiments; the crRNA excludes crRNA sequences hybridizing to a nucleotide sequence comprising a SNP resulting in L132P mutation in kratin 12 protein. In yet further embodiments; the crRNA excludes crRNA sequences hybridizing to a nucleotide sequence comprising a SNP resulting in a mutation in keratin 12 protein.

(81) In some embodiments, tracrRNA provides a hairpin structure that activates Cas9 for opening up the dsDNA for binding of the crRNA sequence. The tracrRNA may have a sequence complementary to the palindromic repeat. When the tracrRNA hybridizes to the short palindromic repeat, it may trigger processing by the bacterial double-stranded RNA-specific ribonuclease, RNase III. In additional embodiments, the tracrRNA may have SPIDRs (SPacer Interspersed Direct Repeats), constitute a family of DNA loci that are usually specific to a particular bacterial species. The CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J. Bacteriol., 171:3553-3556 [1989]), and associated genes. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (See, Groenen et al., Mol. Microbiol., 10:1057-1065 [1993]; Hoe et al., Emerg. Infect. Dis., 5:254 263 [1999]; Masepohl et al., Biochim. Biophys. Acta 1307:26-30 [1996]; and Mojica et al., Mol. Microbiol., 17:85-93 [1995]). The CRISPR loci may differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojica et al., Mol. Microbiol., 36:244-246 [2000]). In certain embodiments, the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra). Although the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al., J. Bacteriol., 182:2393-2401 [2000]). The tracrRNA sequence may be any sequence for tracrRNA for CRISPR/Cas9 system known in the art. In additional embodiments, the tracrRNA comprises a nucleotide sequence having at least about 70, 75, 80, 85, 90, 95 or 100% sequence identity with the nucleotide sequence of SEQ ID NO: 2 and 6. Exemplary CRISPR/Cas9 systems, sgRNA, crRNA and tracrRNA, and their manufacturing process and use are disclosed in U.S. Pat. No. 8,697,359, U.S. Patent Application Publication Nos. 20150232882, 20150203872, 20150184139, 20150079681, 20150073041, 20150056705, 20150031134, 20150020223, 20140357530, 20140335620, 20140310830, 20140273234, 20140273232, 20140273231, 20140256046, 20140248702, 20140242700, 20140242699, 20140242664, 20140234972, 20140227787, 20140189896, 20140186958, 20140186919, 20140186843, 20140179770, 20140179006, 20140170753, 20140093913, 20140080216, and WO2016049024, all of which are incorporated herein by its entirety.

(82) In some embodiments, the Cas9 nucleases described herein are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2. The Cas9 nuclease may be a Cas9 homolog or ortholog. Mutant Cas9 nucleases that exhibit improved specificity may also be used (see, e.g., Ann Ran et al. Cell 154(6) 1380-89 (2013), which is herein incorporated by reference in its entirety for all purposes. and particularly for all teachings relating to mutant Cas9 nucleases with improved specificity for target nucleic acids). The nucleic acid manipulation reagents can also include a deactivated Cas9 nucleases (dCas9). Deactivated Cas9 binding to nucleic acid elements alone may repress transcription by sterically hindering RNA polymerase machinery. Further, deactivated Cas may be used as a homing device for other proteins (e.g., transcriptional repressor, activators and recruitment domains) that affect gene expression at the target site without introducing irreversible mutations to the target nucleic acid. For example, dCas9 can be fused to transcription repressor domains such as KRAB or SID effectors to promote epigenetic silencing at a target site. Cas9 can also be converted into a synthetic transcriptional activator by fusion to VP16/VP64 or p64 activation domains.

(83) In some embodiments, the Cas9 nucleases direct cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. Following directed DNA cleavage by the Cas9 nuclease, there are two modes of DNA repair available to the cell: homology directed repair (HDR) and non-homologous end joining (NHEJ). While seamless correction of the mutation by HDR following Cas9 cleavage close to the mutation site is attractive, the efficiency of method means that it could only be used for in vitro/ex vivo modification of stem cells or induced pluripotent stem cells (iPSC) with an additional step to select those cells in which repair had taken place and purify those modified cells only. HDR does not occur at a high frequency in cells. NHEJ occurs at a much higher efficiency and is suitable for the dominant-negative mutations described for many of the corneal dystrophies. In additional embodiments, the Cas9 nuclease is from Streptococcus. In yet additional embodiments, the Cas9 nuclease is from Streptococcus pyogenes, Streptococcus dysgalactiae, Streptococcus canis, Streptococcus equi, Streptococcus iniae, Streptococcus phocae, Streptococcus pseudoporcinus, Streptococcus oxalis, Streptococcus pseudoporcinus, Streptococcus infantarius, Streptococcus mutans, Streptococcus agalactiae, Streptococcus caballi, Streptococcus equinus, Streptococcus sp. oral taxon, Streptococcus mitis, Streptococcus gallolyticus, Streptococcus gordonii, or Streptococcus pasteurianus, or variants thereof. Such variants may include D10A Nickase, Spy Cas9-HF1 as described in Kleinstiver et al, 2016 Nature, 529, 490-495. In additional embodiments, the Cas9 nuclease is from Staphylococcus. In yet additional embodiments, the Cas9 nuclease is from Staphylococcus aureus, S. simiae, S. auricularis, S. carnosus, S. condimenti, S. massiliensis, S. piscifermentans, S. simulans, S. capitis, S. caprae, S. epidermidis, S. saccharolyticus, S. devriesei, S. haemolyticus, S. hominis, S. agnetis, S. chromogenes, S. fells, S. delphini, S. hyicus, S. intermedius, S. lutrae, S. micron, S. muscae, S. pseudintermedius, S. rostri, S. schleiferi, S. lugdunensis, S. arlettae, S. cohnii, S. equorum, S. gallinarum, S. kloosii, S. leei, S. nepalensis, S. saprophyticus, S. succinus, S. xylosus, S. fleurettii, S. lentus, S. sciuri, S. stepanovicii, S. vitulinus, S. simulans, S. pasteuri, S. warneri, or variants thereof.

(84) In additional embodiments, the Cas9 nuclease comprises an amino acid sequence having at least about 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 4 or 8. In yet further embodiments, the nucleotide molecule encoding Cas9 nuclease comprises a nucleotide sequence having at least about 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NO: 3 or 7.

(85) In some embodiments, the CRISPR/Cas9 system and the methods using the CRISPR/Cas9 system described herein alter a DNA sequence by the NHEJ. In additional embodiments, the CRISPR/Cas9 system or the at least one vector described herein does not include a repair nucleotide molecule. In some embodiments, the methods described herein alter a DNA sequence by the HDR described herein. In additional embodiments, HDR approach could be used in an ex vivo approach to gene therapy in MECD. In further embodiments, approach may not be allele specific and may be used to repair mutations in KRT12 codons 129, 130, 132, 133 and 135.

(86) In some embodiments, the engineered CRISPR/Cas9 system comprises (a) a first regulatory element operably linked to the sgRNA that hybridizes with the target sequence described herein, and (b) a second regulatory element operably linked to the nucleotide molecule encoding Cas9 nuclease, wherein components (a) and (b) are located on a same vector or different vectors of the system, the sgRNA targets (e.g., hybridizes with) the target sequence, and the Cas9 nuclease cleaves the DNA molecule. The target sequence may be a nucleotide sequence complementary to from 16 to 25 nucleotides adjacent to the 5 end of a PAM. Being adjacent herein means being within 2 or 3 nucleotides of the site of reference, including being immediately adjacent, which means that there is no intervening nucleotides between the immediately adjacent nucleotide sequences and the immediate adjacent nucleotide sequences are within 1 nucleotide of each other. In additional embodiments, the cell is a eukaryotic cell, or a mammalian or human cell, and the regulatory elements are eukaryotic regulators. In further embodiments, the cell is a stem cell described herein. In some embodiments, the Cas9 nuclease is codon-optimized for expression in a eukaryotic cell.

(87) In some embodiments, the first regulatory element is a polymerase III promoter. In some embodiments, the second regulatory element is a polymerase II promoter. The term regulatory element is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego. Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector comprises one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol I promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g. 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof, Examples of pol III promoters include, but are not limited to, U6 and H1 promoters. Examples of poi II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the ?-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1? promoter. Also encompassed by the term regulatory element are enhancer elements, such a WPRE; CMV enhancers; the R-U5 segment in LTR of HTLV-I (Mol. Cell Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit ?-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31. 1981).

(88) In some embodiments, the Cas9 nuclease provided herein is an inducible the Cas9 nuclease that is optimized for expression in a temporal or cell-type dependent manner. The first regulatory element may be an inducible promoter that can be linked to the Cas9 nuclease include, but are not limited to tetracycline-inducible promoters, metallothionein promoters; tetracycline-inducible promoters, methionine-inducible promoters (e.g., MET25, MET3 promoters); and galactose-inducible promoters (GAL1, GAL7 and GAL10 promoters). Other suitable promoters include the ADH1 and ADH2 alcohol dehydrogenase promoters (repressed in glucose, induced when glucose is exhausted and ethanol is made), the CUP1 metallothionein promoter (induced in the presence of Cu.sup.2+, Zn.sup.2+), the PHO5 promoter, the CYC1 promoter, the HIS3 promoter, the PGK promoter, the GAPDH promoter, the ADC1 promoter, the TRP1 promoter, the URA3 promoter, the LEU2 promoter, the ENO promoter, the TP1 promoter, and the AOX1 promoter.

(89) It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc. A vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).

(90) The term vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as expression vectors. Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which is, in some cases, selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). Advantageous vectors include lentiviruses and adeno-associated viruses, and types of such vectors can also be selected for targeting particular types of cells.

(91) Stem cells that have undergone a nucleic acid manipulation event (i.e., a manipulated stem cell) can be isolated using any suitable method. In some embodiments, the repair nucleic acid further comprises a nucleic acid encoding a selectable marker. In these embodiments, successful homologous recombination of the repair nucleic into a host stem cell genome is also accompanied by integration of the selectable marker. Thus, in such embodiments, the positive marker is used to select for manipulated stem cells. In some embodiments, the selectable marker allows the manipulated stem cell to survive in the presence of a drug that otherwise would kill the cell. Such selectable markers include, but are not limited to, positive selectable markers that confer resistance to neomycin, puromycin or hygromycin B. In addition, a selectable marker can be a product that allows a manipulated stem cell to be identified visually among a population of stem cells, some of which do not contain the selectable marker. Examples of such selectable markers include, but are not limited to the green fluorescent protein (GFP), which can be visualized by its fluorescence; the luciferase gene, which, when exposed to its substrate luciferin, can be visualized by its luminescence; and ?-galactosidase (?-gal), which, when contacted with its substrate, produces a characteristic color. Such selectable markers are well known in the art and the nucleic acid sequences encoding these markers are commercially available (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press 1989). Methods that employ selectable markers that can be visualized by fluorescence may further be sorted using Fluorescence Activated Cell Sorting (FACS) techniques.

(92) In some embodiments, isolated manipulated stem cells are used to establish cell lines for transplantation. The isolated manipulated cells can be cultured using any suitable method to produce a stable cell line. For instance, cultures can be maintained in the presence or absence of fibroblast cells (e.g., 3T3) as feeder cells. In other instances, human amniotic epithelial cells or human embryonic fibroblasts are used as feeder layers for cultures. In some embodiments, the manipulated stem cells are cultured on a feeder layer of fibroblast (e.g., 3T3 cells) in supplemented hormonal epithelial medium (SHEM). In certain embodiments, medium suitable for culturing the subject manipulated stem cells include one or more of the following components: fetal bovine serum, patient's autologous serum, EGF, insulin, transferrin, sodium selenite, hydrocortisone, cholera toxin subunit A, DMSO, triiodothyronine, antibiotics (e.g., penicillin/streptomycin and gentamycin) and antimycotic (e.g., amphotericin B). Suitable techniques for the culturing of LESCs are further described in Takacs et al. Cytometry A 75: 54-66 (2009), Shortt et al., Surv Opthalmol Vis Sci 52: 483-502 (2007); and Cauchi et al. Am J Ophthalmol 146: 251-259 (2008), which are incorporated by reference in their entirety for all purposes, and particularly for all teachings relating to the culturing of LESCs. Verification of the desired nucleic manipulation in the established cell lines can be carried out using any suitable technique, including, for example, selection of a selectable marker as discussed herein and nucleic acid sequence to confirm the sequence of the desired nucleic acid manipulation.

(93) V. Transplantation

(94) In one aspect, following isolation of manipulated stem cells and optional establishment or culture of a cell line from the manipulated stem cells, the manipulated stem cells are transplanted into the subject in need of treatment thereof. The manipulated stem cells can be transplanted in the subject using any suitable method.

(95) In some embodiments, a surgical graft for transplantation is developed from the manipulated cells that is subsequently transplanted into the subject. In certain embodiments, the manipulated stem cells are cultured on an amniotic membrane for a period of time sufficient for the manipulated stem cells to expand to an appropriate area sized for transplantation. Confirmation of growth can be done by various methods including direct observation, whole mount stained preparation, histopathology, immunohistochemistry, thymidine incorporation and by flow cytometry using markers for cell cycle. The cultured manipulated stem cells can then be transplanted directly with the amniotic membrane. In other embodiments, the manipulated stem cells are separated from the amniotic membrane and transplanted onto a non-amniotic membrane carrier to obtain a surgical graft. Suitable carriers include, but are not limited to paraffin gauze, contact lenses, collage shields, biopolymers, fibrin gels and anterior lens capsules.

(96) Following transplantation, assessment of visual function in the subject can be carried out using any suitable test known in the art, including but not limited to assessments of uncorrected visual acuity (UCVA), best-corrected visual acuity (BCVA) and brightness acuity test (BAT). See, e.g., Awaad et al., Am J Ophthalmol. 145(4): 656-661 (2008) and Sharhan et al., Br J Ophthalmol 84:837-841 (2000), which are incorporated by reference in their entirety for all purposes, and particularly for all teachings relating to standards for assessing visual acuity. In certain embodiments, the subject's visual acuity improves by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% as compared prior to undergoing treatment.

(97) In some embodiments, the method further includes repeating transplanting of the one or more manipulated stem cells into the subject at one or more predetermined frequencies (e.g., weekly, monthly, quarterly, biannually, annually, etc.).

(98) VI. Kits

(99) In another aspect, provided herein are kits that include nucleic acid manipulation reagents for the treatment of the corneal dystrophy. In some embodiments, the kit includes CRISPR reagents, for example, one or more guide RNAs that target the nucleic acid of interest, and a nuclease (e.g., Type-II nuclease). In additional embodiments, the kit also includes a repair nucleic acid that includes a wild-type allele of the mutation to be repaired as described herein. In some embodiments, the kit includes agents that facilitate uptake of the nucleic acid manipulation by cells, for example, a transfection agent or an electroporation buffer. In some embodiments, the subject kits provided herein include one or more reagents for the detection or isolation of stem cells, for example, labeled antibodies for one or more positive stem cell markers that can be used in conjunction with FACS.

EXAMPLES

(100) The following examples are presented to illustrate various embodiments of the invention. It is understood that such examples do not represent and are not intended to represent exclusive embodiments; such examples serve merely to illustrate the practice of invention.

(101) Mutation analysis: Mutations associated with various corneal dystrophies were analyzed to determine which were solely missense mutations or in-frame indels. analysis indicates that for the majority of K12 and TGFBI disease, nonsense or frameshifting indel mutations are not associated with disease. Furthermore, an analysis of the exome variant database confirmed that any naturally occurring nonsense, frameshifting indels or splice site mutations found in these genes are not reported to be associated with disease in these individuals.

(102) Mutation analysis revealed that the following corneal-dystrophy genes are suitable for targeted nuclease gene therapy (Table 1).

(103) TABLE-US-00001 TABLE 1 Genes and their associated corneal dystrophies that are suitable for a CRISPR/Cas9 mediated approach. Gene Associated Corneal Dystrophies TGFBI Avellino corneal dystrophy Reis-B?cklers corneal dystrophy Thiel-Behnke corneal dystrophy Grayson -Wilbrandt corneal dystrophy Lattice Corneal Dystrophy I & II Granular Corneal Dystrophy I, II & III Epithelial Basement Membrane Dystrophy KRT3 Meesmann Epithelial Corneal Dystrophy KRT12 Meesmann Epithelial Corneal Dystrophy UBIAD1 Schnyder corneal dystrophy

(104) An investigation of the suitable corneal dystrophy genes was conducted for report to determine the number of mutations targetable by either a PAM-specific approach or a guide allele-specific approach. A PAM-specific approach requires the disease causing SNP to generate a novel PAM, whilst the allele specific approach involves the design of a guide containing the disease causing SNP.

(105) All non-disease causing SNPs in TGFBI that generate a novel PAM with a minor allele frequency (MAF) of >10% were identified. The selection of SNPs with a MAF of >10% may provide a reasonable chance that the SNP resulting in a novel PAM will be found in cis with the disease causing mutation. All variants within TGFBI were analyzed to determine whether a novel PAM was created (Table 2). Previous reports demonstrate permanent inactivation of the mutant allele using approach (Shin et al., 2016. Human Molecular Genetics).

(106) TABLE-US-00002 TABLE2 ThevariantswithinTGFBIthatresultinanovelPAMthathavea MAFof>10%. NovelPAM (Required Exon variant Number Position SNP Variant underlined) MAF 1 b/w1&2 Intronicvariant,1507bp rs756462 T/C ccc 0.31 2 b/w2&3 Intronicvariant rs1989972 A/C atccca 0.43 Intronicvariant,1945bp rs1989972 A/C ccc 0.43 Intronicvariant,966bp rs3805700 A/G agg 0.41 3 b/w3&4 4 b/w4&5 5 b/w5&6 6 Synonymousvariant rs1442 G/C CCT 0.32 b/w6&7 Intronicvariant,119bp rs764567 A/G cgg 0.3 Intronicvariant,119bp rs764567 A/G gcgggt 0.3 Intronicvariant,268bp rs2073509 T/G ggg 0.4 Intronicvariant,268bp rs2073509 T/G cagggt 0.4 Intronicvariant,784bp rs2073511 T/C cct 0.4 Intronicvariant,685bp rs916951 A(ances- cgg 0.37 tral)/ C/G 7 b/w7&8 Intronicvariant,509bp rs1137550 T/C actctg 0.37 8 Synonymousvariant rs1054124 A/G TGG 0.39 b/w8&9 Intronicvariant,207bp rs6889640 C/A actctc 0.37 9 b/w9&10 10 b/w10&11 Intronicvariant,43bp rs6860369 A/G gag 0.4 11 b/w11&12 12 b/w12&13 Intronicvariant,713bp rs6871571 A/G ttgaat 0.42 13 b/w13&14 Intronicvariant,530bp rs6893691 A/G cgg 0.39 Intronicvariant,640bp rs1990199 G/C cca 0.39 Intronicvariant,659bp rs6894815 G/C ccc 0.42 Intronicvariant,230bp rs10064478 T/G cgg 0.42 14 b/w14&15 Intronicvariant,44bp rs6880837 T/C cca 0.41 15 b/w15&16 16 b/w16&17 17 The novel PAM is shown with the required variant indicated with an underline.

(107) In Table 2, b/w indicates that the variant (e.g., mutation) is located between two exons. For example, b/w 1 & 2 means that the variant is located between exon 1 and exon 2 (e.g., the variant is located in intron), as shown in FIG. 3. In FIG. 3, the numbered boxes indicate the exons within TGFBI. The hotspots in TGFBI, where multiple disease-causing mutations are found, are shown by the red boxes. Each blue arrow indicates the position of a SNP that generates a novel PAM. The novel PAM is shown for each arrow, with the required variant highlighted in red.

(108) Constructs: Three plasmids expressing Cas9 and an sgRNA were used throughout all experiments. The non-targeting plasmid used was pSpCas9(BB)-2A-Puro (PX459) (Broad Institute, MIT; Addgene plasmid 48139; FIG. 4). Following a published protocol (Ran F A, et al., Nat Protoc 2013; 8: 2281-2308), the plasmid containing the sgRNA specific to the K12-L132P allele was designed by annealing and cloning the following 2 primers (Life Technologies, Paisley, UK): 5-CACCGTAGGAAGCTAATCTATCATT-3 (SEQ ID NO: 10) and 5-AAACAATGATAGATTAGCTTCCTAC-3 (SEQ ID NO: 11) into pSpCas9(BB)-2A-Puro. sgRNA corresponds to the 20 nucleotides directly 3 of the allele-specific PAM found on the K12-L132P allele (FIG. 5, red), hereafter named sgK12LP. A Cas9/sgRNA plasmid to target both wild-type and mutant K12 sequences was constructed (Sigma, Gillingham, UK) and used as a positive control (FIG. 5, green).

(109) Additional K12 expression constructs previously described were used to assess allele specificity and potency. Firefly luciferase plasmids with the full mRNA sequence for either K12-WT or K12-L132P inserted 3 of the stop codon, hereafter named as K12WT-Luc and K12LP-Luc, respectively (Liao H, et al. PLoS One 2011; 6: e28582.), and expression plasmids for mature haemagglutinin (HA)-tagged K12-WT and K12-L132P protein (Courtney D G, et al. Invest Ophthalmol Vis Sci 2014; 55: 3352-3360.) with plasmids hereafter known as K12WT-HA and K12LP-HA, respectively, were used. An expression construct for Renilla luciferase (pRL-CMV, Promega, Southampton, UK) was used for the dual-luciferase assay to normalize transfection efficiency.

(110) Dual-luciferase assay: A dual-luciferase assay was used to quantify potency and allele-specificity of the three test sgRNAs in exogenous constructs, using methods adapted as previously described (Courtney D G, et al. Invest Ophthalmol Vis Sci 2014; 55: 977-985; Allen EHA, et al. Invest Ophthalmol Vis Sci 2013; 54: 494-502; Atkinson S D, et al. J Invest Dermatol 2011; 131: 2079-2086). In short, HEK AD293 cells (Life Technologies) were transfected using Lipofectamine 2000 (Life Technologies) with both K12WT-Luc or K12LP-Luc expression constructs and sgNSC, sgK12 or sgK12LP constructs at a ratio of 1:4. Cells were incubated for 72 h before being lysed and the activities of both Firefly and Renilla luciferase quantified. In all, eight replicates were carried out for each transfection condition.

(111) Western blotting: HA-tagged wild-type (K12WT-HA) and mutant (K12LP-HA) expression constructs (Liao H, et al. PLoS One 2011; 6: e28582.) were transiently co-transfected with each of the sgRNAs at a ratio of 1:4 into HEK AD293 cells in duplicate using Lipofectamine 2000 (Invitrogen), using similar methods as previously described (Courtney D G, et al. Invest Ophthalmol Vis Sci 2014; 55: 977-985; Allen EHA, et al. Invest Ophthalmol Vis Sci 2013; 54: 494-502). Transfected cells were incubated for 72 h. Expression of HA-tagged K12 and ?-actin was analyzed using a rabbit polyclonal antibody to HA (Abcam, Cambridge, UK; ab9110, 1:2000) and a mouse monoclonal antibody to human ?-actin (Sigma, 1:15 000) using standard methods (Courtney D G, et al. Invest Ophthalmol Vis Sci 2014; 55: 977-985; Allen EHA, et al. Invest Ophthalmol Vis Sci 2013; 54: 494-502). Membranes were incubated with a secondary horseradish peroxide-conjugated polyclonal swine anti-rabbit antibody (DakoCytomation, Ely, UK) or a horseradish peroxide-conjugated goat anti-mouse antibody (DakoCytomation), respectively. Protein binding was detected by standard chemiluminescence (Life Technologies). Densitometry was performed using ImageJ (Schneider C A, Rasband W S, Eliceiri K W. Nat Methods 2012; 9: 671-675), to quantify the band intensity of the HA-tagged K12 (n=4). was normalized to the band intensity of ?-actin.

(112) Quantitative real-time PCR: Transfections were carried out in the same manner as described for western blotting; however, both K12WT-HA and K12LP-HA were simultaneously transfected into cells. All transfections were carried out in triplicate. Following transfection, cells were incubated for 48 h and RNA extracted using the RNAeasy Plus kit (Qiagen, Venlo, The Netherlands). Following cDNA conversion of 500 ng of RNA (Life Technologies) quantitative real-time PCR was performed to quantify levels of KRT12 mRNA. A KRT12 assay was used (assay Id 140679; Roche, West Sussex, UK) alongside an HPRT assay (assay ID 102079; Roche) and a GAPDH assay (assay ID 141139; Roche). Each sample was run in triplicate for each assay and relative gene expression was calculated using the ??CT method (Livak K J, Schmittgen T D. Methods 2001; 25: 402-408). KRT12 expression levels were normalized against HPRT and GAPDH, where expression of both reference genes was deemed to be stable across treatment groups, using the BestKeeper software tool (Pfaffl M W, Tichopad A, Prgomet C, Neuvians T P. Biotechnol Lett 2004; 26: 509-515).

(113) Pyrosequencing: Using the same cDNA samples assessed by quantitative reverse transcriptase-PCR, pyrosequencing was carried out to determine the ratio of remaining K12-L132P mRNA to K12-WT mRNA, exactly as described previously (Courtney D G, et al. Invest Ophthalmol Vis Sci 2014; 55: 3352-3360).

(114) KRT12 transgenic mouse: A C57 mouse model was obtained, with a human K12-L132P allele knocked in to replace the endogenous mouse Krt12 coding sequence. allowed for the in-vivo targeting of KRT12-L132P by the allele-specific sgRNA and Cas9. Female heterozygous mice at 24 weeks old were used, where one copy of the human K12-L132P allele and one copy of murine Krt12 were present. Standard PCR and Sanger dideoxynucleotide sequencing was used to genotype the mice and confirm heterozygosity of the K12-L132P allele. Randomization of animals was not required, as study investigated the effect of treatment on one cornea, whereas the other cornea of the same animal was used as the negative control. Investigators were not blinded in study. All experimentation complied with ethical regulations and was approved by the local ethics committee.

(115) In-vivo intrastromal ocular injection: To achieve transient expression of the allele-specific sgRNA and the Cas9, the sgK12LP plasmid was introduced into the corneal stroma of the heterozygous knock-in mice by intrastromal ocular injection, following previously described protocols (Moore J E, McMullen C B T, Mahon G, Adamis A P. DNA Cell Biol 21: 443-451). To assess delivery method, wild-type mice were first injected with 4 ?g of a Cas9-GFP plasmid (pCas9D10A_GFP) (Addgene plasmid 44720). Mice were culled at 24, 48 and 72 h, and corneas fixed in 4% paraformaldehyde and processed using standard histological procedures. Five-micrometer-thick sections were cut, rehydrated and imaged by fluorescent microscopy. Mice were administered with general anesthetic and a local anesthetic to the cornea. A qualified ophthalmologist injected 4 ?g of sgK12LP or sgNSC plasmid diluted in a total of 3 ?l phosphate-buffered saline into the cornea of the right eye and the left eye, respectively, of four mice. Mice were culled 48 h post treatment.

(116) Sequencing and determination of NHEJ: Once the mice were culled, the eyes were enucleated and the corneas were dissected. gDNA was extracted using a DNA extraction kit (Qiagen) and samples were pooled into two treatment groups: sgK12LP and sgNSC. Samples underwent PCR amplification using the following two primers to amplify the region around the K12-L132P mutation: 5-ACACCCATCTTGCAGCCTAT-3 (SEQ ID NO: 12) and 5-AAAATTCCCAAAGCGCCTC-3 (SEQ ID NO: 13). PCR products were gel purified and ligated into the CloneJet cloning vector (Life Technologies) and were used to transform DH5? competent cells (Life Technologies). A total of 13 clones were selected and plasmid DNA prepared using a miniprep kit (Qiagen) following manufacturer's procedures. DNA from the 13 clones was then sequenced (Department of Zoology, University of Oxford) using the sequencing primers provided with the CloneJet vector. The two most likely exonic off-target sites for sgK12LP in the mouse genome, as predicted by the Zhang Lab online tool (crispr.mit.edu) were assessed in the same way, where 10 colonies were selected for analysis for each predicted off target. The predicted off-target sites were 5-TAAGTAGCTGATCTATCAGTGGG-3 (SEQ ID NO: 14) (Gon41) and 5-TGGGAAGCATATCTGTCATTTGG-3 (SEQ ID NO: 15) (Asphd1). Only these two sites were selected, as they were the only two to have a calculated off-target score >0.1.

(117) Statistics: All error bars represent the s.e.m. unless stated otherwise. Significance was calculated using an unpaired t-test, as all samples demonstrated the same distribution. Statistical significance was set at 0.05%. Variance was calculated among groups and deemed to be similar.

(118) Construction of a KRT12-specific sgRNA: An analysis of the sequence changes that result from MECD-causing KRT12 missense mutations revealed that the L132P mutation that causes the severe form of MECD coincidentally results in the generation of a novel PAM site (AAG>AGG). An sgRNA (sgK12LP) complementary to the sequence 20 nucleotides adjacent to the 5-end of the novel PAM site generated by the KRT12 L132P mutation was designed and assessed for potential off targets using the Optimized CRISPR Design Tool provided online by the Zhang lab, MIT 2013, (FIG. 5, red). The sgRNA was calculated as having a score of 66% using system, where a score >50% is deemed to be of high quality with a limited number of predicted possible off targets.

(119) Assessment of sgK12LP allele specificity and potency in vitro: The allele-specificity and potency of sgK12LP was assessed in vitro, in HEK AD293 cells, using exogenous expression constructs for wild-type and mutant K12. Allele specificity was first determined using a dual-luciferase reporter assay (FIG. 6 item a). Firefly luciferase activity was found to be significantly decreased in cells expressing either K12WT-Luc or K12LP-Luc and treated with sgK12. A potent and allele-specific reduction of firefly luciferase activity was observed in cells treated with sgK12LP. In cells expressing K12LP-Luc, a reduction of 73.4?2.7% (P<0.001) was observed (FIG. 6 item a). allele-specific and potent knockdown was also observed by western blotting, in cells expressing either K12WT-HA or K12LP-HA (FIG. 6 item b; image representative of four blots) and quantification by densitometry revealed a significant reduction of 32% in K12LP-HA protein by sgK12LP in comparison with K12WT-HA protein (P<0.05). In cells treated with sgK12, both wild-type and mutant K12 protein was found to have decreased, whereas in those treated with sgK12LP there appeared to be no effect on expression of the wild-type protein but a significant knockdown of the mutant K12 protein (FIG. 6 item b).

(120) To support data, observed at the protein level, quantitative reverse transcriptase-PCR and pyrosequencing were carried out to determine allele specificity and potency at the mRNA level. In cells expressing both wild-type and mutant K12 simultaneously (in a 1:1 expression ratio) and treated with each of the three test Cas9/sgRNA expression constructs (NSC, K12 and K12LP), quantitative reverse transcriptase-PCR was used to determine knockdown of total K12 mRNA (FIG. 6 item c). A potent reduction of 73.1?4.2% (P<0.001) of total K12 mRNA was observed in sgK12-treated cells, with a lesser reduction of 52.6?7.0% (P<0.01) measured in sgK12LP-treated cells (FIG. 6 item c). Pyrosequencing was used to determine the intracellular proportion of the remaining mature mRNA species after treatment with these sgRNAs (FIG. 6 item d). Proportions of mRNA were calculated as percentage of K12-L132P/percentage of K12-WT. Cells treated with sgNSC were normalized to 1, assuming a ratio of 1:1 between mutant and wild-type K12 mRNA. In cells tested with sgK12, a K12 mutant mRNA proportion of 0.89?0.03 was observed, but the difference to the NSC control was not significant (P<0.14). In those cells treated with sgK12LP, a K12 mutant mRNA proportion of 0.28?0.02 was detected and was significantly altered in comparison with the sgNSC-treated cells (P<0.001) (FIG. 6 item d).

(121) Determination of the efficacy of sgRNA-K12LP in vivo: Intrastromal injection of the Cas9-GFP construct resulted in the presence of green fluorescent protein (GFP) protein in the corneal epithelium at 24 h post injection (FIG. 7 item a). Transient expression of GFP was found up to 48 h post injection. Following intrastromal injection of either the sgK12LP or sgNSC expression constructs into K12-L132P humanized heterozygous mice and an incubation period of 48 h, mice were euthanized and genomic DNA (gDNA) prepared from the corneas. gDNA from the corneas of four sgK12LP- or sgNSC-treated animals was pooled and PCR amplification of exon 1 of the humanized K12-L132P gene, cloning and sequencing was performed. Of 10 clones established from gDNA of eyes treated with sgNSC, the K12-L132P sequence remained intact in all 10. Thirteen individual clones from sgK12LP-treated eyes were sequenced; eight were found to contain an unaltered KRT12 L132P human sequence, whereas five clones demonstrated NHEJ around the predicted cleavage site of the Cas9/sgK12LP complex (FIG. 7 item b). In one clone (1), an insertion of 1 nucleotide was found, with a deletion of 32 nucleotides. Large deletions of up to 53 nucleotides were observed in vivo (clone 5). Of these 5 clones, 4 contained deletions (clones 1 and 3-5) that are predicted to result in a frameshift that would lead to the occurrence of an early stop codon. The top 2 predicted exonic off-target sites of sgK12LP in mouse were also assessed using method. Ten clones were sequenced for each target and none were found to have undergone nonspecific cleavage.

(122) TGFBI Mutations associated with a PAM site created by mutation in R514P, L518R and L509R: Single guide RNAs were designed to target each of these mutations and cloned into the sgRNA/Cas9 expression plasmid. In addition, a positive control guide RNA utilizing a naturally-occurring near-by PAM was designed for each mutation. Wild-type and mutant target sequences were cloned into a luciferase reporter plasmid to allow us to monitor the effect of gene editing on expression of WT and MUT expression. Both plasmids were used to transfect AD293 cells and luciferase expression was measured 48 hours after CRISPR Cas9 treatment using our high throughput reporter gene assay to give a measurement of the amount of MUT and WT DNA present in the cells.

(123) FIG. 8 shows that for 3 TGFBI mutations (R514P, L518R, and L509R) assessed using the SNP derived PAM approach significant allele-specificity was achieved, with the mutant allele cut by the CRISPR Cas9 system and the WT DNA cut to some degree for some of the guides.

(124) TGFBI Mutations associated with a SNP mutation that lies within a target region adjacent to a PAM site: Single guide RNAs were designed to target these mutations and cloned into the sgRNA/Cas9 expression plasmid. Wild-type and mutant target sequences were cloned into a luciferase reporter plasmid and assessed in our high throughout reporter gene assay. Both plasmids were used to transfect AD293 cells and luciferase expression measured two days afterwards. Firstly, sgRNA that contained a 20 bp target specific sequence were tested. However, these failed to provide sufficient allele specificity. Subsequently, truncated sgRNA (TRU-guides) were designed that reduced the target sequence to 18 bp. An improved allele-specificity was noted (FIG. 9 items a-f).

(125) Ex Vivo Gene Correction: The ability to achieve gene-silencing in corneas from the luciferase reporter mouse was demonstrated. Mice heterozygous for Luc2 were culled, and their corneas were dissected and then transferred to cell culture medium. The dissected corneas were transfected with either a non-specific control sgRNA or a sgRNA targeted to the luciferase reporter gene using Lipofectamine 2000. Corneas were maintained in culture for 3 days, and the luciferase expression was measured.

(126) Potent silencing of the luciferase reporter gene (FIG. 10) was observed in corneas transfected with the sgRNA targeting Luc2 representing successful CRISPR gene editing of the target gene ex vivo. The cornea from a mouse heterozygous for Luc2 was dissected and CRISPR gene editing performed ex vivo. The mouse corneal epithelial stem cell is not restricted to the limbal region and therefore we needed to show gene editing across the entire epithelium as shown in FIG. 10. The dark color of the figure on the right after treatment demonstrated complete gene editing and knock out of the Luc gene in entire mouse cornea ex vivo. (Moore J E, McMullen C B T, Mahon G, Adamis A P (2002). The Corneal Epithelial Stem Cell. DNA & Cell Biology, 21 (5-6) pp. 443-451.)

(127) Surgical Graft for Treatment of Granular Corneal Dystrophy Type II

(128) Cells are cultivated from a limbal biopsy sample obtained from a patient undergoing treatment for granular corneal dystrophy type II. The patient undergoing treatment carries a mutation in a TGFBI gene that encodes for one of the following amino acid substitutions: R124C, R124H, R124L, R555W, R555Q, and H626P. Cells are washed and limbal epithelial stem cells (LESCs) are sorted based on one or more of the following markers: transcription factor p63, ABCG2, C/EBP? or Bmi-1. A cell line is established from the isolated LESCs in the presence of 3T3 feeder cells. The established LESC line is then confirmed by the presence of one or more of the following positive markers: transcription factor p63, ABCG2, C/EBP? or Bmi-1, and the absence of one or more of the following negative markers: cytokeratin 3 (CK3), cytokeratin 12 (CK12), connexin 43 or involucrin.

(129) CRISPR system reagents are prepared according to Shalem et al., Nature Reviews Genetics 16: 299-311 (2013); Zhang et al., Human Molecular Genetics 23(R1): R40-6 (2014); Zetsche et al. dx.doi.org/10.1016/j.ce11.2015.09.038 (2015) and Zhu et al. Cell 157: 1262-1278 (2014). The CRISPR system reagents include one or more guide RNAs (gRNAs), and a Type-II nuclease (e.g., Cas9 or CpfI) included on the same vector and a repair nucleic acid that is approximately 150 bp long. The repair nucleic acid includes a wild type allele of R124, R555, or H626 as well as a selectable GFP marker that allows for the selection of position homologous recombination events. The CRISPR system reagents are introduced into the LESC cell line using standard polymer based (DEAE dextran) transfection techniques. LESCs are allowed to undergo nucleic acid manipulation events and cells positive for such an event are isolated using the GFP marker and FACS. The desired homologous recombination event is further confirmed by sequencing of the TGFBI region of interest in the FACS sorted LESCs.

(130) Manipulated LESCs that contain the desired wild type TGFBI allele are cultured on an amniotic membrane for a period of time sufficient for the manipulated LESCs to expand to an appropriate area size for transplantation. Once the desired size is achieved, the manipulated LESCs can be transplanted using the amniotic membrane as a carrier.