Polypeptide and method of producing IMP using the same

11987611 ยท 2024-05-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a novel polypeptide having an activity of exporting 5-inosine monophosphate, a microorganism comprising the same, a method for preparing 5-inosine monophosphate using the same, and a method for increasing export of 5-inosine monophosphate.

Claims

1. A microorganism of the genus Corynebacterium producing 5-inosine monophosphate, which comprises a protein variant exporting 5-inosine monophosphate; the polynucleotide encoding the protein variant; or a vector comprising the polynucleotide encoding the protein variant; wherein, in the amino acid sequence of SEQ ID NO: 2, (i) the 2.sup.nd amino acid, (ii) the 64.sup.th amino acid, or (iii) the 2.sup.nd amino acid and the 64.sup.th amino acid are each substituted with another amino acid.

2. The microorganism of the genus Corynebacterium according to claim 1, wherein the 2.sup.nd amino acid is substituted with an amino acid selected from the group consisting of isoleucine, phenylalanine, methionine, glutamic acid, histidine, and asparagine; (ii) the 64.sup.th amino acid is substituted with an amino acid selected from the group consisting of aspartate, glutamic acid, asparagine, cysteine, isoleucine, and phenylalanine; or (iii) the 2.sup.nd amino acid and the 64.sup.th amino acid are each substituted with an amino acid selected from the group consisting of methionine, glutamic acid, histidine, asparagine, aspartate, cysteine, isoleucine, and phenylalanine.

3. The microorganism of the genus Corynebacterium according to claim 1, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

4. A method for preparing 5-inosine monophosphate, comprising culturing the microorganism of the genus Corynebacterium of claim 1 in a medium; and recovering 5-inosine monophosphate from the microorganism or medium.

5. The method according to claim 4, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

6. The microorganism of the genus Corynebacterium according to claim 1, further comprising a protein variant in which the 164th amino acid of SEQ ID NO: 1 is substituted with another amino acid; the polynucleotide encoding the protein variant; or a vector comprising the polynucleotide encoding the protein variant.

7. The microorganism of the genus Corynebacterium according to claim 6, wherein the 164.sup.th amino acid of SEQ ID NO: 1 is substituted with an amino acid selected from the group consisting of lysine, arginine, asparagine, glycine, threonine, and proline.

8. The microorganism of the genus Corynebacterium according to claim 6, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

9. A method for preparing 5-inosine monophosphate, comprising culturing the microorganism of the genus Corynebacterium of claim 6 in a medium; and recovering 5-inosine monophosphate from the microorganism or medium.

10. The method according to claim 9, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

Description

BEST MODE FOR CARRYING OUT THE INVENTION

(1) The present disclosure will be described in detail as follows. Meanwhile, each of the explanations and exemplary embodiments disclosed herein can be applied to other respective explanations and exemplary embodiments. That is, all of the combinations of various factors disclosed herein belong to the scope of the present disclosure. Additionally, the scope of the present disclosure should not be limited by the specific disclosure provided hereinbelow.

(2) To achieve the above objects, an aspect of the present disclosure provides a protein variant having an activity of exporting IMP.

(3) As used herein, the term a protein that exports 5-inosine monophosphate (IMP) refers to a protein involved in the extracellular export of IMP. For the purpose of the present disclosure, the term may be used interchangeably with a protein having an activity of exporting IMP, an IMP export protein, a protein having an activity of exporting 5-inosine monophosphate, a 5-inosine monophosphate-exporting protein, etc.; specifically, the protein may be expressed as ImpE, and more specifically, may be expressed as ImpE1 or ImpE2, but is not limited thereto. Additionally, the protein may be derived from a microorganism of the genus Corynebacterium, and specifically from Corynebacterium stationis, but the microorganism is not limited thereto.

(4) The protein, for example, may consist of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, but any sequence having the same activity as the protein can be included without limitation, and one of ordinary skill in the art can obtain sequence information from GenBank of NCBI, a well-known database. Additionally, the protein may include the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or an amino acid sequence having a homology or identity to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. Additionally, it is obvious that any protein having an amino acid sequence with deletion, modification, substitution, or addition in part of the sequence can also be included in the scope of the present disclosure, as long as the amino acid sequence has a homology or identity described above and has an effect corresponding to that of the protein.

(5) That is, although described as a protein having an amino acid sequence of a particular SEQ ID NO or a protein consisting of an amino acid sequence of a particular SEQ ID NO in the present disclosure, the protein may have an activity that is identical or corresponding to that of a protein consisting of an amino acid sequence of the corresponding SEQ ID NO. In such a case, it is obvious that any proteins having an amino acid sequence with deletion, modification, substitution, conservative substitution, or addition in part of the sequence also can be used in the present disclosure. For example, in the case of having the activity that is the same as or corresponding to that of the modified protein, it does not exclude an addition of a sequence upstream or downstream of the amino acid sequence, which does not alter the function of the protein, a mutation that may occur naturally, a silent mutation thereof, or a conservative constitution, and even when the sequence addition or mutation is present, it obviously belongs to the scope of the present disclosure.

(6) As used herein, the term homology or identity refers to a degree of matching with two given amino acid sequences or nucleotide sequences, and may be expressed as a percentage.

(7) The terms homology and identity may often be used interchangeably with each other.

(8) The sequence homology or identity of conserved polynucleotide or polypeptide sequences may be determined by standard alignment algorithms and can be used with a default gap penalty established by the program being used. Substantially homologous or identical sequences are generally expected to hybridize under moderate or high stringency, along the entire length or at least about 50%, about 60%, about 70%, about 80%, or about 90% of the entire length of the sequences. Polynucleotides that contain degenerate codons instead of codons in the hybridizing polypeptides are also considered.

(9) Whether any two polynucleotide or polypeptide sequences have a homology, similarity, or identity may be determined using a known computer algorithm such as the FASTA program (Pearson et al., (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444: using default parameters in 2444). Alternately, it may be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), which is performed in the Needleman program of the EMBOSS package ((EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or versions thereafter) (GCG program package (Devereux, J., et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073). For example, the homology, similarity, or identity may be determined using BLAST or ClustalW of the National Center for Biotechnology Information (NCBI).

(10) The homology, similarity, or identity of polynucleotide or polypeptide sequences may be determined by comparing sequence information using, for example, the GAP computer program (e.g., Needleman et al., (1970), J Mol Biol. 48: 443) as published (e.g., Smith and Waterman, Adv. Appl. Math (1981) 2:482). In summary, the GAP program defines the homology, similarity, or identity as the value obtained by dividing the number of similarly aligned symbols (i.e., nucleotides or amino acids) into the total number of the symbols in the shorter of the two sequences. Default parameters for the GAP program may include (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986), Nucl. Acids Res. 14:6745, as disclosed in Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps. Accordingly, as used herein, the term homology or identity refers to relevance between sequences. Specifically, the protein variant of the present disclosure having the activity of exporting IMP may be one in which at least one amino acid selected from the group consisting of the 164.sup.th amino acid in the amino acid sequence of SEQ ID NO: 1, the 222.sup.nd amino acid in the amino acid sequence of SEQ ID NO: 1, the 2.sup.nd amino acid in the amino acid sequence of SEQ ID NO: 2, and the 64.sup.th amino acid in the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid, but is not limited thereto.

(11) For example, in the protein variant having the activity of exporting IMP, the 164.sup.th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with lysine, arginine, asparagine, glycine, threonine, or proline; the 2.sup.nd amino acid in the amino acid sequence of SEQ ID NO: 2 is substituted with isoleucine, phenylalanine, methionine, glutamic acid, histidine, or asparagine; or the 64.sup.th amino acid in the amino acid sequence of SEQ ID NO: 2 is substituted with aspartic acid, glutamic acid, asparagine, cysteine, isoleucine, or phenylalanine, but is not limited thereto.

(12) As a specific example, the protein variant having the activity of exporting IMP may be a protein having the amino acid sequence consisting of SEQ ID NO: 141, 142, 145, 147, 149, or 151, a protein having an amino acid sequence encoded by the polynucleotide of SEQ ID NO: 153 or 154, or a protein having an amino acid sequence having a homology thereto of at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. In addition, it is apparent that a protein having a deletion, modification, substitution, or addition of some sequence may be used as the protein of the present disclosure as long as it is a protein having the amino acid sequence with the homology above and exhibiting an effect corresponding to that of the protein.

(13) Another aspect of the present disclosure provides a polynucleotide encoding the protein variant, or a vector including the polynucleotide.

(14) As used herein, the term polynucleotide refers to a polymer of nucleotides which is extended in a long chain by covalent bonds and has a DNA strand or an RNA strand longer than a certain length, and more specifically, refers to a polynucleotide fragment encoding the protein variant.

(15) It is apparent that a polynucleotide, which can be translated by codon degeneracy into a protein consisting of the amino acid sequence of SEQ ID NO: 141, 142, 145, 147, 149, or 151, a protein consisting of an amino acid sequence encoded by the polynucleotide of SEQ ID NO: 153 or 154, or into a protein having a homology thereto, also can be included as the polynucleotide of the present disclosure. For example, the polynucleotide of the present disclosure may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 143, 144, 146, 148, 150, 152, 153, or 154, and more specifically, may be a polynucleotide composed of a nucleotide sequence of SEQ ID NO: 143, 144, 146, 148, 150, 152, 153, or 154. In addition, a polynucleotide sequence, which encodes a protein having the activity of the protein consisting of an amino acid sequence of SEQ ID NO: 141, 142, 145, 147, 149, or 151 or an amino acid sequence encoded by a polynucleotide of SEQ ID NO: 153 or 154 by hybridization under stringent conditions with a probe which can be prepared from known gene sequences, e.g., a complementary sequence to all or part of the nucleotide sequence, may be included without limitation.

(16) The term stringent conditions refers to conditions under which specific hybridization between polynucleotides is made possible. Such conditions are specifically described in references (e.g., J. Sambrook et al., supra). For example, the conditions may include performing hybridization between genes having a high homology, a homology of 40% or higher, specifically 90% or higher, more specifically 95% or higher, even more specifically 97% or higher, and most specifically 99% or higher, while not performing hybridization between genes having a homology of lower than the above homologies; or to perform hybridization once, specifically two or three times, under conventional washing conditions for southern hybridization of 60? C., 1?SSC, and 0.1% SDS, specifically at a salt concentration and temperature corresponding to 60? C., 0.1?SSC, and 0.1% SDS, and more specifically 68? C., 0.1?SSC, and 0.1% SDS.

(17) Hybridization requires that two nucleic acids have a complementary sequence, although mismatches between bases may be possible depending on the stringency of the hybridization. The term complementary is used to describe the relationship between mutually hybridizable nucleotide bases. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the present disclosure may also include isolated nucleic acid fragments complementary to the entire sequence as well as substantially similar nucleic acid sequences.

(18) Specifically, polynucleotides having a homology can be detected at a T.sub.m value of 55? C. using hybridization conditions that include a hybridization step and using the conditions described above. Additionally, the Tm value may be 60? C., 63? C., or 65? C., but is not limited thereto and may be appropriately adjusted by an ordinary person skilled in the art according to the intended purpose.

(19) The stringency suitable for the hybridization of polynucleotides depends on the length and complementarity of the polynucleotides and the related variables are well known in the art (see Sambrook et al., supra, 9.50 to 9.51 and 11.7 to 11.8).

(20) As used herein, the term vector refers to a DNA construct including the nucleotide sequence of the polynucleotide encoding a target protein, in which the target protein is operably linked to a suitable control sequence so that the target protein can be expressed in an appropriate host. The control sequence may include a promoter capable of initiating transcription, any operator sequence for controlling the transcription, a sequence encoding an appropriate mRNA ribosome-binding domain, and a sequence controlling the termination of transcription and translation. The vector, after being transformed into a suitable host cell, may be replicated or function irrespective of the host genome, or may be integrated into the host genome itself.

(21) The vector used in the present disclosure may not be particularly limited as long as the vector is replicable in the host cell, and it may be constructed using any vector known in the art. Examples of the vector may include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, as a phage vector or cosmid vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc., may be used; and as a plasmid vector, those based on pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET, etc., may be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc., may be used.

(22) In an embodiment, the polynucleotide encoding the target protein may be replaced with a modified polynucleotide within the chromosome using a vector for the insertion into the chromosome in a cell. The insertion of the polynucleotide into the chromosome may be performed using a known method in the art, for example, by homologous recombination, but is not limited thereto. In particular, a selection marker for confirming the insertion into the chromosome may be further included. The selection marker is used for selection of a transformed cell, i.e., in order to confirm whether the target nucleic acid has been inserted, and markers capable of providing selectable phenotypes such as drug resistance, nutrient requirement, resistance to cytotoxic agents, and expression of surface proteins may be used. Under the circumstances where selective agents are treated, only the cells capable of expressing the selection markers can survive or express other phenotypic traits, and thus the transformed cells can be easily selected.

(23) Still another aspect of the present disclosure provides a microorganism producing IMP, including the protein variant of the present disclosure, the polynucleotide of the present disclosure encoding the protein variant, or the vector of the present disclosure. Specifically, the microorganism including the protein variant and/or a polynucleotide encoding the protein variant may be a microorganism prepared by transformation using a vector containing the polynucleotide encoding the protein variant, but the microorganism is not limited thereto.

(24) As used herein, the term transformation refers to a process of introducing a vector including a polynucleotide encoding a target protein into a host cell, thereby enabling the expression of the protein encoded by the polynucleotide in the host cell. For the transformed polynucleotide, it does not matter whether it is inserted into the chromosome of the host cell and located therein or located outside the chromosome, as long as the transformed polynucleotide can be expressed in the host cell. Additionally, the polynucleotide includes DNA and RNA which encode the target protein. The polynucleotide may be inserted in any form as long as it can be introduced into a host cell and expressed therein. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all of the essential elements required for self-expression. The expression cassette may conventionally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome-binding domain, and a translation termination signal. The expression cassette may be in the form of a self-replicable expression vector. Additionally, the polynucleotide may be introduced into a host cell as is and operably linked to a sequence essential for its expression in the host cell, but is not limited thereto.

(25) Additionally, as used herein, the term operably linked refers to a functional linkage between a promoter sequence, which initiates and mediates the transcription of the polynucleotide encoding the target protein, i.e., a conjugate of the present disclosure, and the above gene sequence.

(26) As used herein, the term IMP-producing microorganism refers to a microorganism which is naturally capable of producing IMP; or a microorganism introduced an ability to produce or export IMP to whose parent strain is not naturally capable of producing and/or exporting IMP which is In the present disclosure, the microorganism producing IMP can be used interchangeably with a microorganism having an activity of exporting IMP.

(27) The IMP-producing microorganism is a cell or microorganism which includes a protein variant having an activity of exporting IMP or a polynucleotide encoding the protein variant, or which is transformed with a vector containing the polynucleotide encoding the protein variant, and is thereby capable of expressing the protein variant. For the purposes of the present disclosure, the host cell of the IMP-producing microorganism or microorganism may be any microorganism including the protein variant thus capable of producing IMP. For example, the microorganism may be a microorganism of the genus Escherichia, a microorganism of the genus Serratia, a microorganism of the genus Erwinia, a microorganism of the genus Enterobacteria, a microorganism of the genus Salmonella, a microorganism of the genus Streptomyces, a microorganism of the genus Pseudomonas, a microorganism of the genus Brevibacterium, a microorganism of the genus Corynebacterium, etc., and specifically, a microorganism of the genus Corynebacterium.

(28) As used herein, the term IMP-producing microorganism of the genus Corynebacterium refers to a microorganism of the genus Corynebacterium which is naturally capable of producing IMP or capable of producing IMP by modification. Specifically, as used herein, the microorganism of the genus Corynebacterium capable of producing IMP refers to a native strain of the microorganism of the genus Corynebacterium capable of producing IMP; or a microorganism of the genus Corynebacterium with enhanced abilities to produce IMP prepared by inserting a gene associated with IMP production or by enhancing or attenuating the endogenous gene associated with IMP production. More specifically, in the present disclosure, the microorganism of the genus Corynebacterium capable of producing IMP refers to a microorganism of the genus Corynebacterium which has improved abilities to produce IMP by including a protein variant having an activity of exporting IMP or a polynucleotide encoding the protein variant, or by being transformed with a vector containing the polynucleotide encoding the protein variant. The microorganism of the genus Corynebacterium with enhanced abilities to produce IMP refers to a microorganism of the genus Corynebacterium with improved abilities to produce IMP compared to that of its parent strain before transformation or that of an unmodified microorganism of the genus Corynebacterium. The unmodified microorganism of the genus Corynebacterium refers to a native type of the microorganism of the genus Corynebacterium, a microorganism of the genus Corynebacterium which does not contain a protein variant capable of exporting IMP, or a microorganism of the genus Corynebacterium which is not transformed with a vector containing a polynucleotide encoding the protein variant capable of exporting IMP.

(29) In an embodiment of the present disclosure, the microorganism of the present disclosure may be a microorganism of the genus Corynebacterium, in which the activity of adenylosuccinate synthetase and/or IMP dehydrogenase is further attenuated.

(30) In the present disclosure, a microorganism of the genus Corynebacterium specifically refers to Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, Corynebacterium stationis, etc., but the microorganism is not necessarily limited thereto.

(31) Still another aspect of the present disclosure provides a method for preparing IMP, including culturing the microorganism of the genus Corynebacterium in a medium.

(32) Specifically, the method of the present disclosure may additionally include a step of recovering IMP from the microorganism or medium.

(33) In the above method, the cultivation of the microorganism may be performed in a batch process, continuous process, fed-batch process, etc., known in the art, but the cultivation process is not particularly limited thereto. In particular, with respect to the cultivation conditions, the pH of the culture may be adjusted to a suitable pH (e.g., pH 5 to 9, specifically pH 6 to 8, and most specifically with an appropriate basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or acidic compound (e.g., phosphoric acid or sulfuric acid), and the aerobic condition of the culture may be maintained by introducing oxygen or an oxygen-containing gas mixture to the culture. The cultivation temperature may generally be in the range of 20? C. to 45? C., and specifically 25? C. to 40? C. for about 10 to 160 hours, but the cultivation conditions are not limited thereto. The IMP produced by the above cultivation may be secreted into the culture or may be retained in the cells.

(34) Additionally, examples of the carbon sources to be used in the culture medium may include sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose); oils and fats (e.g., soybean oil, sunflower oil, peanut oil, and coconut oil); fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid); alcohols (e.g., glycerol and ethanol); and organic acids (e.g., acetic acid), but are not limited thereto. These carbon sources may be used alone or in combination, but are not limited thereto. Examples of the nitrogen sources to be used in the culture medium may include nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat gravy, malt extract, corn steep liquor, soybean flour, and urea) or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), etc. These nitrogen sources may be used alone or in combination, but are not limited thereto. Examples of the phosphorus sources to be used in the culture medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, corresponding sodium-containing salts, etc., but are not limited thereto. Additionally, metal salts (e.g., magnesium sulfate or iron sulfate), amino acids, vitamins, etc., which are essential growth-promoting materials, may be contained in the medium.

(35) In the present disclosure, the method for recovering the IMP produced in the step of cultivation may be performed by collecting the IMP from the culture broth using an appropriate method known in the art. For example, methods such as centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc., may be used, and the desired IMP can be recovered from a culture or cultured microorganism using an appropriate method known in the art.

(36) Further, the recovery may include a purification process and may be performed using an appropriate method known in the art. Thus, the IMP to be recovered may be in a purified form or a microorganism fermentation broth containing IMP.

(37) Still another aspect of the present disclosure provides a composition for producing IMP, including the protein variant of the present disclosure, which has the activity of exporting IMP, or a polynucleotide encoding the same.

(38) The composition of the present disclosure may further include, without limitation, a constitution capable of operating the polynucleotide. In the composition of the present disclosure, the polynucleotide may be in a form included within a vector to express an operably linked gene in the introduced host cell.

(39) Additionally, the composition may further include any suitable excipients conventionally used in the composition for producing IMP. Such excipients may be, for example, preservatives, humectants, suspending agents, buffers, stabilizing agents, or isotonic agents, but are not limited thereto.

(40) Still another aspect of the present disclosure provides use of the protein of the present disclosure for increasing the production of IMP in the microorganism of the genus Corynebacterium.

(41) Still another aspect of the present disclosure provides a method for increasing the export of IMP, including enhancing the activity of the protein variant, which has the activity of exporting IMP, in the microorganism of the genus Corynebacterium.

(42) The terms protein having the activity of exporting IMP, enhancement, and microorganism of the genus Corynebacterium are as described above.

(43) Still another aspect of the present disclosure provides use of the protein of the present disclosure for increasing the export of IMP in the microorganism of the genus Corynebacterium.

DETAILED DESCRIPTION

(44) Hereinafter, the present disclosure will be described in detail through exemplary embodiments. However, it should be obvious to one of ordinary skill in the art that these exemplary embodiments are provided for the purpose of illustration only and are not intended to limit the scope of the present disclosure.

Example 1

Discovery of IMP Export Proteins

(45) A genomic DNA library of Corynebacterium stationis ATCC6872 was prepared for the identification of membrane proteins of Corynebacterium involved in the export of IMP. Then, since the wild-type strain of Corynebacterium cannot produce IMP, or even if it does produce IMP, it produces only a small amount thereof, a strain called CJI0323, which is capable of producing IMP, derived from the ATCC6872 strain was prepared for the identification of the ability to produce IMP. The CJI0323 strain prepared was subjected to screening of membrane proteins involved in IMP export using the genomic DNA library of the ATCC6872 strain. The specific details of the experiment are as follows.

Example 1-1

Selection of IMP-Producing Strain, CJI0323

(46) The ATCC6872 cells were suspended in a phosphate buffer (pH 7.0) or citrate buffer (pH 5.5) at a concentration of 10.sup.7 cells/mL to 10.sup.8 cells/mL to prepare an ATCC6872-derived IMP-producing strain, and the cells were subjected to UV treatment to induce mutation. The resulting cells were washed twice with a 0.85% saline solution, and then diluted and plated on a medium, which was prepared by adding a resistance-providing material at an appropriate concentration to a minimal medium containing 1.7% agar, and colonies were obtained thereafter. Each colony was cultured in a nutrient medium and cultured in a seed medium for 24 hours. After culturing the colonies for 3 to 4 days in a fermentation medium, the colony with the highest abilities to produce IMP accumulated in the culture medium was selected. In the course of preparing a strain capable of producing IMP at high concentration, in order to provide adenine auxotrophy, guanine leakage, lysozyme susceptibility, 3,4-dihydroproline resistance, streptomycin resistance, azetidine carboxylic acid resistance, thiaproline resistance, azaserine resistance, sulfaguanidine resistance, norvaline resistance, and trimethoprim resistance, the procedures above were performed sequentially for each material. As a result, CJI0323, which showed resistance to the above materials and excellent abilities to produce IMP, was finally selected. The degree of resistance between ATCC6872 and CJI0323 was compared and the results are shown in Table 1 below.

(47) TABLE-US-00001 TABLE 1 Characteristics ATCC6872 CJI0323 Adenine auxotrophy Non-auxotrophy Auxotrophy Guanine leakage Non-auxotrophy Leaky auxotrophy Lysozyme susceptibility 80 ?g/mL 8 ?g/mL 3,4-Dihydroproline resistance 1000 ?g/mL 3500 ?g/mL Streptomycin resistance 500 ?g/mL 2000 ?g/mL Azetidine carboxylic acid resistance 5 mg/mL 30 mg/mL Thiaproline resistance 10 ?g/mL 100 ?g/mL Azaserine resistance 25 ?g/mL 100 ?g/mL Sulfaguanidine resistance 50 ?g/mL 200 ?g/mL Norvaline resistance 0.2 mg/mL 2 mg/mL Trimethoprim resistance 20 ?g/mL 100 ?g/mL

(48) Minimal medium: 2% glucose, 0.3% sodium sulfate, 0.1% KH.sub.2SO.sub.4, 0.3% K.sub.2HPO.sub.4, 0.3% magnesium sulfate, calcium chloride (10 mg/L), iron sulfate (10 mg/L), zinc sulfate (1 mg/L), manganese chloride (3.6 mg/L), L-cysteine (20 mg/L), calcium pantothenate (10 mg/L), thiamine hydrochloride (5 mg/L), biotin (30 ?g/L), adenine (20 mg/L), guanine (20 mg/L), pH 7.3

(49) Nutrient medium: 1% peptone, 1% meat juice, 0.25% sodium chloride, 1% yeast extract, 2% agar, pH 7.2

(50) Seed medium: 1% glucose, 1% peptone, 1% meat juice, 1% yeast extract, 0.25% sodium chloride, adenine (100 mg/L), guanine (100 mg/L), pH 7.5

(51) Fermentation medium: 0.1% sodium glutamate, 1% ammonium chloride, 1.2% magnesium sulfate, 0.01% calcium chloride, iron sulfate (20 mg/L), manganese sulfate (20 mg/L), zinc sulfate (20 mg/L), copper sulfate (5 mg/L), L-cysteine (23 mg/L), alanine (24 mg/L), nicotinic acid (8 mg/L), biotin (45 ?g/L), thiamine hydrochloride (5 mg/L), adenine (30 mg/L), 1.9% phosphoric acid (85%), 2.55% glucose, 1.45% fructose

Example 1-2

Experiments on Fermentation Titer of CJI0323

(52) The seed medium (2 mL) was dispensed into test tubes (diameter: 18 mm), which were then autoclaved and each inoculated with ATCC6872 and CJI0323. Thereafter, the resultants were shake-cultured at 30? C. for 24 hours and then used as a seed culture solution. The fermentation medium (29 mL) was dispensed into Erlenmeyer flasks (250 mL) for shaking, autoclaved at 121? C. for 15 minutes, and the seed culture solution (2 mL) was inoculated thereto and cultured for 3 days. The culture conditions were set to 170 rpm, 30? C., and a pH of 7.5.

(53) Upon completion of the culture, the amount of IMP produced was measured by HPLC (SHIMAZDU LC20A) and the results of the culture are shown in Table 2 below.

(54) TABLE-US-00002 TABLE 2 Strain IMP (g/L) ATCC6872 0 CJI0323 9.52

(55) The CJI0323 strain was named as Corynebacterium stationis CN01-0323. The strain was deposited under the Budapest Treaty to the Korean Culture Center of Microorganisms (KCCM) on Nov. 7, 2017. In addition, the strain was designated as Accession No. KCCM12151P.

Example 1-3

Discovery of Exporting Proteins

(56) Screening conditions showing growth inhibition of the CJI0323 strain were established by additionally adding IMP to the minimal medium containing 1.7% agar. The plasmids of the genomic library of the ATCC6872 strain were transformed into the CJI0323 strain by electroporation (van der Rest et al. 1999), and those colonies in which the growth inhibition was released under the medium conditions supplemented with an excess amount of IMP were selected. Plasmids were obtained from the selected colonies and analyzed by a sequencing technique. As a result, one kind of membrane protein involved in the release of the growth inhibition was identified under the condition where an excess amount of IMP was added.

(57) The one kind of membrane protein from Corynebacterium was identified based on the amino acid sequence of SEQ ID NO: 2 and the nucleotide sequence of SEQ ID NO: 4 (NCBI GenBank: NZ_CP014279, WP_066795121, MFS transporter). The membrane protein is known as the MFS transporter, but its specific function has not been confirmed, and further, its function regarding the IMP export is still unknown. In the present disclosure, the membrane protein was named ImpE2(WT).

Example 2

Identification of impE1 and impE2

Example 2-1

Confirmation of impE1 and impE2

(58) In order to examine the functions of the membrane protein, ImpE2, the gene structure of SEQ ID NO: 4 was confirmed in the NCBI (NCBI GenBank: NZ_CP014279, WP_066795121, MFS transporter). As a result, it was confirmed that the 7 bp starting portion of the ORF of SEQ ID NO: 4 (impE2) overlaps in 7 bp with a different gene (NCBI GenBank: NZ_CP014279, WP_066795119, transcriptional regulator), which is located upstream of impE2. Since the functions of the gene located upstream of impE2 and the protein encoded by the gene have not been confirmed, in the present disclosure, the protein was named ImpE1(WT) (the amino acid sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 3).

Example 2-2

Preparation of impE1- or impE2-Deficient Vector

(59) In order to confirm whether the deletion of ImpE1 or ImpE2, which are involved in releasing the growth inhibition caused by IMP as identified in Examples 1 and 2-1, in an IMP-producing strain can reduce its IMP-exporting ability, attempts were made to prepare vectors deficient in each of the genes.

(60) The gene fragments for preparing the vectors were obtained by PCR using the genomic DNA of the ATCC6872 strain as a template.

(61) Specifically, the PCR for impE1 was performed using primers of SEQ ID NOS: 5 and 6 and primers of SEQ ID NOS: 7 and 8; and the PCR for impE2 was performed using the primers of SEQ ID NOS: 9 and 10 and primers of SEQ ID NOS: 11 and 12 (Table 3).

(62) TABLE-US-00003 TABLE3 SEQ ID NO Primer Sequence(5to3) 5 impE1kop-1 GCTCTAGACGAGAAAGCTA AAGCCGGTGA 6 impE1kop-2 GTTTTTAGCTACCATTGTT ACACCCCGTGCAAGTTT 7 impE1kop-3 GCACGGGGTGTAACAATGG TAGCTAAAAACTCCACC 8 impE1kop-4 GCTCTAGAAATAGTTGGGG AAGTCCACTC 9 impE2kop-1 GCTCTAGACTTGGATGACC TGGTGGAAAA 10 impE2kop-2 CTTGGAGAAAATTTCCTAC CATTCCAGTCCTTTCGT 11 impE2kop-3 GGACTGGAATGGTAGGAAA TTTTCTCCAAGGGAAAT 12 impE2kop-4 GGACTAGTGGATTGTGTTG ACGCACGATG 13 impE1E2kop-2 CTTGGAGAAAATTTCTGTT ACACCCCGTGCAAGTTT 14 impE1E2kop-3 GCACGGGGTGTAACAGAAA TTTTCTCCAAGGGAAAT

(63) In particular, the primers used were prepared based on information on a gene of Corynebacterium stationis (ATCC6872) (NCBI Genbank: NZ_CP014279) registered in NIH GenBank and the nucleotide sequences adjacent thereto.

(64) PCR was performed by initial denaturation at 94? C. for 5 minutes; 25 cycles consisting of denaturation at 94? C. for 30 seconds, annealing at 52? C. for 30 minutes, and polymerization at 72? C. for 1 minute; and final polymerization at 72? C. for 5 minutes.

(65) Overlapping PCR was performed using two fragments of the impE1 gene, which were amplified using the primers of SEQ ID NOS: 5 and 6 and the primers of SEQ ID NOS: 7 and 8, as templates, and as a result, a polynucleotide template (1.8 kbp) was obtained. The obtained gene fragment was cloned into a linearized pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001), which was digested with the restriction enzyme (XbaI), and ligated using T4 ligase, and thereby the pDZ-?impE1 vector was prepared. Additionally, overlapping polymerase chain reaction was performed using a fragment of the impE2 gene, amplified using the primers of SEQ ID NOS: 9 and 10, and two fragments of the impE2 gene, amplified using the primers of SEQ ID NOS: 11 and 12, as templates, and as a result, a polynucleotide template (1.7 kbp) was obtained. The obtained gene fragment was digested with restriction enzymes, XbaI and SpeI. The gene fragment was cloned using T4 ligase into a linearized pDZ vector, which had already been digested with the restriction enzyme (XbaI), and thereby the pDZ-_?impE2 vector was prepared.

Example 2-3

Preparation of impE1- and impE2-Integration-Deficient Vectors

(66) Since the impE1 and impE2 genes, which encode proteins involved in releasing the growth inhibition caused by IMP, are overlapped, there is a need to regulate both genes simultaneously. Therefore, attempts were made to prepare a vector in which both impE1 and impE2 are deficient.

(67) For the PCR of impE1 and impE2 genes, primers of SEQ ID NOS: 5 and 13 and primers of SEQ ID NOS: 14 and 12 were used. The primers used were prepared based on information on a gene of Corynebacterium stationis (ATCC6872) (NCBI Genbank: NZ_CP014279) registered in NIH GenBank and the nucleotide sequences adjacent thereto. Overlapping PCR was performed using a fragment of the impE1 gene, amplified using the primers of SEQ ID NOS: 5 and 13, and two fragments of the impE2 gene, amplified using the primers of SEQ ID NOS: 14 and 12, as templates, and as a result, a polynucleotide template (2.0 kbp) was obtained. The obtained gene fragments were digested with XbaI and SpeI, respectively. The gene fragments were cloned using T4 ligase into a linearized pDZ vector, which had already been digested with the restriction enzyme (XbaI), and thereby the pDZ-?impE1E2 vector was prepared.

Example 2-4

Preparation of impE1- and impE2-Deficient Strains

(68) The two kinds of plasmids prepared in Example 2-2 and one kind of plasmid prepared in Example 2-3 were each transformed into the CJI0323 strain by electroporation (using the transformation method disclosed in Appl. Microbiol. Biotechnol. (1999) 52: 541 to 545). The strains in which the vector was inserted into the chromosome by recombination of the homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to a second cross-over. The genetic deficiency in the finally transformed strains was confirmed by performing PCR using the primer pairs of SEQ ID NOS: 5 and 8, SEQ ID NOS: 9 and 12, and SEQ ID NOS: 5 and 12.

(69) The selected strains were named CJI0323_?impE1, CJI0323_?impE2, and CJI0323_?impE1E2. Additionally, the abilities to produce IMP of these strains was evaluated.

(70) The seed medium (2 mL) was dispensed into test tubes (diameter: 18 mm), which were then autoclaved, each inoculated with CJI0323, CJI0323_?impE1, CJI0323_?impE2, and CJI0323_?impE1E2, shake-cultured at 30? C. for 24 hours, and used as seed culture solutions. The fermentation medium (29 mL) was dispensed into Erlenmeyer flasks (250 mL) for shaking and autoclaved at 121? C. for 15 minutes. Then, the seed culture solution (2 mL) was inoculated thereto and the resultant was cultured for 3 days. The culture conditions were set to 170 rpm, 30? C., and a pH of 7.5.

(71) Upon completion of the culture, the amount of IMP produced was measured by HPLC, and the results of the culture are shown in Table 4 below.

(72) TABLE-US-00004 TABLE 4 Strain IMP (g/L) CJI0323 9.52 CJI0323_?impE1 1.92 CJI0323_?impE2 1.88 CJI0323_?impE1E2 1.80

(73) The IMP amount accumulated in each strain was compared with that of the parent strain, Corynebacterium stationis CJI0323. As a result, it was found that, as shown in Table 4 above, the IMP concentrations of the strains CJI0323_?impE1, CJI0323_?impE2, and CJI0323_?impE1E2 were reduced by about 8 g/L under the same conditions compared to the parent strain, confirming that ImpE1 and ImpE2 are proteins involved in the IMP export.

Example 3

Confirmation of Nucleotide Sequences of impE1 and impE2 of IMP-Producing Strain, CJI0323

(74) In the case of the CJI0323 strain producing IMP at high concentration in Example 1, it is possible that the strain has an improved IMP-exporting ability so as to produce IMP at high concentration. Accordingly, an attempt was made to confirm the presence of any mutation in impE1 and impE2 of the CJI0323 strain.

(75) The chromosomal DNA of the CJI0323 strain was amplified by polymerase chain reaction (hereinafter, PCR). Specifically, first, PCR was performed by repeating 28 cycles consisting of denaturation at 94? C. for 1 minute, annealing at 58? C. for 30 seconds, and polymerization at 72? C. for 2 minutes using the chromosomal DNA of the CJI0323 strain as a template along with the primers of SEQ ID NOS: 15 and 16 (Table 5), and thereby a fragment of about 2.8 kbp was amplified.

(76) TABLE-US-00005 TABLE5 SEQ ID NO Primer Sequence(5to3) 15 impE1E2seqF GAACGGAGTCATCTCCTTTGC 16 impE1E2seqR CCAAACGCTCTGCAAGAAACTG

(77) Upon analysis of the nucleotide sequence using the same primers, it was confirmed that the 490.sup.th nucleotide of the impE1 gene (i.e., g) was substituted with a, compared to the nucleotide sequence of the wild-type strain, ATCC6872. This substitution indicates that there was a modification in which the 164.sup.th amino acid of the ImpE1 protein (i.e., glutamic acid) was substituted with lysine.

(78) Additionally, it was confirmed that the 4.sup.th nucleotide of the impE2 gene (i.e., g) was substituted with a (this means that the 666.sup.th nucleotide of the impE1 gene (i.e., g) was substituted with a) and the 191.sup.st nucleotide of the impE1 gene (i.e., g) was substituted with a. These substitutions indicate that there were modifications in which the 2.sup.nd amino acid of the ImpE2 protein (i.e., valine), which corresponds to the 222.sup.nd amino acid of the ImpE1 protein, was substituted with isoleucine; and the 64.sup.th amino acid of the ImpE2 protein (i.e., glycine) was substituted with glutamic acid.

(79) The impE1 nucleotide of the CJI0323 strain was named impE1_CJI0323 (SEQ ID NO: 143) and the protein thereof was named ImpE1_CJI0323 (SEQ ID NO: 141), whereas the impE2 nucleotide of the CJI0323 strain was named impE2_CJI0323 (SEQ ID NO: 144) and the protein thereof was named ImpE2_CJI0323 (SEQ ID NO: 142).

Example 4

Recovery of Modifications in impE1 and impE2

Example 4-1

Preparation of Vectors for Recovering Modifications in impE1 or impE2

(80) In Example 3, the presence of any modification in impE1 and impE2 of the IMP-producing strain CJI0323 was examined. As a result, it was confirmed that impE1 had one modification and impE2 had two modifications. Since the CJI0323 strain produces IMP at a high concentration, it is highly likely that the modification is one that can improve the ability to export IMP. Accordingly, after recovering the mutated impE1 and impE2 to the native wild-type ImpE without modification, the following experiment was performed to confirm whether each modification actually imparted the IMP-exporting ability.

(81) To prepare a recovery vector, PCR was performed using Corynebacterium stationis ATCC6872 as a template.

(82) The impE1impE2 gene fragment amplified using the primers of SEQ ID NOS: 17 and 18 was treated with a restriction enzyme, XbaI, and cloned into the XbaI restriction site on the pDZ vector, and thereby the pDZ-impE1E2(WT) was prepared.

Example 4-2

Preparation of Vectors with Single Modification in impE1 or impE2

(83) A vector with a single E164K modification in the ImpE1 gene was prepared using the native wild-type strain, Corynebacterium stationis ATCC6872, as a template along with the primers of SEQ ID NOS: 19 and 20 and primers of SEQ ID NOS: 21 and 22. Overlapping PCR was performed using an E164K-1 gene fragment amplified using the primers of SEQ ID NOS: 19 and 20 and two E164K-2 gene fragments amplified using the primers of SEQ ID NOS: 21 and 22, and thereby a template with a 1.8 kbp polynucleotide was obtained. The obtained gene fragments were digested with XbaI and cloned into a linearized pDZ vector, which had already been digested with XbaI, using T4 ligase, and thereby the pDZ-impE1(E164K) vector was prepared.

(84) A vector with a single V2I modification in the ImpE2 gene was prepared using the ATCC6872 strain as a template along with the primers of SEQ ID NOS: 19 and 23 and primers of SEQ ID NOS: 24 and 22. Overlapping PCR was performed using a V2I-1 gene fragment amplified using the primers of SEQ ID NOS: 19 and 23 and two V2I-2 gene fragments amplified using the primers of SEQ ID NOS: 24 and 22, and thereby a template with a 1.8 kbp polynucleotide was obtained. The obtained gene fragments were digested with XbaI and cloned into a linearized pDZ vector, which had already been digested with XbaI, using T4 ligase, and thereby the pDZ-impE2(V21) vector was prepared.

(85) A vector with a single G64E modification in the ImpE2 gene was prepared using the ATCC6872 strain as a template along with the primers of SEQ ID NOS: 19 and 25 and primers of SEQ ID NOS: 26 and 22. Overlapping PCR was performed using a G64E-1 gene fragment amplified using the primers of SEQ ID NOS: 19 and 25 and two G64E-2 gene fragments amplified using the primers of SEQ ID NOS: 26 and 22, and thereby a template with a 1.8 kbp polynucleotide was obtained. The obtained gene fragments were digested with XbaI and cloned into a linearized pDZ vector, which had already been digested with XbaI, using T4 ligase, and thereby the pDZ-impE2(G64E) vector was prepared.

(86) TABLE-US-00006 TABLE6 SEQ ID NO Primer Sequence(5to3) 17 impE1E2WTF GCTCTAGAGAACGGAGTCATCTCC TTTGC 18 impE1E2WTR GCTCTAGACCAAACGCTCTGCAA GAAACTG 19 impE1164K-1 GCTCTAGACTTGGATGACCTGGT GGAAAA 20 impE1164K-2 CTGGGGCGCGTTGTTTTTCAGGA CTGCTCCGAAGACG 21 impE1164K-3 AACAACGCGCCCCAGAATTGG 22 impE1164K-4 GCTCTAGAAATAGTTGGGGAAG TCCACTC 23 impE2V2I-2 TGGAGTTTTTAGCTATCATTCCA GTCCTTTCGTGTAA 24 impE2V2I-3 TAGCTAAAAACTCCACCCCAA 25 impE2G64E-2 CCGAAAATCATCTGCTCCAAAGA GCTCATCAGCATGG 26 impE2G64E-3 GCAGATGATTTTCGGTTCCGC

Example 4-3

Recovery of impE1, impE2 Modifications and Preparation of Strains with Single Modification

(87) The plasmid prepared in Example 4-1 was transformed into the CJI0323 strain by electroporation (using the transformation method disclosed in Appl. Microbiol. Biotechnol. (1999) 52: 541 to 545). The strains in which the vector was inserted into the chromosome by recombination of the homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to a second cross-over. The recovery of the modification in the finally transformed strains was confirmed by performing PCR using the primer pair of SEQ ID NOS: 15 and 16, followed by nucleotide sequencing analysis. The prepared strain was named CJI0323_impE1E2(W7).

(88) The three kinds of plasmids prepared in Example 4-2 were each transformed into the CJI0323_impE1E2(W7) strain by electroporation (using the transformation method disclosed in Appl. Microbiol. Biotechnol. (1999) 52: 541 to 545). The strains in which the vector was inserted into the chromosome by recombination of the homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to a second cross-over. The introduction of the modification in the finally transformed strains was confirmed by performing PCR using the primer pair of SEQ ID NOS: 15 and 16, followed by nucleotide sequencing analysis. The selected strains were named CJI0323_impE1(E164K), CJI0323_impE2(V21), and CJI0323_impE2(G64E).

(89) The Corynebacterium stationis CJI0323_impE1(E164K), Corynebacterium stationis CJI0323_impE2(V2I), and Corynebacterium stationis CJI0323_impE2(G64E) strains were deposited under the Budapest Treaty to the Korean Culture Center of Microorganisms (KCCM) on Nov. 2, 2018. In addition, the strains were designated with Accession Nos. KCCM12359P, KCCM12360P, and KCCM12361P, respectively.

Example 4-4

Preparation of impE1- and impE2-Integration-Modified Strains

(90) The pDZ-impE2(V21) and pDZ-impE2(G64E) plasmids prepared in Example 4-2 were transformed into the CJI0323_impE1(E164K) strain by electroporation (using the transformation method disclosed in Appl. Microbiol. Biotechnol. (1999) 52: 541 to 545). The strains in which the vectors were inserted into the chromosome by recombination of the homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to a second cross-over. The introduction of the modification in the finally transformed strains was confirmed by performing PCR using the primer pair of SEQ ID NOS: 15 and 16, followed by nucleotide sequencing analysis. The prepared strains were named CJI0323_impE1(E164K)_impE2(V21) and CJI0323_impE1(164K)_impE2(G64E).

(91) The pDZ-impE2(G64E) plasmid was transformed into the CJI0323_impE2(V21) strain by electroporation (using the transformation method disclosed in Appl. Microbiol. Biotechnol. (1999) 52: 541 to 545). The strains in which the vector was inserted into the chromosome by recombination of the homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to a second cross-over. The introduction of the modification in the finally transformed strains was confirmed by performing PCR using the primer pair of SEQ ID NOS: 15 and 16, followed by nucleotide sequencing analysis. The selected strain was named CJI0323_impE2(V21)(G64E).

Example 4-5

Evaluation of Strains with impE1, impE2 Modifications

(92) The seed medium (2 mL) was dispensed into test tubes (diameter: 18 mm), which were then autoclaved, each inoculated with CJI0323_impE1E2(WT), CJI0323_impE1(E164K), CJI0323_impE2(V21), CJI0323_impE2(G64E), CJI0323_impE1(E164K)_impE2(V21), CJI0323_impE1(E164K)_impE2(G64E), and CJI0323_impE2(V21)(G64E), shake-cultured at 30? C. for 24 hours, and used as seed culture solutions. The fermentation medium (29 mL) was dispensed into Erlenmeyer flasks (250 mL) for shaking and autoclaved at 121? C. for 15 minutes. Then, the seed culture solutions (2 mL) were inoculated thereto and the resultants were cultured for 3 days. The culture conditions were set to 170 rpm, 30? C., and a pH of 7.5.

(93) Upon completion of the culture, the amount of IMP produced was measured by HPLC, and the results of the culture are shown in Table 7 below.

(94) TABLE-US-00007 TABLE 7 Strain IMP (g/L) CJI0323 9.52 CJI0323_impE1E2(WT) 2.32 CJI0323_impE1(E164K) 2.57 CJI0323_impE2(V2I) 3.11 CJI0323_impE2(G64E) 3.27 CJI0323_impE1(E164K)_impE2(V2I) 4.24 CJI0323_impE1(E164K)_impE2(G64E) 6.27 CJI0323_impE2(V2I)(G64E) 7.35

(95) As shown above, it was confirmed that with respect to each modification position, one kind of modification, the integration of two kinds of modifications, and the integration of three kinds of modifications were all involved in the IMP export. Accordingly, in a microorganism of the genus Corynebacterium which does not produce IMP or produces only a small amount thereof, the increase in the amount of IMP production due to modifications of the ImpE protein of the present disclosure can be interpreted to be very meaningful.

Example 5

Substitution of Amino Acids in impE1, impE2 Modifications with Another Amino Acids

Example 5-1

Preparation of Vectors for Substitutional Insertion of Amino Acids in impE1, impE2 Modifications

(96) To confirm the positional importance of the representative three kinds of modifications (i.e., impE1(E164K), impE2(V2I), and impE2(G64E)) with enhanced abilities to produce IMP as identified in the results above, a vector for introducing modifications (e.g., a modification of substituting the 164.sup.th amino acid in the amino acid sequence of impE1, the 2.sup.nd amino acid in the amino acid sequence of impE2, and the 64.sup.th amino acid in the amino acid sequence of impE2 with an another amino acid) was prepared.

(97) Firstly, the procedure of preparing the vector for the introduction of the ImpE1(E164K) modification is as follows.

(98) Based on the reported polynucleotide sequences, the chromosomal genes of Corynebacterium stationis CJI0323 were isolated, and gene fragments were obtained by performing PCR using the chromosomal DNA of Corynebacterium stationis CJI0323 as a template along with primer pairs between the primer of SEQ ID NO: 27 and each of SEQ ID NOS: 28 to 45. PCR was performed by initial denaturation at 94? C. for 5 minutes; 20 cycles consisting of denaturation at 94? C. for 30 seconds, annealing at 55? C. for 30 seconds, and polymerization at 72? C. for 1 minute; and final polymerization at 72? C. for 5 minutes. As a result, 18 kinds of 0.7 kbp polynucleotides were obtained. Then, the chromosomal genes of Corynebacterium stationis CJI0323 were isolated, and gene fragments were obtained by performing PCR using the chromosomal DNA of Corynebacterium stationis CJI0323 as a template along with primer pairs between the primer of SEQ ID NO: 46 and each of SEQ ID NOS: 47 to 64. PCR was performed by initial denaturation at 94? C. for 5 minutes; 20 cycles consisting of denaturation at 94? C. for 30 seconds, annealing at 55? C. for 30 seconds, and polymerization at 72? C. for 1 minute; and final polymerization at 72? C. for 5 minutes. As a result, 18 kinds of 0.7 kbp polynucleotides were obtained.

(99) Overlapping PCR was performed using two fragments obtained from the above results as a template, and thereby 18 kinds of 1.4 kbp polynucleotides to be used as templates were obtained. The obtained gene fragments were digested with a restriction enzyme, SpeI, ligated to the linearized pDZ vector, which had already been digested with a restriction enzyme, XbaI, transformed into E. coli DH5?, and the transformants were plated on a solid LB medium containing kanamycin (25 mg/L).

(100) The sequence information on the primers used for the preparation of the vector is shown in Table 8 below.

(101) TABLE-US-00008 TABLE8 SEQ ID NO Primer Sequence(5to3) 27 Spe1-impE1164 GGGACTAGTGATTCCGGCCAACTGTCG 1F 28 impE1164-R1R TGGGGCGCGTTGGCGTTCAGGATGCTC 29 impE1164-H1R TGGGGCGCGTTGGTGTTCAGGATGCTC 30 impE1164-D1R TGGGGCGCGTTGATCTTCAGGATGCTC 31 impE1164-S1R TGGGGCGCGTTGGGATTCAGGATGCTC 32 impE1164-T1R TGGGGCGCGTTGGGTTTCAGGATGCTC 33 impE1164-N1R TGGGGCGCGTTGGTTTTCAGGATGCTC 34 impE1164-Q1R TGGGGCGCGTTGCTGTTCAGGATGCTC 35 impE1164-C1R TGGGGCGCGTTGGCATTCAGGATGCTC 36 impE1164-G1R TGGGGCGCGTTGGCCTTCAGGATGCTC 37 impE1164-P1R TGGGGCGCGTTGCGGTTCAGGATGCTC 38 impE1164-A1R TGGGGCGCGTTGGGCTTCAGGATGCTC 39 impE1164-V1R TGGGGCGCGTTGGACTTCAGGATGCTC 40 impE1164-11R TGGGGCGCGTTGGATTTCAGGATGCTC 41 impE1164-L1R TGGGGCGCGTTGCAGTTCAGGATGCTC 42 impE1164-M1R TGGGGCGCGTTGCATTTCAGGATGCTC 43 impE1164-F1R TGGGGCGCGTTGGAATTCAGGATGCTC 44 impE1164-Y1R TGGGGCGCGTTGGTATTCAGGATGCTC 45 impE1164-W1R TGGGGCGCGTTGCCATTCAGGATGCTC 46 Spe1-impE1164 GGGACTAGTCATGAACTTGCCGCGCTC 2R 47 impE1164-R2F GAGCATCCTGAACGCCAACGCGCCCCA 48 impE1164-H2F GAGCATCCTGAACACCAACGCGCCCCA 49 impE1164-D2F GAGCATCCTGAAGATCAACGCGCCCCA 50 impE1164-S2F GAGCATCCTGAATCCCAACGCGCCCCA 51 impE1164-T2F GAGCATCCTGAAACCCAACGCGCCCCA 52 impE1164-N2F GAGCATCCTGAAAACCAACGCGCCCCA 53 impE1164-Q2F GAGCATCCTGAACAGCAACGCGCCCCA 54 impE1164-C2F GAGCATCCTGAATGCCAACGCGCCCCA 55 impE1164-G2F GAGCATCCTGAAGGCCAACGCGCCCCA 56 impE1164-P2F GAGCATCCTGAACCGCAACGCGCCCCA 57 impE1164-A2F GAGCATCCTGAAGGCCAACGCGCCCCA 58 impE1164-V2F GAGCATCCTGAAGTCCAACGCGCCCCA 59 impE1164-I2F GAGCATCCTGAAATCCAACGCGCCCCA 60 impE1164-L2F GAGCATCCTGAACTGCAACGCGCCCCA 61 impE1164-M2F GAGCATCCTGAAATGCAACGCGCCCCA 62 impE1164-F2F GAGCATCCTGAATTCCAACGCGCCCCA 63 impE1164-Y2F GAGCATCCTGAATACCAACGCGCCCCA 64 impE1164-W2F GAGCATCCTGAATGGCAACGCGCCCCA

(102) After selecting by PCR the colonies transformed with the vector into which the target gene was inserted, the plasmids were obtained using a conventionally known plasmid extraction method. The information on the obtained plasmids is shown in Table 9 below.

(103) TABLE-US-00009 TABLE 9 No. Plasmid 1 pDZ-impE1 164R 2 pDZ-impE1 164H 3 pDZ-impE1 164D 4 pDZ-impE1 164S 5 pDZ-impE1 164T 6 pDZ-impE1 164N 7 pDZ-impE1 164Q 8 pDZ-impE1 164C 9 pDZ-impE1 164G 10 pDZ-impE1 164P 11 pDZ-impE1 164A 12 pDZ-impE1 164V 13 pDZ-impE1 164I 14 pDZ-impE1 164L 15 pDZ-impE1 164M 16 pDZ-impE1 164F 17 pDZ-impE1 164Y 18 pDZ-impE1 164W

(104) Secondly, the procedure of preparing the vector for the introduction of the ImpE2(V2I) is as follows.

(105) Based on the reported polynucleotide sequences, the chromosomal genes of Corynebacterium stationis CJI0323 were isolated, and gene fragments were obtained by performing PCR using the chromosomal DNA of Corynebacterium stationis CJI0323 as a template along with primer pairs between the primer of SEQ ID NO: 65 and each of SEQ ID NOS: 66 to 83. PCR was performed by initial denaturation at 94? C. for 5 minutes; 20 cycles consisting of denaturation at 94? C. for 30 seconds, annealing at 55? C. for 30 seconds, and polymerization at 72? C. for 1 minute; and final polymerization at 72? C. for 5 minutes. As a result, 18 kinds of 0.7 kbp polynucleotides were obtained. Then, the chromosomal genes of Corynebacterium stationis CJI0323 were isolated, and gene fragments were obtained by performing PCR using the chromosomal DNA of Corynebacterium stationis CJI0323 as a template along with primer pairs between the primer of SEQ ID NO: 84 and each of SEQ ID NOS: 85 to 102. PCR was performed by initial denaturation at 94? C. for 5 minutes; 20 cycles consisting of denaturation at 94? C. for 30 seconds, annealing at 55? C. for 30 seconds, and polymerization at 72? C. for 1 minute; and final polymerization at 72? C. for 5 minutes. As a result, 18 kinds of 0.7 kbp polynucleotides were obtained.

(106) Overlapping PCR was performed using two fragments obtained from the above results as a template, and thereby 18 kinds of 1.4 kbp polynucleotides to be used as templates were obtained. The obtained gene fragments were digested with a restriction enzyme, XbaI, ligated to the linearized pDZ vector, which had already been digested with a restriction enzyme, XbaI, transformed into E. coli DH5?, and the transformants were plated on a solid LB medium containing kanamycin (25 mg/L).

(107) The sequence information on the primers used for the preparation of the vector is shown in Table 10 below.

(108) TABLE-US-00010 TABLE10 SEQ ID NO Primer Sequence(5to3) 65 XbaI-impE221F GGGTCTAGATTGCATGCTGTGCAAGA 66 impE22-R1R GGAGTTTTTAGCGCGCATTCCAGTCCT 67 impE22-H1R GGAGTTTTTAGCGTGCATTCCAGTCCT 68 impE22-K1R GGAGTTTTTAGCCTTCATTCCAGTCCT 69 impE22-D1R GGAGTTTTTAGCGTCCATTCCAGTCCT 70 impE22-E1R GGAGTTTTTAGCTTCCATTCCAGTCCT 71 impE22-S1R GGAGTTTTTAGCGGACATTCCAGTCCT 72 impE22-T1R GGAGTTTTTAGCGGTCATTCCAGTCCT 73 impE22-N1R GGAGTTTTTAGCGTTCATTCCAGTCCT 74 impE22-Q1R GGAGTTTTTAGCCTGCATTCCAGTCCT 75 impE22-C1R GGAGTTTTTAGCGCACATTCCAGTCCT 76 impE22-G1R GGAGTTTTTAGCGCCCATTCCAGTCCT 77 impE22-P1R GGAGTTTTTAGCTGGCATTCCAGTCCT 78 impE22-A1R GGAGTTTTTAGCAGCCATTCCAGTCCT 79 impE22-L1R GGAGTTTTTAGCCAGCATTCCAGTCCT 80 impE22-M1R GGAGTTTTTAGCCATCATTCCAGTCCT 81 impE22-F1R GGAGTTTTTAGCGAACATTCCAGTCCT 82 impE22-Y1R GGAGTTTTTAGCGTACATTCCAGTCCT 83 impE22-W1R GGAGTTTTTAGCCCACATTCCAGTCCT 84 XbaI-impE222R GGGTCTAGATTGCTCGCCCACGCGCA 85 impE22-R2F AGGACTGGAATGCGCGCTAAAAACTCC 86 impE22-H2F AGGACTGGAATGCACGCTAAAAACTCC 87 impE22-K2F AGGACTGGAATGAAGGCTAAAAACTCC 88 impE22-D2F AGGACTGGAATGGACGCTAAAAACTCC 89 impE22-E2F AGGACTGGAATGGAAGCTAAAAACTCC 90 impE22-S2F AGGACTGGAATGTCCGCTAAAAACTCC 91 impE22-T2F AGGACTGGAATGACCGCTAAAAACTCC 92 impE22-N2F AGGACTGGAATGAACGCTAAAAACTCC 93 impE22-Q2F AGGACTGGAATGCAGGCTAAAAACTCC 94 impE22-C2F AGGACTGGAATGTGCGCTAAAAACTCC 95 impE22-G2F AGGACTGGAATGGGCGCTAAAAACTCC 96 impE22-P2F AGGACTGGAATGCCAGCTAAAAACTCC 97 impE22-A2F AGGACTGGAATGGCTGCTAAAAACTCC 98 impE22-L2F AGGACTGGAATGCTGGCTAAAAACTCC 99 impE22-M2F AGGACTGGAATGATGGCTAAAAACTCC 100 impE22-F2F AGGACTGGAATGTTCGCTAAAAACTCC 101 impE22-Y2F AGGACTGGAATGTACGCTAAAAACTCC 102 impE22-W2F AGGACTGGAATGTGGGCTAAAAACTCC

(109) After selecting by PCR the colonies transformed with the vector into which the target gene was inserted, the plasmids were obtained using a conventionally known plasmid extraction method. The information on the obtained plasmids is shown in Table 11 below.

(110) TABLE-US-00011 TABLE 11 No. Plasmid 1 pDZ-impE2 2R 2 pDZ-impE2 2H 3 pDZ-impE2 2K 4 pDZ-impE2 2D 5 pDZ-impE2 2E 6 pDZ-impE2 2S 7 pDZ-impE2 2T 8 pDZ-impE2 2N 9 pDZ-impE2 2Q 10 pDZ-impE2 2C 11 pDZ-impE2 2G 12 pDZ-impE2 2P 13 pDZ-impE2 2A 14 pDZ-impE2 2L 15 pDZ-impE2 2M 16 pDZ-impE2 2F 17 pDZ-impE2 2Y 18 pDZ-impE2 2W

(111) Lastly, the procedure of preparing the vector for the introduction of the ImpE2(G64E) is as follows.

(112) Based on the reported polynucleotide sequences, the chromosomal genes of Corynebacterium stationis CJI0323 were isolated, and gene fragments were obtained by performing PCR using the chromosomal DNA of Corynebacterium stationis CJI0323 as a template denaturation at 94? C. for 30 seconds, annealing at 55? C. for 30 seconds, and poly along with primer pairs between the primer of SEQ ID NO: 103 and each of SEQ ID NOS: 104 to 121. PCR was performed by initial denaturation at 94? C. for 5 minutes; 20 cycles consisting of denaturation at 94? C. for 30 seconds, annealing at 55? C. for 30 seconds, and polymerization at 72? C. for 1 minute; and final polymerization at 72? C. for 5 minutes. As a result, 18 kinds of 1 kbp polynucleotides were obtained. Then, the chromosomal genes of Corynebacterium stationis CJI0323 were isolated, and gene fragments were obtained by performing PCR using the chromosomal DNA of Corynebacterium stationis CJI0323 as a template along with primer pairs between the primer of SEQ ID NO: 84 and each of SEQ ID NOS: 85 to 102. PCR was performed by initial denaturation at 94? C. for 5 minutes; 20 cycles consisting of polymerization at 72? C. for 1 minute; and final polymerization at 72? C. for 5 minutes. As a result, 18 kinds of 1 kbp polynucleotides were obtained.

(113) Overlapping PCR was performed using two fragments obtained from the above results as a template, and thereby 18 kinds of 2 kbp polynucleotides to be used as templates were obtained. The obtained gene fragments were digested with a restriction enzyme, XbaI, ligated to the linearized pDZ vector, which had already been digested with a restriction enzyme, XbaI, transformed into E. coli DH5?, and the transformants were plated on a solid LB medium containing kanamycin (25 mg/L).

(114) The sequence information on the primers used for the preparation of the vector is shown in Table 12 below.

(115) TABLE-US-00012 TABLE12 SEQ ID NO Primer Sequence(5to3) 103 XbaI-impE264 GGGTCTAGAAAAGAGCTTAAGGCAGCT 1F GCT 104 impE264-R1R GAAAATCATCTGGCGCAAAGAGCTCAT 105 impE264-H1R GAAAATCATCTGGTGCAAAGAGCTCAT 106 impE264-D1R GAAAATCATCTGGTCCAAAGAGCTCAT 107 impE264-K1R GAAAATCATCTGCTTCAAAGAGCTCAT 108 impE264-S1R GAAAATCATCTGGGACAAAGAGCTCAT 109 impE264-T1R GAAAATCATCTGGGTCAAAGAGCTCAT 110 impE264-N1R GAAAATCATCTGGTTCAAAGAGCTCAT 111 impE264-Q1R GAAAATCATCTGGTGCAAAGAGCTCAT 112 impE264-C1R GAAAATCATCTGGGACAAAGAGCTCAT 113 impE264-P1R GAAAATCATCTGTGGCAAAGAGCTCAT 114 impE264-A1R GAAAATCATCTGAGCCAAAGAGCTCAT 115 impE264-V1R GAAAATCATCTGGACCAAAGAGCTCAT 116 impE264-11R GAAAATCATCTGGATCAAAGAGCTCAT 117 impE264-L1R GAAAATCATCTGCAGCAAAGAGCTCAT 118 impE264-M1R GAAAATCATCTGGATCAAAGAGCTCAT 119 impE264-F1R GAAAATCATCTGGAACAAAGAGCTCAT 120 impE264-Y1R GAAAATCATCTGGTACAAAGAGCTCAT 121 impE264-W1R GAAAATCATCTGCCACAAAGAGCTCAT 122 XbaI-impE264 GGGTCTAGACGGTCAATGAAGTCTCAA 2R CGG 123 impE264-R2F ATGAGCTCTTTGCGCCAGATGATTTTC 124 impE264-H2F ATGAGCTCTTTGCACCAGATGATTTTC 125 impE264-D2F ATGAGCTCTTTGGACCAGATGATTTTC 126 impE264-K2F ATGAGCTCTTTGAAGCAGATGATTTTC 127 impE264-S2F ATGAGCTCTTTGTCCCAGATGATTTTC 128 impE264-T2F ATGAGCTCTTTGACCCAGATGATTTTC 129 impE264-N2F ATGAGCTCTTTGAACCAGATGATTTTC 130 impE264-Q2F ATGAGCTCTTTGCAGCAGATGATTTTC 131 impE264-C2F ATGAGCTCTTTGTGCCAGATGATTTTC 132 impE264-P2F ATGAGCTCTTTGCCACAGATGATTTTC 133 impE264-A2F ATGAGCTCTTTGGCTCAGATGATTTTC 134 impE264-V2F ATGAGCTCTTTGGTCCAGATGATTTTC 135 impE264-I2F ATGAGCTCTTTGATCCAGATGATTTTC 136 impE264-L2F ATGAGCTCTTTGCTGCAGATGATTTTC 137 impE264-M2F ATGAGCTCTTTGATGCAGATGATTTTC 138 impE264-F2F ATGAGCTCTTTGTTCCAGATGATTTTC 139 impE264-Y2F ATGAGCTCTTTGTACCAGATGATTTTC 140 impE264-W2F ATGAGCTCTTTGTGGCAGATGATTTTC

(116) After selecting by PCR the colonies transformed with the vector into which the target gene was inserted, the plasmids were obtained using a conventionally known plasmid extraction method. The information on the obtained plasmids is shown in Table 13 below.

(117) TABLE-US-00013 TABLE 13 No. Plasmid 1 pDZ-impE2 64R 2 pDZ-impE2 64H 3 pDZ-impE2 64D 4 pDZ-impE2 64K 5 pDZ-impE2 64S 6 pDZ-impE2 64T 7 pDZ-impE2 64N 8 pDZ-impE2 64Q 9 pDZ-impE2 64C 10 pDZ-impE2 64P 11 pDZ-impE2 64A 12 pDZ-impE2 64V 13 pDZ-impE2 64I 14 pDZ-impE2 64L 15 pDZ-impE2 64M 16 pDZ-impE2 64F 17 pDZ-impE2 64Y 18 pDZ-impE2 64W

Example 5-2

Preparation of Strains where Amino Acids at Positions of Modified Products (ImpE1, ImpE2) are Substituted with Another Amino Acids, and Comparison of Ability to Produce IMP

(118) The 54 kinds of plasmids prepared in Example 5-1 were transformed into the CJI0323 strain. The strains in which the vector was inserted into the chromosome by recombination of the homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to a second cross-over. The introduction of the modification in the finally transformed strains was confirmed by performing PCR using the primer pair of SEQ ID NOS: 15 and 16, followed by nucleotide sequencing analysis. The strain names according to the inserted modifications are shown in Table 14 below.

(119) TABLE-US-00014 TABLE 14 No. Strain 1 CJI0323::impE1(E164R) 2 CJI0323::impE1(E164H) 3 CJI0323::impE1(E164D) 4 CJI0323::impE1(E164S) 5 CJI0323::impE1(E164T) 6 CJI0323::impE1(E164N) 7 CJI0323::impE1(E164Q) 8 CJI0323::impE1(E164C) 9 CJI0323::impE1(E164G) 10 CJI0323::impE1(E164P) 11 CJI0323::impE1(E164A) 12 CJI0323::impE1(E164V) 13 CJI0323::impE1(E164I) 14 CJI0323::impE1(E164L) 15 CJI0323::impE1(E164M) 16 CJI0323::impE1(E164F) 17 CJI0323::impE1(E164Y) 18 CJI0323::impE1(E164W) 19 CJI0323::impE2(V2R) 20 CJI0323::impE2(V2H) 21 CJI0323::impE2(V2K) 22 CJI0323::impE2(V2D) 23 CJI0323::impE2(V2E) 24 CJI0323::impE2(V2S) 25 CJI0323::impE2(V2T) 26 CJI0323::impE2(V2N) 27 CJI0323::impE2(V2Q) 28 CJI0323::impE2(V2C) 29 CJI0323::impE2(V2G) 30 CJI0323::impE2(V2P) 31 CJI0323::impE2(V2A) 32 CJI0323::impE2(V2L) 33 CJI0323::impE2(V2M) 34 CJI0323::impE2(V2F) 35 CJI0323::impE2(V2Y) 36 CJI0323::impE2(V2W) 37 CJI0323::impE2(G64R) 38 CJI0323::impE2(G64H) 39 CJI0323:impE2(G64D) 40 CJI0323::impE2(G64K) 41 CJI0323::impE2(G64S) 42 CJI0323::impE2(G64T) 43 CJI0323::impE2(G64N) 44 CJI0323::impE2(G64Q) 45 CJI0323::impE2(G64C) 46 CJI0323::impE2(G64P) 47 CJI0323::impE2(G64A) 48 CJI0323::impE2(G64V) 49 CJI0323::impE2(G64I) 50 CJI0323:impE2(G64L) 51 CJI0323::impE2(G64M) 52 CJI0323::impE2(G64F) 53 CJI0323:impE2(G64Y) 54 CJI0323::impE2(G64W)

(120) The cultivation was performed in the same manner as in Example 1 and the concentration of IMP produced thereof was analyzed (Table 15).

(121) TABLE-US-00015 TABLE 15 Concentration (g/L) of IMP production in strains with combined introduction of impE1, impE2 modifications Strain Average IMP Control CJI0323_impE1E2(WT) 2.32 1 CJI0323::impE1(E164R) 9.42 2 CJI0323::impE1(E164H) 8.47 3 CJI0323::impE1(E164D) 7.37 4 CJI0323::impE1(E164S) 8.56 5 CJI0323::impE1(E164T) 8.85 6 CJI0323::impE1(E164N) 9.13 7 CJI0323::impE1(E164Q) 7.45 8 CJI0323::impE1(E164C) 7.37 9 CJI0323::impE1(E164G) 9.13 10 CJI0323::impE1(E164P) 9.43 11 CJI0323::impE1(E164A) 7.44 12 CJI0323::impE1(E164V) 8.18 13 CJI0323::impE1(E164I) 8.09 14 CJI0323::impE1(E164L) 7.85 15 CJI0323::impE1(E164M) 7.39 16 CJI0323::impE1(E164F) 7.56 17 CJI0323::impE1(E164Y) 7.60 18 CJI0323::impE1(E164W) 8.56 19 CJI0323::impE2(V2R) 7.99 20 CJI0323::impE2(V2H) 8.75 21 CJI0323::impE2(V2K) 8.66 22 CJI0323::impE2(V2D) 8.28 23 CJI0323::impE2(V2E) 9.32 24 CJI0323::impE2(V2S) 6.37 25 CJI0323::impE2(V2T) 8.37 26 CJI0323::impE2(V2N) 9.80 27 CJI0323::impE2(V2Q) 7.04 28 CJI0323::impE2(V2C) 7.23 29 CJI0323::impE2(V2G) 7.71 30 CJI0323::impE2(V2P) 7.80 31 CJI0323::impE2(V2A) 6.57 32 CJI0323::impE2(V2L) 6.42 33 CJI0323::impE2(V2M) 9.20 34 CJI0323::impE2(V2F) 9.43 35 CJI0323::impE2(V2Y) 8.37 36 CJI0323::impE2(V2W) 7.22 37 CJI0323::impE2(G64R) 4.42 38 CJI0323::impE2(G64H) 5.14 39 CJI0323::impE2(G64D) 11.53 40 CJI0323::impE2(G64K) 4.8 41 CJI0323::impE2(G64S) 5.7 42 CJI0323::impE2(G64T) 5.52 43 CJI0323::impE2(G64N) 5.9 44 CJI0323::impE2(G64Q) 4.8 45 CJI0323::impE2(G64C) 5.9 46 CJI0323::impE2(G64P) 4.75 47 CJI0323::impE2(G64A) 4.58 48 CJI0323::impE2(G64V) 4.56 49 CJI0323::impE2(G64I) 5.89 50 CJI0323::impE2(G64L) 5.6 51 CJI0323::impE2(G64M) 4.3 52 CJI0323::impE2(G64F) 5.89 53 CJI0323::impE2(G64Y) 4.6 54 CJI0323::impE2(G64W) 4.76

(122) As shown above, all of the modified strains showed an increase in the ability to produce IMP compared to each of the control strains, and thus, it was confirmed that the three positions of modification are important sites that have a significant effect on the increase of the ability of the ImpE protein with respect to IMP export.

Example 6

Introduction of impE1, impE2 Modifications Based on Imp-Producing Strains

Example 6-1

Preparation of Strains with impE1, impE2 Modifications Based on Imp-Producing Strains

(123) To confirm the effect of introduction of impE1 and impE2 modifications, An IMP-producing strain was prepared in which the activities of adenylosuccinate synthetase and IMP dehydrogenase corresponding to the degradation pathway of IMP in the ATCC6872 strain were attenuated. The initiation codon was changed by changing the first base from a to t in each nucleotide sequence of the two genes purA and guaB, which encode the two enzymes. The strain in which the expression of the two genes was attenuated in the ATCC6872 strain was named CJI9088. The pDZ-impE1(E164K), pDZ-impE2(V21), and pDZ-impE2(G64E) vectors prepared in Example 4-2 were transformed into the CJI9088 strain by electroporation, and the pDZ-impE2(G64D) vector prepared in Example 5-1 was transformed into the CJI9088_impE1(E164K)_impE2(V21) strain by electroporation. The strains in which the vectors were inserted into the chromosome by recombination of the homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to a second cross-over. The introduction of the modification in the finally transformed strains was confirmed by performing PCR using the primer pair of SEQ ID NOS: 15 and 16, followed by nucleotide sequencing analysis.

(124) The ability of the prepared strains (i.e., CJI9088, CJI9088_impE1(E164K), CJI9088_impE2(V21), CJI9088_impE2(G64E), and CJI9088_impE1(E164K)_impE2(V21)(G64D)) to produce IMP was evaluated. Upon completion of the culture, the amount of IMP production was measured by HPLC and the results are shown in Table 16 below.

(125) TABLE-US-00016 TABLE 16 Strain IMP (g/L) CJI9088 0.52 CJI9088_impE1(E164K) 0.84 CJI9088_impE2(V2I) 0.93 CJI9088_impE2(G64E) 1.73 CJI9088_impE1(E164K)_impE2(V2I)(G64D) 4.30

(126) Upon confirming the amount of IMP accumulated in the culture medium, it was confirmed that these strains showed an increase of IMP production by at least 61%, and a maximum increase of 727%, compared to the parent strain, CJ9088. Accordingly, the increase in the amount of IMP production due to modifications of the ImpE protein of the present disclosure can be interpreted to be very meaningful.

(127) From the foregoing, a skilled person in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.

(128) The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.

(129) These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.