Solid support for synthesizing nucleic acid sequences and methods for making and using
11987599 ยท 2024-05-21
Assignee
Inventors
Cpc classification
C07F9/65515
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
C12N15/1068
CHEMISTRY; METALLURGY
C40B50/18
CHEMISTRY; METALLURGY
C07F9/093
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C07F9/655
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are embodiments of a solid support suitable for synthesizing nucleic acid sequences. The solid support may have a structure according to Formula I, where CPG is controlled pore glass, and m, n, x, y, R.sup.1 and R.sup.2 are as defined herein. ##STR00001## Also disclosed are methods for making and using the solid support, kits including solid support, and a universal linker phosphoramidite suitable for use in the solid support.
Claims
1. A solid support according to Formula I ##STR00068## wherein: CPG is controlled pore glass; m is 2, 3, 4, 5 or 6; x is 1, 2, 3, 4 or 5; y is from 2 to 12; n is 3, 4, 5, 6, 7, 8, 9 or 10; R.sup.2 is H, ##STR00069## p is 2, 3, 4, 5, 6, 7, 8, 9 or 10; R.sup.3 is H or ##STR00070## R.sup.4 is H or OR.sup.6; R is PG or a nucleic acid sequence; R.sup.6 is pixyl, TBDMS, TBDPS, TMS, TES, or TIPS; T is 1, 2, 3, or 4; B.sup.P is a nucleic acid base where an exocyclic amine, if present, is protected; PG is a protecting group; and each R.sup.1 independently is a thermolabile phosphate protecting group having a structure ##STR00071## wherein: X is O or S; R.sup.7 is H, R.sup.a, OR.sup.a, SR.sup.a, or N(R.sup.b).sub.2; R.sup.a is R.sup.d; R.sup.b is H, R.sup.d or two R.sup.bs together with the nitrogen to which they are attached, form a 3- to 7-membered heterocyclyl; Z is O, S, N(R.sup.c), C(R.sup.c).sub.2 or C(R.sup.c).sub.2C(R.sup.c).sub.2; each R.sup.c independently is H or R.sup.d, or one R.sup.d in combination with the C?X moiety and one R.sup.a or R.sup.b from R.sup.7 together form a 3- to 7-membered cycloaliphatic or heterocyclyl ring; R.sup.d is alkyl, alkenyl, alkynyl, cycloalkyl, aryl, or aralkyl; each R.sup.8 independently is H or R.sup.d, or one R.sup.8 together with Z forms an aryl ring; each R.sup.9 independently is H or R.sup.d, or one R.sup.9 and one R.sup.8 together with the atoms to which they are attached, forms a moiety having a formula ##STR00072## wherein r is 0 to 6; and each R.sup.10 independently is H, C.sub.1-6alkyl, NO.sub.2, N(C.sub.1-6alkyl).sub.2, OC.sub.1-6alkyl, SC.sub.1-6alkyl, CN, or halogen, provided that the aromatic ring substituted with R.sup.10 is one carbon removed from the phosphate oxygen of Formula I.
2. The solid support of claim 1, wherein: PG is 4,4-dimethoxytrityl (DMTr); m is 2, 3 or 4; x is 1, 2 or 3; y is from 3 to 10; n is from 3 to 7; or a combination thereof.
3. The solid support of claim 1, wherein the solid support has a formula selected from Formula II, Formula III, Formula IV, Formula V, Formula VII, Formula XI or Formula XIII: ##STR00073##
4. The solid support of claim 1, wherein n is 5.
5. The solid support of claim 1, wherein m, x, y and n are selected to produce a support backbone length from the silicon atom to the R.sup.2 moiety of from 50 atoms to 400 atoms.
6. The solid support of claim 1, wherein the support backbone length is from 100 atoms to 150 atoms.
7. The solid support of claim 1, wherein R.sup.2 is H.
8. The solid support of claim 1, wherein R.sup.2 is ##STR00074##
9. The solid support of claim 8, wherein p is 6.
10. The solid support of claim 8, wherein R.sup.3 is H.
11. The solid support of claim 8, wherein R.sup.3 is ##STR00075##
12. The solid support of claim 11, wherein B.sup.P is exocyclic amine-protected adenine, exocyclic amine-protected cytosine, exocyclic amine-protected guanine, thymine, uracil, hypoxanthine, xanthine, exocyclic amine-protected 7-methylguanine, 5,6-dihydrouracil, exocyclic amine-protected 5-methylcytosine, or exocyclic amine-protected 5-hydroxymethylcytosine.
13. The solid support of claim 11, wherein R.sup.4 is H.
14. The solid support of claim 11, wherein R.sup.4 is OR.sup.6.
15. The solid support of claim 11, wherein: R.sup.4 is H and B.sup.P is exocyclic amine-protected adenine, exocyclic amine-protected cytosine, exocyclic amine-protected guanine, or thymine; or R.sup.4 is OR.sup.6 and B.sup.P is exocyclic amine-protected adenine, exocyclic amine-protected cytosine, exocyclic amine-protected guanine, or uracil.
16. The solid support of claim 8, wherein: B.sup.P is adenine, cytosine, or guanine, where the exocyclic amine is protected by a benzoyl (Bz), isobutyryl (iBu), phenoxyacetyl (Pac), phenylsulfonylethoxycarbonyl, p-nitrophenyloxycarbonyl, allyloxycarbonyl, or levulinyl group; or B.sup.P is thymine or uracil.
17. The solid support of claim 1, wherein: R.sup.6 is TBDMS; t is 2; R.sup.5 is PG: or a combination thereof.
18. The solid support of claim 1, wherein R.sup.5 is a nucleic acid sequence.
19. The solid support of claim 18, wherein: the nucleic acid sequence comprises one or more DNA sequences; or the nucleic acid sequence comprises one or more RNA sequences.
20. The solid support of claim 19, wherein: the one or more DNA sequences comprise one or more antisense DNA sequences; or the one or more RNA sequences comprise one or more antisense RNA sequences, one or more microRNA (miRNA) sequences, one or more small interfering RNA (siRNA) sequences, one or more repeat-associated small interfering RNA (rasiRNA) sequences, or combinations thereof.
21. The solid support of claim 1, wherein B.sup.P comprises a protecting group selected from benzoyl, isobutyryl, or phenoxyacetyl.
22. The solid support of claim 21, wherein B.sup.P is selected from N.sup.6-benzoyl adenine (A.sup.Bz), N.sup.4-benzoyl cytosine (C.sup.Bz), N.sup.2-isobutyryl guanine (G.sup.iBu), thymine (T), N.sup.6-phenoxyacetyl adenine (A.sup.Pac), N.sup.4-phenoxyacetyl cytosine (C.sup.pac), N.sup.2-phenoxyacetyl guanine (G.sup.Pac), or uracil (U).
23. The solid support of claim 1, wherein a loading of the support on the CPG is from 5 ?mol/g to 50 ?mol/g.
24. A method for synthesizing a nucleic acid sequence, comprising: loading a solid support according to claim 1 into a DNA/RNA synthesizer; and operating the synthesizer to produce a desired nucleic acid sequence.
25. The method of claim 24, wherein the solid support is a solid support where R.sup.5 is PG; and R.sup.6 is TBDMS; t is 2; or R.sup.6 is TBDMS and t is 2.
26. The method of claim 25, wherein R.sup.5 is DMTr.
27. A kit, comprising the solid support of claim 1.
28. The kit of claim 27, further comprising a protected 2-deoxynucleoside, ribonucleoside, and/or chemically modified nucleoside wherein an exocyclic amine on the deoxynucleoside, ribonucleoside or chemically modified nucleoside, if present, also is protected.
29. The kit of claim 28, wherein the 2-deoxynucleoside is DMTrdA.sup.Bz, DMTrdC.sup.Bz, DMTrdG.sup.iBu, or DMTrT), or the ribonucleosides is DMTrA.sup.PAc-2-OTBDMS, DMTrC.sup.Pac-2-OTBDMS, DMTrG.sup.Pac-2-OTBDMS, or DMTrU-2-OTBDMS.
30. A solid support according to Formula I ##STR00076## wherein: CPG is controlled pore glass; m is 2, 3, 4, 5 or 6; x is 1, 2, 3, 4 or 5; y is from 2 to 12; n is 3, 4, 5, 6, 7, 8, 9 or 10; R.sup.2 is H, ##STR00077## p is 2, 3, 4, 5, 6, 7, 8, 9 or 10; R.sup.3 is H or ##STR00078## R.sup.4 is H or OR.sup.6; R.sup.5 is PG or a nucleic acid sequence; R.sup.6 is pixyl, TBDMS, TBDPS, TMS, TES, or TIPS; T is 1, 2, 3, or 4; B.sup.P is a nucleic acid base where an exocyclic amine, if present, is protected; PG is a protecting group; and each R.sup.1 independently is a thermolabile phosphate protecting group selected from: ##STR00079##
31. A solid support according to Formula I ##STR00080## wherein: CPG is controlled pre glass; m is 2, 3, 4, 5 or 6; x is 1, 2, 3, 4 or 5; y is from 2 to 12; n is 3, 4, 5, 6, 7, 8, 9 or 10; each R.sup.1 independently is C.sub.1-6alkyl, (CH.sub.2).sub.1-6CN, (CH.sub.2).sub.1-6OR or a thermolabile phosphate protecting group; R is aliphatic, aryl, or aralkyl; R.sup.2 is ##STR00081## p is 2, 3, 4, 5, 6, 7, 8, 9 or 10; R.sup.3 is H or ##STR00082## R.sup.4 is H or OR.sup.6; R.sup.5 is PG or a nucleic acid sequence; R.sup.6 is pixyl, TBDMS, TBDPS, TMS, TES, or TIPS; T is 1, 2, 3, or 4; B.sup.P is a nucleic acid base where an exocyclic amine, if present, is protected; and PG is a protecting group.
32. The solid support of claim 31, selected from: ##STR00083## ##STR00084##
33. A kit, comprising the solid support of claim 32.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
SEQUENCE LISTING
(12) The nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on Jun. 28, 2021, 4 KB, which is incorporated by reference herein in its entirety. In the accompanying sequence listing:
(13) SEQ ID NOs: 1-5 are nucleic acid sequences produced using exemplary embodiments of the disclosed solid support structure.
DETAILED DESCRIPTION
I. Terms
(14) The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. The singular forms a, an, and the refer to one or more than one, unless the context clearly dictates otherwise. The term or refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise. As used herein, comprises means includes. Thus, comprising A or B, means including A, B, or A and B, without excluding additional elements. All references, including patents and patent applications cited herein, are incorporated by reference in their entireties.
(15) Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, percentages, temperatures, times, and so forth, as used in the specification or claims are to be understood as being modified by the term about. Accordingly, unless otherwise indicated, implicitly or explicitly, the numerical parameters set forth are approximations that may depend on the desired properties sought and/or limits of detection under standard test conditions/methods. When directly and explicitly distinguishing embodiments from discussed prior art, the embodiment numbers are not approximates unless the word about is recited.
(16) Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.
(17) When chemical structures are depicted or described, unless explicitly stated otherwise, all carbons are assumed to include implicit hydrogens such that each carbon conforms to a valence of four. For example, in the structure on the left-hand side of the schematic below there are nine hydrogen atoms implied. The nine hydrogen atoms are depicted in the right-hand structure
(18) ##STR00007##
(19) Sometimes a particular atom in a structure is described in textual formula as having a hydrogen or hydrogen atoms, for example CH.sub.2CH.sub.2. It will be understood by a person of ordinary skill in the art that the aforementioned descriptive techniques are common in the chemical arts to provide brevity and simplicity to description of organic structures.
(20) A person of ordinary skill in the art will appreciate that compounds, such as the solid supports disclosed herein, may exhibit the phenomena of tautomerism, conformational isomerism, geometric isomerism, and/or optical isomerism. For example, certain disclosed compounds can include one or more chiral centers and/or double bonds and as a consequence can exist as stereoisomers, such as double-bond isomers (i.e., geometric isomers), enantiomers, diasteromers, and mixtures thereof, such as racemic mixtures. In certain embodiments the compounds disclosed herein are synthesized in or are purified to be in substantially enantiopure form, such as in an 85% enantiomeric excess (e.e.), a 90% enantiomeric excess, a 95% enantiomeric excess, a 97% enantiomeric excess, a 98% enantiomeric excess, a 99% enantiomeric excess, or even in greater than a 99% enantiomeric excess, such as in a substantially enantiopure form. In other embodiments, the compounds are in a racemic form, having substantially a 50:50 mixture of enantiomers.
(21) As another example, certain disclosed compounds can exist in several tautomeric forms, including the enol form, the keto form, and mixtures thereof. For example, a compound may have a moiety exhibiting the following isomerization:
(22) ##STR00008##
(23) As the various compound names, formulae and compound drawings within the specification and claims can represent only one of the possible tautomeric, conformational isomeric, optical isomeric, or geometric isomeric forms, a person of ordinary skill in the art will appreciate that the disclosed compounds encompass any tautomeric, conformational isomeric, optical isomeric, and/or geometric isomeric forms of the compounds described herein, as well as mixtures of these various different isomeric forms. In cases of limited rotation, e.g. around the amide bond, atropisomers are also possible and are also specifically included in the compounds of the invention.
(24) In any embodiments, any or all hydrogens present in the compound, or in a particular group or moiety within the compound, may be replaced by a deuterium or a tritium. Thus, a recitation of alkyl includes deuterated alkyl, where from one to the maximum number of hydrogens present may be replaced by deuterium. For example, ethyl may be C.sub.2H.sub.5 or C.sub.2H.sub.5 where from 1 to 5 hydrogens are replaced by deuterium, such as in C.sub.2D.sub.xH.sub.5-x.
(25) As used herein, the term substituted refers to all subsequent modifiers in a term, for example in the term substituted arylC.sub.1-8alkyl, substitution may occur on the C.sub.1-8alkyl portion, the aryl portion or both portions of the arylC.sub.1-8alkyl group.
(26) Aliphatic: A substantially hydrocarbon-based group or moiety. An aliphatic group or moiety can be acyclic, including alkyl, alkenyl, or alkynyl groups, cyclic versions thereof, such as cycloaliphatic and/or spiroaliphatic groups or moieties including cycloalkyl, cycloalkenyl, cycloalkynyl, or spiroalkyl and further including straight- and branched-chain arrangements, and all stereo and position isomers as well. Unless expressly stated otherwise, an aliphatic group contains from one to twenty-five carbon atoms (C.sub.1-25), for example, from one to fifteen (C.sub.1-15), from one to ten (C.sub.1-10) from one to six (C.sub.1-6), or from one to four carbon atoms (C.sub.1-4) for an acyclic alkyl group or moiety; from two to twenty-five carbon atoms (C.sub.1-25) for example, from two to fifteen (C.sub.1-15), from two to ten (C.sub.1-10) from two to six (C.sub.1-6), or from two to four carbon atoms (C.sub.1-4) for an acyclic alkenyl or alkynyl group or moiety; from three to fifteen carbon atoms (C.sub.3-15), such as from three to ten (C.sub.3-10), from three to eight (C.sub.3-8), from three to six (C.sub.3-6), or from three to four (C.sub.3-4) carbon atoms for a cycloaliphatic group or moiety; or from three to fifteen (C.sub.6-15) carbon atoms for a spiroaliphatic group or moiety. An aliphatic group may be substituted or unsubstituted, unless expressly referred to as an unsubstituted aliphatic or a substituted aliphatic. An aliphatic group can be substituted with one or more substituents (up to two substituents for each methylene carbon in an aliphatic chain, or up to one substituent for each carbon of a C?C double bond in an aliphatic chain, or up to one substituent for a carbon of a terminal methine group).
(27) Alkyl: A saturated aliphatic hydrocarbyl group having from 1 to 10 (C.sub.1-10) or more carbon atoms, more typically 1 to 8 (C.sub.1-8) carbon atoms such as 1 to 6 (C.sub.1-6) carbon atoms or 1 to 4 (C.sub.1-4) carbon atoms. An alkyl moiety may be substituted or unsubstituted. This term includes, by way of example, linear and branched hydrocarbyl groups such as methyl (CH.sub.3), ethyl (CH.sub.2CH.sub.3), n-propyl (CH.sub.2CH.sub.2CH.sub.3), isopropyl (CH(CH.sub.3).sub.2), n-butyl (CH.sub.2CH.sub.2CH.sub.2CH.sub.3), or isobutyl (CH.sub.2CH.sub.2(CH.sub.3).sub.2).
(28) Cycloaliphatic: Refers to a cyclic aliphatic group having a single ring (e.g., cyclohexyl), or multiple rings, such as in a fused, bridged or spirocyclic system, at least one of which is aliphatic. Typically, the point of attachment to the parent structure is through an aliphatic portion of the multiple ring system. Cycloaliphatic includes saturated and unsaturated systems, including cycloalkyl, cycloalkenyl and cycloalkynyl. A cycloaliphatic group may contain from three to twenty-five carbon atoms; for example, from three to fifteen, from three to ten, or from three to six carbon atoms. Unless otherwise stated, a cycloaliphatic group may be substituted or unsubstituted. Exemplary cycloaliphatic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, or cyclohexenyl.
(29) Aryl: Refers to an aromatic carbocyclic group of, unless specified otherwise, from 6 to 15 carbon atoms having a single ring (e.g., phenyl) or multiple condensed rings in which at least one ring is aromatic (e.g., naphthalene). If any aromatic ring portion contains a heteroatom, the group is heteroaryl and not aryl. Aryl groups may be, for example, monocyclic, bicyclic, tricyclic or tetracyclic. Unless otherwise stated, an aryl group may be substituted or unsubstituted.
(30) Aralkyl: Refers to an aryl group attached to the parent via an alkyl moiety. Exemplary aralkyl groups include benzyl and phenylethyl.
(31) Exocyclic amine: As used herein, an exocyclic amine is an amine moiety that is not part of a ring structure, i.e., the nitrogen atom of the exocyclic amine is not a ring atom. Exemplary exocyclic amines include, but are not limited to, the amine at the N.sup.6 position of adenine, the amine at the N.sup.2 position of guanine, and the amine at the N.sup.4 position of cytosine. An exocyclic amine may be unprotected or protected, such as by a suitable amine protecting group. Exemplary protecting groups include, but are not limited to, isobutyryl(iBu); phenoxyacetyl (Pac); levulinyl; amidine protecting groups, such as
(32) ##STR00009##
carbamate protecting groups, such as 9-fluorenylmethyl carbamate (Fmoc), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC),
(33) ##STR00010##
(where R is H, Cl or NO.sub.2), 2-(4-nitrophenyl)ethyl carbamate, benzyl carbamate (Cbz), allyl carbamate (allyloxycarbonyl), 4-nitrophenyloxycarbonyl, or (CH.sub.3).sub.2CHCH.sub.2OC(?O); or amide protecting groups, such as formamide, acetamide, CH.sub.3CH.sub.3C(?O), (CH.sub.3).sub.2CHC(?O), (CH.sub.3).sub.3CC(?O),
(34) ##STR00011##
(where R is H or CMe.sub.3), (Ph).sub.2CHC(?O),
(35) ##STR00012##
MeOCH.sub.2C(?O), i-PrOCH.sub.2C(?O),
(36) ##STR00013##
(where R is H, 2-Cl or 4-t-butyl), MeC(?O)CH.sub.2CH.sub.2C(?O), benzoyl (Bz),
(37) ##STR00014##
(where R is 4-methoxy, 4-Cl, 4-nitro, 4-NMe.sub.2, 4-tert-butyl, 2-methyl, 3-Cl, 3,4-dichloro, or 3-methoxy-4-phenoxy),
(38) ##STR00015##
(where R is Me or MeO),
(39) ##STR00016##
(where R is Ac, or Ph), PhN?NPh-C(?O),
(40) ##STR00017##
Additional information concerning protecting groups for exocyclic amines on nucleic acid bases can be found in Beaucage, S. L. and Iyer, R. L. Advances in the Synthesis of Oligonucleotides by the Phosphoramidite Approach, Tetrahedron, 1992, Vol. 48(12), pp 2223-2311, which is incorporated herein by reference in its entirety.
(41) Heteroaryl: An aromatic group or moiety of, unless specified otherwise, from 5 to 15 ring atoms comprising at least one carbon atom and at least one heteroatom, such as N, S, O, P, or Si, preferably N, S or O. A heteroaryl group or moiety may comprise a single ring (e.g., pyridinyl, or pyrazine) or multiple condensed rings (e.g., indolyl). Heteroaryl groups or moiety may be, for example, monocyclic, bicyclic, tricyclic or tetracyclic. Unless otherwise stated, a heteroaryl group or moiety may be substituted or unsubstituted.
(42) Heterocyclyl, heterocyclo or heterocycle: Aromatic and non-aromatic ring systems, and more specifically refer to a stable three- to fifteen-membered ring moiety comprising at least one carbon atom, and typically plural carbon atoms, and at least one, such as from one to five, heteroatoms. The heteroatom(s) may be nitrogen, phosphorus, oxygen, silicon or sulfur atom(s), preferably N, S or O. The heterocyclyl moiety may be a monocyclic moiety, or may comprise multiple rings, such as in a bicyclic or tricyclic ring system, provided that at least one of the rings contains a heteroatom. Such a multiple ring moiety can include fused or bridged ring systems as well as spirocyclic systems; and any nitrogen, phosphorus, carbon, silicon or sulfur atoms in the heterocyclyl moiety can be optionally oxidized to various oxidation states. For convenience, nitrogens, particularly, but not exclusively, those defined as annular aromatic nitrogens, are meant to include their corresponding N-oxide form, although not explicitly defined as such in a particular example. Thus, for a compound having, for example, a pyridinyl ring, the corresponding pyridinyl-N-oxide is included as another compound of the invention, unless expressly excluded or excluded by context. In addition, annular nitrogen atoms can be optionally quaternized. Heterocycle includes heteroaryl moieties, and heterocycloaliphatic moieties, such as heterocycloalkyl moieties, which are heterocyclyl rings that are partially or fully saturated. Unless otherwise stated, a heterocyclyl group or moiety may be substituted or unsubstituted. Examples of heterocyclyl groups include, but are not limited to, azetidinyl, oxetanyl, acridinyl, benzodioxolyl, benzodioxanyl, benzofuranyl, dioxolanyl, indolizinyl, naphthyridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrazoyl, tetrahydroisoquinolyl, piperidinyl, piperazinyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, 2-oxoazepinyl, azepinyl, pyrrolyl, 4-piperidonyl, pyrrolidinyl, pyrazolyl, pyrazolidinyl, imidazolyl, imidazolinyl, imidazolidinyl, dihydropyridinyl, tetrahydropyridinyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, oxazolyl, oxazolinyl, oxazolidinyl, triazolyl, isoxazolyl, isoxazolidinyl, morpholinyl, thiazolyl, thiazolinyl, thiazolidinyl, isothiazolyl, quinuclidinyl, isothiazolidinyl, indolyl, isoindolyl, indolinyl, isoindolinyl, octahydroindolyl, octahydroisoindolyl, quinolyl, isoquinolyl, decahydroisoquinolyl, benzimidazolyl, thiadiazolyl, benzopyranyl, benzothiazolyl, benzoxazolyl, furyl, tetrahydrofuryl, tetrahydropyranyl, thienyl, benzothieliyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiamorpholinyl sulfone, and oxadiazolyl.
(43) Halo, halide or halogen: Refers to fluoro, chloro, bromo or iodo.
(44) Nucleic acid sequence: Refers to DNA and RNA sequences, such as cDNA and mRNA. In one examples, includes antisense nucleic acid sequences (such as antisense RNA or antisense DNA), microRNAs (miRNAs), small interfering RNAs (siRNAs), and repeat-associated small interfering RNAs (rasiRNAs). In one example, a nucleic acid sequence is a therapeutic nucleic acid sequence, such as a DNA therapeutic (e.g., antisense oligonucleotide, DNA aptamers) or RNA therapeutic (e.g., miRNA, siRNA, ribozyme, or RNA decoy). A nucleic acid sequence can include naturally occurring and/or non-naturally occurring nucleotides.
(45) Nucleosides: The major nucleosides of DNA are deoxyadenosine (dA), deoxyguanosine (dG), deoxycytidine (dC) and deoxythymidine (T). The major nucleosides of RNA are adenosine (rA), guanosine (rG), cytidine (rC) and uridine (U). Includes nucleosides containing modified bases and modified sugar moieties, for example as described in U.S. Pat. No. 5,866,336 to Nazarenko et al. (herein incorporated by reference). Examples of modified sugar moieties which may be used to modify nucleotides at any position on its structure include, but are not limited to: arabinose, 2-fluoroarabinose, xylose, and hexose. In one example, a nucleoside is a 2-deoxynucleoside (dA, dC, dG, or T). In one example, a nucleoside is chemically modified (e.g., LNA, BNA or UNA).
II. Solid Support Structure
(46) Disclosed herein is a solid support structure suitable for synthesizing nucleic acid sequences. Embodiments of the solid support structure may facilitate synthesizing nucleic acid sequences having reduced process-related impurities and/or increased yield, compared to the same sequence synthesized using commercial solid supports. The impurities may comprise, but are not limited to, nucleic acid sequences having shorter lengths than a desired nucleic acid sequence, such as one or more nucleotides shorter; partially alkylated thymine or uracil bases in DNA or RNA sequences, possibly resulting from exposure to acrylonitrile produced during the deprotection of 2-cyanoethyl phosphate protecting groups under basic conditions; and/or impurities from removed protecting groups, such as tert-butyldimethylsilyl fluoride or tetrabutylammonium fluoride, that may contaminate the sequence, particularly solid-phase purified RNA sequences.
(47) In some embodiments, the disclosed solid support structure has a formula I:
(48) ##STR00018##
With respect to formula I, CPG is controlled pore glass. In some embodiments, the CPG has a pore size of from 250 ? to 1500 ? or more, such as from 500 ? to 1500 ?, from 500 ? to 1250 ? or from 500 ? to 1000 ?, and in certain embodiments, the CPG has a pore size of about 500 ?.
(49) m is 2, 3, 4, 5, 6, such as 2, 3, or 4, and in certain embodiments, m is 3.
(50) x is 1, 2, 3, 4, or 5, such as 1, 2, or 3. In some embodiments, x is 1 or 2, and in certain embodiments, x is 1.
(51) y is from 2 to 12, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, and may be from 3 to 10, or from 4 to 8, and in some embodiments, y is 6.
(52) n is from 3 to 10 or more, such as 3, 4, 5, 6, or 7, and may be 5, 6 or 7. In certain embodiments, n is 5.
(53) In some embodiments, m, x, y and/or n are selected to produce a carbon/oxygen/phosphorus backbone chain from the silicon atom to the R.sup.2 moiety of 50 atoms or more in length, such as from 50 atoms to 400 atoms, from 60 atoms to 350 atoms, from 100 atoms to 210 atoms, or from 100 atoms to 150 atoms.
(54) Each R.sup.1 independently is C.sub.1-6alkyl, (CH.sub.2).sub.1-6CN, (CH.sub.2).sub.1-6OR or a thermolabile phosphate protecting group, where R is aliphatic, aryl or aralkyl. R may be alkyl, such as C.sub.1-6alkyl; alkenyl, such as C.sub.2-6alkenyl; alkynyl, such as C.sub.2-6alkynyl; cycloalkyl, such as C.sub.3-8cycloalkyl; aryl, such as phenyl; or aralkyl, such as benzyl. The thermolabile phosphate protecting group may have a structure
(55) ##STR00019##
With respect to this structure, X is O or S.
(56) R.sup.7 is H, R.sup.a, OR.sup.a, SR.sup.a, or N(R.sup.b).sub.2, where R.sup.a is R.sup.d; and R.sup.b is H, R.sup.d or two R.sup.bs together with the nitrogen to which they are attached, form a 3- to 7-membered heterocyclyl.
(57) Z is O, S, N(R.sup.c), C(R.sup.c).sub.2 or C(R.sup.c).sub.2C(R.sup.c).sub.2 where each R.sup.c independently is H or R.sup.d or one R.sup.d in combination with the C?X moiety and one R.sup.a or R.sup.b from R.sup.7 together form a 3- to 7-membered cycloaliphatic or heterocyclyl ring.
(58) Each R.sup.8 independently is H or R.sup.d, or one R.sup.8 together with Z forms an aryl ring, such as phenyl.
(59) Each R.sup.9 independently is H or R.sup.d or one R.sup.9 and one R.sup.8 together with the atoms to which they are attached, forms a moiety having a formula
(60) ##STR00020##
where r is 0 to 6, and each R.sup.10 independently is H, C.sub.1-6alkyl, NO.sub.2, N(C.sub.1-6alkyl).sub.2, OC.sub.1-6alkyl, SC.sub.1-6alkyl, CN, or halogen, provided that the aromatic ring substituted with R.sup.10 is one carbon removed from the phosphate oxygen of Formula I.
(61) R.sup.d is alkyl, alkenyl, alkynyl, cycloalkyl, aryl, or aralkyl.
(62) In some embodiments, the thermolabile phosphate protecting group is selected from
(63) ##STR00021## ##STR00022##
Additional information concerning thermolabile phosphate protecting groups can be found in U.S. Pat. No. 6,762,298, which is incorporated herein by reference in its entirety.
(64) In some embodiments, each R.sup.1 independently is C.sub.1-4alkyl or (CH.sub.2).sub.1-4CN, and may be methyl, ethyl, propyl, CH.sub.2CN or CH.sub.2CH.sub.2CN, and in certain embodiments, R.sup.1 is CH.sub.2CH.sub.2CN.
(65) In other embodiments, each R.sup.1 independently is a thermolabile phosphate protecting group as defined herein.
(66) And in some embodiments, each R.sup.1 is the same, but in other embodiments, the support comprises two or more R.sup.1 moieties, such as from 2 to the maximum number of R.sup.1 moieties present in the structure. In certain embodiments, each R.sup.1 is CH.sub.2CH.sub.2CN.
(67) R.sup.2 is H,
(68) ##STR00023##
where p is from 2 to 10, such as from 3 to 8 or from 4 to 8, and in certain embodiments, p is 6.
(69) R.sup.3 is H or
(70) ##STR00024##
where t is 1, 2, 3 or 4, such as 2; R.sup.4 is H or OR.sup.6; and B.sup.P is a nucleic acid base where the exocyclic amine, if present, is protected. The protecting group can be any suitable protecting group, and may be a protecting group as disclosed herein. In some embodiments, B.sup.P is a nucleic acid where the exocyclic amine, if present, is protected by a benzoyl (Bz), isobutyryl(iBu), phenoxyacetyl (Pac), phenylsulfonylethoxycarbonyl, p-nitrophenyloxycarbonyl, allyloxycarbonyl, or levulinyl group. In certain embodiments, B.sup.P is N.sup.6-benzoyl adenine (A.sup.Bz), N.sup.4-benzoyl cytosine (C.sup.Bz), N.sup.2-isobutyryl guanine (G.sup.iBu), thymine (T), N.sup.6-phenoxyacetyl adenine (A.sup.Pac), N.sup.4-phenoxyacetyl cytosine (C.sup.Pac), N.sup.2-phenoxyacetyl guanine (G.sup.Pac), uracil (U), and/or similarly exocyclic amine-protected (where applicable) hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, or 5-hydroxymethylcytosine. Additional information concerning modified nucleic acid bases that can be used with the disclosed technology can be found in U.S. Pat. Nos. 7,355,037 and 7,612,197, which are incorporated herein by reference in their entireties. In some embodiments, B.sup.P is A.sup.Bz, C.sup.Bz, G.sup.iBu, T or A.sup.Pac, C.sup.Pac, G.sup.Pac, or U.
(71) R.sup.5 is PG or a nucleic acid sequence. The nucleic acid sequence may comprise one or more DNA sequences and/or one or more RNA sequences. An exemplary DNA sequence is an antisense DNA sequence. An exemplary RNA sequence is an antisense RNA sequence, microRNA (miRNA) sequence, small interfering RNA (siRNA) sequence, repeat-associated small interfering RNA (rasiRNA) sequence, or a combination thereof. A person of ordinary skill in the art understands that when R.sup.5 is a nucleic acid sequence, the nucleic acid sequence is attached to the support via a phosphate moiety at the 3 end of the nucleic acid sequence, in the same manner as nucleotides are typically attached together to form a nucleic acid sequence.
(72) R.sup.6 is a hydroxyl protecting group that can be removed with fluoride ions or under essentially neutral conditions. Typically, R.sup.6 is 9-phenylxanthyl (pixyl) or a silyl protecting group, such as tert-butyldimethylsilyl (TBDMS), tert-butyldiphenylsilyl (TBDPS), trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS). In certain embodiments, R.sup.6 is TBDMS, TBDPS, TMS, TES, TIPS, and may be TBDMS.
(73) PG is any protecting group suitable for use in DNA or RNA synthesis. In some embodiments PG is dimethoxytrityl(DMTr), triphenylmethyl (trityl), p-monomethoxytrityl (MMTr), trimethoxytrityl (TMTr), 9-phenylxanthen-9-yl, 9-(p-methoxyphenyl)xanthen-9-yl, 9-phenylthioxanthen-9-yl, or 7-chloro-9-phenylthioxanthen-9-yl. In certain embodiments, PG is DMTr.
(74) ##STR00025##
(75) In some embodiments, R.sup.4 is H and B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine, for example:
(76) ##STR00026##
(77) In other embodiments, R.sup.4 is OR.sup.6 and B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil, for example:
(78) ##STR00027##
(79) In some embodiments, x is 1, leading to a support structure according to Formula II:
(80) ##STR00028##
With respect to formula II, CPG, m, y, n, R.sup.1 and R.sup.2 are as previously defined for Formula I.
(81) In some embodiments of Formulas I and II, y is 6. In particular embodiments, the solid support structure has a formula according to Formula III:
(82) ##STR00029##
With respect to Formula III, CPG, m, n, R.sup.1 and R.sup.2 are as previously defined for Formula I.
(83) In some embodiments of Formula I, m is 3, leading to solid support structure according to Formula IV
(84) ##STR00030##
With respect to Formula IV, CPG, n, x, y, R.sup.1 and R.sup.2 are as previously defined for Formula I. In certain embodiments, of Formula IV, x is 1 and y is 6, leading to a solid support structure according to Formula V
(85) ##STR00031##
With respect to Formula V, CPG, n, R.sup.1 and R.sup.2 are as previously defined for Formula I.
(86) In some embodiments of Formulas I-V, R.sup.2 is H.
(87) In other embodiments of Formulas I to V, R.sup.2 is
(88) ##STR00032##
where R.sup.1 and R.sup.5 are as previously defined for Formula I. In certain embodiments, the solid support structure has a formula according to Formula VI or VII
(89) ##STR00033##
With respect to Formulas VI and VII, CPG, m, n, x, y, R.sup.1 and R.sup.5 are as previously defined for Formula I. In certain embodiments, of Formulas VI and VII, R.sup.5 is PG, where PG is as previously defined for Formula I.
(90) In some other embodiments of Formulas I to V, R.sup.2 is
(91) ##STR00034##
In certain embodiments, the solid support structure has a formula according to Formula VIII or IX
(92) ##STR00035##
With respect to Formulas VIII and IX, CPG, m, n, p, x, y, R.sup.1 and R.sup.3 are as previously defined for Formula I.
(93) In some embodiments of Formulas I-V or VIII-IX, R.sup.3 is H. In other embodiments, R.sup.3 is
(94) ##STR00036##
where t, R.sup.4, R.sup.5 and B.sup.P are as previously defined for Formula I. And in certain embodiments, the solid support structure has a formula according to Formula X, XI, XII or XIII
(95) ##STR00037##
With respect to Formulas X-XIII, CPG, m, n, p, t, x, y, R.sup.1, R.sup.4, R.sup.5, and B.sup.P are as previously defined for Formula I. In some embodiments, R.sup.5 is PG.
(96) In some embodiments of Formulas X-XIII, R.sup.4 is H and B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine. In other embodiments of Formulas X-XIII, R.sup.4 is OR.sup.6 and B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil.
(97) In particular embodiments of Formulas I-V and p is 6.
(98) In any embodiments, each R.sup.1 may be the same, and in certain embodiments, each R.sup.1 is CH.sub.2CH.sub.2CN.
(99) In any embodiments, n is 3, 4, 5, 6, 7, 8, 9 or 10, such as 3, 4, 5, 6, or 7, and may be selected from 3, 5, or 7, or from 4, 5, 6 or 7, such as 5, 6, or 7. And in certain examples, n is 5.
(100) In certain embodiments of Formulas I-XIII, R.sup.5 is PG, such as DMTr. In other embodiments, R.sup.5 is a nucleic acid sequence. In certain embodiments, R.sup.5 is, or comprises, a DNA sequence. In certain other embodiments, R.sup.5 is, or comprises, an RNA sequence. In particular embodiments, R.sup.5 is a DNA sequence, R.sup.4 is H and B.sup.P an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine. In other particular embodiments, R.sup.5 is an RNA sequence, R.sup.4 is OR.sup.6 and B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil.
(101) Certain disclosed exemplary solid support structures within the scope of one or more of the general formulas include:
(102) ##STR00038## ##STR00039##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine;
(103) ##STR00040##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine;
(104) ##STR00041##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine;
(105) ##STR00042##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine;
(106) ##STR00043##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine;
(107) ##STR00044##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or thymine;
(108) ##STR00045##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil;
(109) ##STR00046##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil;
(110) ##STR00047##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil;
(111) ##STR00048##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil;
(112) ##STR00049##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil;
(113) ##STR00050##
where B.sup.P is an exocyclic amine-protected adenine, an exocyclic amine-protected cytosine, an exocyclic amine-protected guanine, or uracil.
(114) In any embodiments, the loading of the support on the CPG is from greater than zero to 125 ?mol/g or more, such as from 5 ?mol/g to 125 ?mol/g, from 10 ?mol/g to 100 ?mol/g, or from 15 ?mol/g to 75 ?mol/g.
III. Method for Making the Solid Support Structure
(115) The disclosed solid support structures can be prepared as exemplified below, as illustrated for specific supports in the examples, and as will be understood by a person of ordinary skill in the art of organic synthesis. An exemplary synthesis may include the following first reaction step according to Scheme 1.
(116) ##STR00051##
(117) CPG A is treated with a trialkoxysilane, such as trimethoxysilane as illustrated in Scheme 1, in a suitable solvent, such as an aprotic solvent, for example, toluene. The mixture is agitated, such as by stirring or shaking, at a temperature suitable to facilitate production of compound B. The temperature may be from 20? C. or lower, to 100? C. or more, such as from 25? C. to 75? C. or from 40? C. to 60? C., and in some embodiments, a temperature of about 50? C. is used. The reaction may proceed until the reaction is complete, such as by reaching an equilibrium, and may proceed for from 6 hours to 48 hours, from 12 hours to 36 hours, or from 18 hours to 30 hours, and in some embodiments, the reaction proceeds for about 24 hours. Compound B is then treated with a suitable base, such as aqueous ammonia, to form compound C. The mixture is agitated, such as by stirring or shaking, at a temperature suitable to facilitate the reaction, such as from 25? C. or less to 75? C. or more, or from 40? C. to 60? C., and in some embodiments, a temperature of about 55? C. is used. The reaction may proceed from greater than zero to 6 hours or more, such as from 1 hour to 4 hours, or for about 2 hours. Compound C is then isolated by a suitable technique, such as filtration.
(118) A second reaction step in the exemplary synthesis is provided below according to Scheme 2.
(119) ##STR00052##
(120) Compound C is treated with phosphoramidite D under a standard solid-phase DNA synthesis protocol, such as conditions recommended by a manufacturer of an automated DNA/RNA synthesizer, to form Compound E. The protecting group is any protecting group suitable to facilitate solid phase DNA synthesis, such as DMTr. And each alkyl group in the (alkyl).sub.2N moiety in phosphoramidite D may be C.sub.1-6alkyl or the two alkyl moieties together with the nitrogen to which they are attached form a 5- to 7 membered heterocycloaliphatic group. Suitable (alkyl).sub.2N moieties include, but are not limited to, dimethylamino (NCH.sub.3).sub.2, diethylamino (N(CH.sub.2CH.sub.3).sub.2), di-n-propylamino, diisopropylamino, di-n-butylamino, diisopropylamino, diisobutylamino, di-sec-butylamino, di-tert-butylamino, di-n-hexylamino, or morpholino.
(121) Compound E is exposed to an aqueous solution of iodine and then to reagents needed to inactivate any unreacted hydroxyl groups, such as a 1:1 (v/v) solution of Cap A (Ac.sub.2O/THF/pyridine) and Cap B (10% 1-Methylimidazole in THF). The protecting group is then removed under acidic conditions to form Compound F. A person of ordinary skill in the art understands the conditions required to remove a particular protecting group, and additional information concerning suitable protecting groups and how to remove them can be found in Greene's Protective Groups in Organic Synthesis, Fourth Edition, published by John Wiley and Sons, Inc, Apr. 10, 2006. For example, a DMTr protecting group may be removed by treatment with 3% trichloroacetic acid in a suitable solvent, such as a chlorinated solvent (for example, chloroform or dichloromethane).
(122) The chain length can be extended as desired by repeating the steps above, as illustrated in Scheme 3.
(123) ##STR00053##
(124) A third reaction step in the exemplary synthesis is provided below according to Scheme 4.
(125) ##STR00054##
(126) Compound G is obtained after oxidation of the phosphite triester intermediate with an aqueous solution of iodine followed by treatment with a 1:1 (v/v) Cap A:Cap B solution to inactivate unreacted hydroxyl groups and after removal of the protecting group under acidic conditions as previously described with respect to Scheme 2. Compound G is then treated with phosphoramidite H according to standard solid-phase DNA synthesis protocols. Typically, the amino moiety is protected by a suitable protecting group, such as a 4-monomethoxytrityl group. Removal of such a group produces Compound J. A person of ordinary skill in the art understands how to remove such protecting groups. For example, a 4-monomethoxytrityl amino protecting group may be removed using 3% trichloroacetic acid (TCA) in a chlorinated solvent, such as dichloromethane, over a period of 15 minutes at about 25? C.
(127) A fourth reaction step in the exemplary synthesis is provided below according to Scheme 5.
(128) ##STR00055##
(129) Compound J is treated with a suitable 5-O-deoxy- or ribonucleoside K comprising a nucleic acid base suitable for the 3-end of the resultant nucleic acid sequence, and a linker suitable to attach the nucleoside to the solid support. A person of ordinary skill in the art understands that if the nucleic acid comprises an exocyclic amine, such amine likely will be protected by a suitable protecting group, such as a protecting group disclosed herein. In Scheme 5, an exemplary succinate linker is shown, but a person of ordinary skill in the art understands that any linker suitable to facilitate the DNA or RNA sequence synthesis may be used. The reaction proceeds in the presence of a suitable coupling agent, such as dicyclohexylcarbodiimide (DCC), ethyl-(N,N-dimethylamino)propylcarbodiimide hydrochloride (EDC), diisopropylcarbodiimide (DIC), carbonyldiimidazole (CDI), BOP, PyBOP, BOP-Cl, or HATU. The reaction is performed in a solvent suitable to facilitate the coupling reaction, such as pyridine, DMF, acetonitrile, toluene, a chlorinated solvent, such as chloroform, dichloromethane, or dichloroethane, or any combination thereof. Pyridine may be used in combination with a solvent to further facilitate the reaction proceeding.
(130) After the reaction is complete, the reaction mixture is treated with a 1:1 (v/v) Cap A:Cap B solution to inactivate any unreacted amines moieties, and the solid support is filtered and treated with a suitable reagent, such as TCA in a chlorinated solvent, such as dichloromethane, to remove the protecting group to form compound L.
(131) An alternative exemplary synthesis to those illustrated by Schemes 4 and 5 is shown in Scheme 6.
(132) ##STR00056##
(133) Compound G is treated with phosphoramidite M according to standard solid-phase DNA synthesis protocols. After treatment with an aqueous solution of iodine, unreacted hydroxyl groups are inactivated by a 1:1 (v/v) Cap A:Cap B solution as previously described with respect to Scheme 2. Typically, the hydroxyl moiety of M is protected by a suitable protecting group, such as a 4-monomethoxytrityl or 4,4-dimethoxytrityl group. Removal of such a group produces Compound N, and a person of ordinary skill in the art understands the conditions used to remove such protecting groups. For example, a 4-monomethoxytrityl or 4,4-dimethoxytrityl hydroxyl protecting group may be removed using 3% TCA in a chlorinated solvent, such as dichloromethane, over a period of 15 minutes at about 25? C.
(134) In some embodiments, phosphoramidite M is
(135) ##STR00057##
(136) Using either solid support L or solid support N, the DNA or RNA sequence can be synthesized in an automated DNA/RNA synthesizer using the standard protocols recommended by the manufacturer. Upon completion of the automated solid-phase synthesis, the DNA sequence is released by passing ammonium hydroxide through the synthesis column over a suitable period, such as from greater than zero to 1 hour or more, or from 10 minutes to 30 minutes, while collecting the eluate. The eluate then is heated to a temperature suitable to ensure complete deprotection, such as from 30? C. or less to 100? C. or less, for example, from 40? C. to 75? C. or from 50? C. to 60? C., and in some embodiments, the temperature is about 55? C. The eluate is heated for a time period to facilitate deprotection, such as from 6 hours or less to 30 hours or more, from 12 hours to 24 hours, or from 15 hours to 20 hours, and in some embodiments, the eluate is heated for about 18 hours.
(137) Alternatively, nucleic acid sequences, such as RNA sequences, may be manually released by suspending each support in an alcoholic solution of concentrated ammonium hydroxide, typically an ethanolic solution, at an approximate ratio of from 1:1 v/v to 1:5 or more v/v, such as about EtOH:NH.sub.4OH (1:3 v/v). The mixture is maintained, typically in a closed container, at ambient temperature, such as from 20? C. to 30? C. or about 25? C., for a time period suitable to facilitate release of the nucleic acid sequence. The time period may be from 6 hours or less to 24 hours or more, such as from 12 hours to 18 hours, and in some embodiments, the time period is about 16 hours. The support is then filtered and washed with RNase free water. The filtrates are concentrated to dryness, such as by centrifugation and/or a speedvac concentrator. For RNA sequences, the residue is dissolved in a suitable solvent, such as DMSO, and treated with conditions suitable to remove the OH protecting group. In some embodiments, the OH protecting group is fluoride-labile, and the residue is treated with a fluoride reagent, such as triethylamine trihydrofluoride. The mixtures are heated, such as on a heat block, at a temperature suitable to facilitate OH deprotection, such as from 50? C. or less to 100? C. or more, from 55? C. to 75? C. or about 65? C. for a suitable time period, such as from 1 hours or less to 56 hours or more, from 2 hours to 4 hours or about 3 hours.
IV. Examples
Example 1
Preparation of the 3-hydroxypropylated CPG Support 3
(138) ##STR00058##
(139) To CPG (500 ?, 1.00 g, 1) placed in a 4-mL screw-capped glass vial was added a solution of 3-acetoxypropyltrimethoxysilane (890 mg, 4.00 mmol) in dry toluene (4 mL). The suspension was then shaken at 50? C. over a period of 24 hours. The 3-acetoxypropylated support 2 was filtered, washed with acetonitrile (10 mL), air-dried and transferred to a 7-mL screw-capped glass vial. Concentrated aqueous ammonia (4 mL) was added to the vial which was immediately capped; the suspension was shaken at 55? C. over 2 hours. The 3-hydroxypropylated support 3 was filtered and successively washed with water (10 mL), acetonitrile (10 mL), air dried and then left under high vacuum for 1 hour at about 25? C.
Example 2
Conversion of the CPG Support 3 to CPG Supports 5 and 6
(140) ##STR00059##
(141) A 0.1 M solution of commercial phosphoramidite 4 in anhydrous CH.sub.3CN was employed for the phosphitylation of CPG support 3, which was performed via a standard 1 ?mole scale solid-phase DNA synthesis protocol under conditions recommended by the manufacturer of the automated DNA/RNA synthesizer. The CPG support 5 was then exposed to an aqueous solution of iodine followed by a 1:1 (v/v) solution of Cap A (Ac.sub.2O/THF/pyridine) and Cap B (10% 1-methylimidazole in THF) to inactivate unreacted hydroxyls. The CPG support 6 was produced upon exposing 5 to a solution of 3% trichloroacetic acid (TCA) in CH.sub.2Cl.sub.2 to cleave the 4,4-dimethoxytrityl (DMTr) group according to a standard automated DNA synthesis protocol. The released DMTr cation solution, obtained from an accurately weighed sample of support 5, was collected into a 10-mL volumetric flask and spectrophotometrically measured at 498 nm to reveal a functional hydroxyl concentration of 108 ?mole OH/gram of CPG support 6.
Example 3
General Procedure for the Automated Preparation of CPG Supports 7, 8 or 9
(142) ##STR00060##
(143) The procedure comprises repeating all the steps described above at the same scale, under the same conditions, using CPG support 6 as the starting material.
Example 4
Typical Procedure for the Automated Preparation of CPG Supports 10, 11 or 12
(144) ##STR00061##
(145) A 0.1 M solution of commercial 6-(4-monomethoxytritylamino)hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite in anhydrous CH.sub.3CN was employed for the phosphitylation of CPG support 7, 8 or 9, at the 1 ?mole scale, according to a standard solid-phase DNA synthesis protocol. The CPG support 10, 11, or 12, was then treated with an aqueous solution of iodine followed by a 1:1 (v/v) Cap A:Cap B solution to inactivate unreacted hydroxyls. Cleavage of the 4-monomethoxytritylamino protecting group was performed manually, off the automated DNA/RNA synthesizer, using 3% TCA in CH.sub.2Cl.sub.2 over a period of 15 min at about 25? C. Multiple batches of each CPG support were needed to generate enough material to initiate solid-phase synthesis of each DNA or RNA sequence at the 1 ?mole scale on each support.
Example 5
General Procedure for the Preparation of CPG Supports 13, 14 or 15
(146) ##STR00062##
(147) To a flame-dried 4-mL glass vial was added CPG support 10, 11 or 12 (50 mg) and a 5-O-(4,4-dimethoxytrityl)-2-deoxythymidine-3-O-succinate, N.sup.4-benzoyl-5-O-(4,4-dimethoxytrityl)-2-deoxycytidine-3-O-succinate, N.sup.6-benzoyl-5-O-(4,4-dimethoxytrityl)-2-deoxyadenosine-3-O-succinate, N.sup.2-isobutyryl-5-O-(4,4-dime-thoxytrityl)-2-deoxyguanosine-3-O-succinate or 5-O-(4,4-dimethoxytrityl)-2-O-tert-butyldimethylsilyl uridine-3-O-succinate salt (30 mg) along with N,N-dicyclohexylcarbodiimide (15 mg). The glass vial and its content were then subjected to high vacuum for 2 hours at about 25? C. A solution of 10% dry pyridine in anhydrous DMF (200 ?L) was added by syringe to the glass vial, which was immediately sealed with a teflon-lined screw cap and shaken at about 25? C. over a period of 24 hours. The suspension was filtered, washed with dry CH.sub.3CN (10 mL) and treated with 2-mL of a 1:1 (v/v) Cap A:Cap B solution to inactivate any unreacted amine functions. The CPG support was again filtered, washed with dry CH.sub.3CN (10 mL) and air-dried. An accurately weighed sample of support 13, 14 or 15 was mixed with a solution of 3% TCA in CH.sub.2Cl.sub.2 (10 mL), over 5 minutes at about 25? C., to spectrophotometrically measure at 498 nm the concentration of the leader nucleoside (dA.sup.Bz) covalently linked to the support. DMTr cation measurements revealed a 5-hydroxyl concentration of: 57 ?mole/gram of CPG support 13; 43 ?mole/gram of CPG support 14 or 26 ?mole/gram of CPG support 15. When the leader nucleoside is dT, dC.sup.Bz, dG.sup.iBu or U, DMTr cation measurements were: 51 ?mole/gram, 49 ?mole/gram, 50 ?mole/gram or 49 ?mole/gram of CPG support 14, respectively.
Example 6
Protocol for Automated Synthesis of DNA or RNA Sequences on Commercial LCAA-CPG and CPG Supports 13, 14 and 15
(148) ##STR00063##
(149) Automated syntheses of DNA and RNA sequences were performed on a DNA/RNA synthesizer, employing commercial long chain alkylamine controlled-pore glass supports (LCAA-CPG) or modified CPG supports 13, 14 and 15 pre-loaded with suitably protected leader deoxy- or ribonucleosides. Each solid support was accurately weighed, based on its leader nucleoside load, to provide one micromole of leader nucleoside per synthesis column. The synthesis of DNA or RNA sequences was conducted, side-by-side, on LCAA-CPG and CPG support 13 according to the standard (trityl-off) DNA or RNA protocol conditions recommended by the manufacturer of the DNA/RNA synthesizer. Side-by-side syntheses were carried out on the same day by the same operator, using the same batches of deoxy- or ribonucleoside phosphoramidites under identical conditions in terms of concentration, activation/coupling times and subsequent usage of reagents through all the steps of each synthesis cycle. This protocol was repeated under identical conditions for the side-by-side synthesis of DNA sequences on LCAA-CPG and CPG support 14 and 15.
Example 7
Deprotection of the DNA or RNA Sequences Released from LCAA-CPG and CPG Supports 16, 17 and 18
(150) ##STR00064##
(151) Upon completion of the automated solid-phase synthesis of DNA or RNA sequences, the synthesis columns containing the DNA sequences linked to LCAA-CPG support and CPG supports 16, 17 or 18 were taken off the DNA/RNA synthesizer, and each DNA sequence of each CPG support was manually released by passing concentrated ammonium hydroxide (1 mL) through the synthesis column over a period of 15 minutes while collecting the eluate in a 4-mL screw cap glass vial. Each glass vial was then capped and heated at 55? C. for 18 hours on a heat block to ensure complete deprotection. The ammoniacal solution of each DNA sequence was then concentrated to about 50% of its original volume using a stream of air to remove most of the ammonia from each solution.
(152) The synthesis columns containing the RNA sequence linked to LCAA-CPG and CPG 17 supports was manually released upon suspending each support in 1 mL of an ethanolic solution of concentrated ammonium hydroxide [EtOH:NH.sub.4OH (1:3 v/v)] kept in capped 4-mL screw cap glass vials over 16 hours at about 25? C. The support of each vial was then filtered and washed with RNase free water (0.5 mL) twice, and the filtrates were placed in 1.5 mL polypropylene microcentrifuge tubes and concentrated to dryness using a speedvac concentrator. Each RNA sequence was dissolved in DMSO (100 ?L) to which was added triethylamine trihydrofluoride (125 The solutions were heated on a heat block at 65? C. for 3 hours. Each deprotected RNA sequence solution was cooled to room temperature, diluted with 775 ?L of RNase free water, and desalted through a PD-10 column. Each desalted RNA solution was immediately analyzed by RP-HPLC as described below.
(153) The identity of all nucleic acid sequences released from the CPG support 17 was verified by mass spectrometry.
(154) TABLE-US-00001 MALDI:m/zcalcdforC.sub.197H.sub.244N.sub.85O.sub.114-P.sub.19: 6215[M+H].sup.+;found:6212. (SEQIDNO:1): 5-d(CTGAGTAGC-GAACGTGAAGA) MALDI:m/zcalcdforC.sub.196H.sub.249N.sub.68O.sub.121P.sub.19: 6082[M+H].sup.+;found:6077. (SEQIDNO:2): 5-d(TCTTGGTTACAGA-AATCCT) MALDI:m/zcalcdforC.sub.193H.sub.249N.sub.62O.sub.124P.sub.19: 6010[M+H].sup.+;found:6014. (SEQIDNO:4): 5-d(CTCTGTACCTTACGTCTTCG) MALDI:m/zcalcdforC.sub.195H.sub.246N.sub.75O.sub.118P.sub.19: [M+H].sup.+;6117;found:6118. (SEQIDNO:5): 5-d(ATAGTGTGCATCGATGCCAC) MALDI:m/zcalcdforC.sub.188H.sub.233N.sub.68O.sub.141P.sub.19: [M+H].sup.+;6290;found:6282. (SEQIDNO:3): 5-r(UCUUGGUUACAUGAAAUCCU)
Example 8
Comparative RP-HPLC Analyses of Unpurified DNA or RNA Sequences Released from LCAA-CPG and CPG Supports 16, 17 and 18
(155) All analyses were performed using an Agilent Technologies 1260 Infinity II HPLC system equipped with a diode array detector for spectral analysis. The OpenLAB CDS ChemStation software provides peak integration capabilities needed for comparative analyses. Optimally, 0.2 OD.sub.260 unit of fully deprotected and unpurified DNA or RNA sequences released from the above CPG supports were each analyzed using an Agilent ion-pair reversed-phase AdvanceBio Oligonucleotide column under the following chromatographic conditions: from 0.1 M triethylammonium acetate (pH 7.0), a linear gradient of 0.66% CH.sub.3CN/min is pumped at a flow rate of 0.8 mL/min for 30 minutes. Chromatographic peak areas were measured using the OpenLAB CDS ChemStation software by perpendicularly extending the start and end of DNA or RNA peak elution points to base line.
Example 9
Results and Discussion
(156) In this study, a controlled-pore glass support functionalized with multiple hexaethylene glycol spacers was designed, implemented and demonstrated to reduce the level of process-related impurities in synthetic DNA and RNA sequences when compared to that achieved using commercial long-chain alkylamine controlled-pore glass supports (also see Grajkowski et al., Bioorg. Med. Chem. 28:115779, 2020, herein incorporated by reference in its entirety).
(157) A first attempt to reduce the level of process-related impurities in synthetic DNA and RNA sequences used a CPG 500 support functionalized with one hexaethylene glycol spacer under typical solid-phase synthesis conditions. A DNA sequence (20-mer) was produced in a yield not better than that obtained (86%) when employing the standard commercial LCAA-CPG support. Hexaethylene glycol has about the same number of carbon-carbon (CC) bond lengths (about 18) than that of the long chain alkylamine spacer of LCAA-CPG.
(158) It was hypothesized that a CPG support functionalized with either a spacer much larger in length than the alkylamine spacer of LCAA-CPG or multiple hexaethylene glycol spacers would improve access of activated phosphoramidites and required reagents to the leader nucleoside for efficient initiation of solid-phase DNA or RNA synthesis. Therefore, the CPG support 6 (see Example 2) was functionalized with two, four and six additional hexaethylene glycol spacers to provide the CPG supports 13, 14 and 15 from which, solid-phase syntheses of DNA and RNA sequences were conducted to provide supports 16, 17, and 18, respectively. The quality of the nucleic acid sequences obtained from these CPG supports was assessed by HPLC and compared with that obtained from the same sequences made from the commercial LCAA-CPG support.
(159)
(160) The results obtained by using CPG support 14 prompted an investigation as to whether better results could be obtained using CPG support 15 for solid-phase synthesis of SEQ ID NO: 1.
(161) Results of the above experiments demonstrated that the disclosed CPG support provided a significant reduction in process-related impurities formation, compared to the commercial LCAA-CPG support, during solid-phase synthesis of nucleic acid sequences.
(162) The solid-phase synthesis of one RNA sequence (SEQ ID. NO: 3) and three additional DNA sequences (SEQ ID NOs: 2, 4 and 5) were therefore conducted on LCAA-CPG and CPG support 14 to demonstrate that the minimization of process-related impurities was not limited to one particular nucleic acid sequence.
(163) TABLE-US-00002 TABLE1 Minimizationofprocess-relatedimpurities insyntheticnucleicacidsequences.sup.a Solid mPA PA-pRI Mi-pRI support (%).sup.b (%).sup.b (%) 5-d(CTGAGTAGCGAACGTGAAGA) SEQIDNO:1 LCAA-CPG 64 36 36 CPG-14 77 23 5-d(TCTTGGTTACATGAAATCCT) SEQIDNO:2 LCAA-CPG 74 26 42 CPG-14 85 15 5-r(UCUUGGUUACAUGAAAUCCU) SEQIDNO:3 LCAA-CPG 66 34 27 CPG-14 75 25 5-d(CTCTGTACCTTACGTCTTCG) SEQIDNO:4 LCAA-CPG 78 22 23 CPG-14 83 17 5-d(ATAGTGTGCATCGATGCCAC) SEQIDNO:5 LCAA-CPG 32 68 19 CPG-14 45 55 .sup.amPA, main peak area; PA-pRI, peak area of process-related impurities; Mi-pRI, relative minimization of process-related impurities resulting from the use of CPG support 14 and calculated according to the following equation: % Mi-pRI =[1 ?(% PA-pRI.sub.CPG-14 ?% PA-pRI.sub.LCAA-CPG)]?100 .sup.bpercent of total DNA- or RNA-related peak areas.
(164) As shown in Table 1, synthesizing nucleic acid sequences using embodiments of the disclosed solid support structures results in significant reductions in process-related impurities. In contrast, using a similar solid support structure having only a single hexaethylene glycol spacer, i.e., n=1 in the solid phase supports from Examples 3-7, resulted in substantially less pure nucleic acid sequences than those made using solid phase supports where n was 3 or more (
(165) ##STR00065##
Table 2 provides comparative data illustrating the purity of sequences made using supports where n=1, 3, 5, 7, and 10.
(166) TABLE-US-00003 TABLE2 PurityofDNAsequencesmadeusingdifferent lengthsolidphasesupportsasapercentage oftotalpeakarea Support n=1 n=3 n=5 n=7 n=10 Sequence:5-d(CTGAGTAGCGAACGTGAAGA) (SEQIDNO:1) Purity 79% 92% 94% 92% Sequence:5-d(TCTTGGTTACATGAAATCCT) (SEQIDNO:2) Purity 93% 93%
CONCLUSIONS
(167) As demonstrated herein, modification of a CPG support with the addition of multiple hexaethylene glycol spacers led to the synthesis of DNA and RNA sequences of significantly greater purity that that obtained from the current, state-of-the art, LCAA-CPG support. The CPG support 14 is composed of five hexaethylene glycol spacers and was found to be as efficient as the CPG support 15, carrying seven hexaethylene glycol spacers, for minimizing process-related impurities in synthetic DNA sequences. A reduction of process-related impurities of up to 53% in synthetic nucleic acid sequences was achieved when using 14, instead of LCAA-CPG, for the solid-phase synthesis of nucleic acid sequences. Although the reduction of process-related impurities is variable and may vary depending on the composition of the nucleic acid sequence, a lower content of residual process-related impurities facilitates the removal of those impurities from the full-length nucleic acid sequences, to ultimately provide nucleic acid-based drugs of exquisite purity for safer and more efficacious therapies for human diseases.
Example 10
Typical Procedure for the Automated Preparation of a CPG Support Comprising a Universal Linker
(168) ##STR00066##
(169) The universal support is produced using a universal linker phosphoramidite, such as the universal linker phosphoramidite shown below, according to the method illustrated in Example 4. Unreacted hydroxyl moieties are inactivated using a 1:1 (v/v) Cap A:Cap B solution as described in Example 4. And standard DNA or RNA synthesis proceeds as described in Examples 6 and 7.
(170) ##STR00067## Exemplary universal linker phosphoramidite,
(171) In view of the many possible embodiments to which the principles of the disclosed technology may be applied, it should be recognized that the illustrated embodiments are only examples of the technology and should not be taken as limiting the scope of the disclosure. Rather, the scope of the disclosure is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.