Nitrilase mutant and application thereof in the synthesis of an anti-epileptic drug intermediate

11987826 ยท 2024-05-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a nitrilase mutant protein with increased thermal stability and its application in the synthesis of an anti-epileptic drug intermediate, wherein the mutant is obtained by mutating one or two of the amino acids at position 151, 223 and 250 of the amino acid sequence shown in SEQ ID No. 2. the thermal stability of the nitrilase mutant AcN-T151V/C223A/C250G was increased by up to 1.73 folds. The yield of the final product was up to 95% using the recombinant Escherichia coli containing the nitrilase mutant to hydrolyze 1M 1-cyanocyclohexylacetonitrile to produce 1-cyanocyclohexyl acetic acid at 35? C. And the yield of the final product was up to 97% when hydrolyzing 1.2M 1-cyanocyclohexylacetonitrile at 35? C. The final yield was up to 80% when using the nitrilase mutants obtained by the present invention to synthesize gabapentin.

Claims

1. A nitrilase mutant, wherein the nitrilase mutant has nitrilase activity and comprises the amino acid sequence of SEQ ID NO: 2, except for the substitution T151V, the substitution C223A, or the substitutions T151V, C223A, and C250G.

2. A polynucleotide comprising a nucleotide sequence encoding the nitrilase mutant of claim 1.

3. A method for producing 1-cyanocyclohexyl acetic acid, the method comprising: reacting a catalyst and a substrate in a reaction medium to produce a reaction solution comprising 1-cyanocyclohexyl acetic acid, wherein the catalyst is wet cells comprising the nitrilase mutant of claim 1, wherein the wet wells are obtained by fermentation culture of a genetically engineered strain expressing the nitrilase mutant, immobilized cells comprising the nitrilase mutant, or the nitrilase mutant, wherein the nitrilase mutant is purified, wherein the purified nitrilase mutant is obtained by subjecting the wet cells to ultrasonic breaking and centrifugation, wherein the substrate is 1-cyanocyclohexylacetonitrile, wherein the reaction medium is a pH 7.0, 200 mM disodium hydrogen phosphate-sodium dihydrogen phosphate buffer, wherein the reaction is carried out in a constant temperature water bath at 25-50? C., and wherein after the reaction is completed, the reaction solution is subjected to separation and purification to obtain 1-cyanocyclohexyl acetic acid.

4. The method of claim 3, wherein the final concentration of the substrate in the reaction medium is 100-1200 mM, wherein the catalyst is wet cells and the concentration of wet cells in the reaction medium is 10-100 g/L.

5. The method of claim 3, wherein the reaction temperature is 35? C.

6. The method of claim 3, wherein the wet cells are prepared according to the following method: culturing LB medium with the genetically engineered strain expressing the nitrilase mutant at 37? C. for 10-12 hours to produce an inoculum, inoculating LB medium with the inoculum with a 2% incubating volume, wherein the LB medium contains 50 mg/L kanamycin, and culturing at 37? C., inducing expression of the nitrilase mutant by adding isopropyl-p-D-thiogalactopyranoside to a final concentration of 0.1 mM when the OD.sub.600 of the culture medium reaches 0.6-0.8 and culturing at 28? C. for 10 hours, harvesting cells by centrifugation, and washing the cells with normal saline twice thereby obtaining the wet cells.

7. The method of claim 6, wherein the purified nitrilase is prepared according to the following method: resuspending the wet cells with a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing 300 mM NaCl, ultrasonically breaking the resuspended wet cells under the conditions of 400 W, 25 min, 1 s breaking and 1 s pause, centrifuging the broken cells at 12000 rpm for 10 min to obtain a supernatant, wherein the supernatant is a crude enzyme solution, applying the crude enzyme solution to a Ni-NTA column that has been washed with an equilibrium buffer, wherein the crude enzyme solution is applied to the Ni-NTA column at a flow rate of 1 mL/min, and wherein the equilibrium buffer is a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing 300 mM NaCl, applying a first elution buffer to the Ni-NTA column with the applied crude enzyme solution at a flow rate of 2 mL/min to elute weakly adsorbed protein impurities, wherein the first elution buffer is a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing 300 mM NaCl and 50 mM imidazole, applying a second elution buffer to the Ni-NTA column with the applied first elution buffer at a flow rate of 2 mL/min to elute and collect the nitrilase mutant, wherein the second elution buffer is a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing 300 mM NaCl and 250 mM imidazole, and dialyzing the collected nitrilase mutant with a 50 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer.

8. The method of claim 6, wherein the immobilized cells are prepared according to the following method: resuspending the wet cells with a pH 7.0, 200 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer to form a cell suspension, adding diatomite into the cell suspension to a final concentration of 6 mg/mL and stirring at room temperature for 1 hour to form a cell suspension comprising diatomite, adding a 5% polyethyleneimine aqueous solution with a mass concentration of 5% to the cell suspension comprising diatomite and stirring at room temperature for 1 hour to form a cell suspension comprising diatomite and polyethyleneimine, wherein the volume of the polyethyleneimine aqueous solution is 3% of the volume of the cell suspension comprising diatomite and polyethyleneimine, adding a glutaraldehyde aqueous solution with a mass concentration of 25% to the cell suspension comprising diatomite and polyethyleneimine and stirring for 0.5 hour to form an immobilization reaction solution, wherein the volume of the glutaraldehyde aqueous solution is 1% of the volume of the immobilization reaction solution, and subjecting the immobilization reaction solution to vacuum filtration to thereby obtain the immobilized cells.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: an SDS-PAGE of the purified nitrilase proteins, wherein lane 1 is AcN-M, lane 2 is AcN-T151V, lane 3 is AcN-C223A, lane 4 is AcN-C250G, and lane 5 is AcN-T151V/C223A/C250G.

(2) FIG. 2: activity comparison of the nitrilase mutants.

(3) FIG. 3: thermal stability of the nitrilase mutants at 50? C.

(4) FIG. 4: activity comparison of recombinant E. coli resting cells containing the nitrilase mutants.

(5) FIG. 5: thermal stability of recombinant E. coli resting cells containing the nitrilase mutants at 50? C.

(6) FIG. 6: comparison of hydrolysis of 1M 1-cyanocycloalkaneacetonitrile by recombinant E. coli resting cells containing the nitrilase mutants.

(7) FIG. 7: comparison of hydrolysis of 1.2 M 1-cyanocycloalkaneacetonitrile by recombinant E. coli resting cells containing the nitrilase mutants.

(8) FIG. 8: high performance liquid chromatogram of 1-cyanocyclohexyl acetic acid

SPECIFIC EMBODIMENTS

(9) The present invention is further illustrated below with specific examples, but the scope of the present invention is not limited thereto:

(10) The components of LB liquid medium and the final concentrations thereof are as follows: 10 g/L tryptone, 5 g/L yeast extract, 10 g/L sodium chloride, water as solvent, natural pH.

(11) The components of LB solid medium and the final concentrations thereof are as follows: 10 g/L tryptone, 5 g/L yeast extract, 10 g/L sodium chloride, 15 g/L agar, water as solvent, natural pH.

Example 1: Semi-Rational Design and Site-Directed Mutation

(12) The plasmid pET-28b(+)-AcN-M containing the nitrilase gene AcN-M (the nucleotide sequence is shown in SEQ ID No: 1, and the amino acid sequence is shown in SEQ ID No: 2) derived from A. facilis CCTCC NO:M 029044 was used as a template, the sites can improve the thermal stability, and site-directed mutation (table 1) was carried out by whole-plasmid PCR amplification. The PCR system (50 ?L) was as follows: 0.5-20 ng of the template, 2?Phanta max Buffer 25 ?L, 0.2 ?M of each primer, Phanta Max Super-Fidelity DNA Polymerase 1 ?L, water up to 50 ?L. The PCR program was as follows: (1) pre-denaturation at 95? C. for 3 min; (2) denaturation at 95? C. for 15 s; (3) anneal at 60? C. for 15 s; (4) extension at 72? C. for 5.5 min, wherein steps (2)?(4) were cycled 30 times; and (5) finally, extension at 72? C. for 10 min, preservation at 16? C. The PCR product was identified by agarose gel electrophoresis, digested with DpnI, and then introduced into the host strain E. coli BL21 (DE3) which was then plated on a LB plate containing 50 ng/mL kanamycin to obtain monoclones. The monoclones were subjected to sequencing, and according to the results, a further verification was carried out by reaction.

(13) TABLE-US-00001 TABLE1 thedesignoftheprimers Name ofthe primers sequencesoftheprimers(5to3) R111L-F AGGCAGCCTGTACCTGTCCCAGGTCTTTATCGA R111L-R GACAGGTACAGGCTGCCTGCCTCACGCTCGCTGTAA T151V-F CGGTACCGACTTTCTGGTGCATGACTTCGCATTTG T151V-R CAAATGCGAAGTCATGCACCAGAAAGTCGGTACCG Q169P-F GAACTGCTGGGAGCACGTTCCGCCGCTGTCCAAATTCATG Q169P-R CATGAATTTGGACAGCGGCGGAACGTGCTCCCAGCAGTTC C223A-F CCAAACCTTCGTTCTGGCGTCTACGCAGGTTATCG C223V-R CGATAACCTGCGTAGACGCCAGAACGAAGGTTTGG C250G-F CTGCCGCAGGGTGGCGGTTGGGCGC C250G-R GCGCCCAACCGCCACCCTGCGGCAG D280P-F GTATTCTGTACGCAGAAATCCCGCTGGAACAGATTCTGCTGG D280P-R CCAGCAGAATCTGTTCCAGCGGGATTTCTGCGTACAGAATAC L281P-F CGCAGAAATCGATCCGGAACAGATTCTGC L281P-R GCAGAATCTGTTCCGGATCGATTTCTGCG

(14) T151V, C223A and C250G, the mutants with increased thermal stability were screened out with liquid chromatography whose nucleotide sequences are shown in SEQ ID No: 3, SEQ ID No: 5 and SEQ ID No: 7, respectively. And with the same method, the combinatorial mutant T151V/C223A/C250G was constructed, and the nucleotide sequence is shown in SEQ ID No: 9.

(15) The above mutants and the original vector were respectively transformed into E. coli BL21(DE3) to construct the single mutants E. coli BL21(DE3)/pET28b(+)-AcN-T151V, E. coli BL21(DE3)/pET28b(+)-AcN-C223A and E. coli BL21(DE3)/pET28b(+)-AcN-C250G, the combinatorial mutant E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G and the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M.

Example 2: Expression of the Nitrilase Mutant

(16) The single mutants E. coli BL21(DE3)/pET28b(+)-AcN-T151V, E. coli BL21(DE3)/pET28b(+)-AcN-C223A and E. coli BL21(DE3)/pET28b(+)-AcN-C250G, the combinatorial mutant E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G and the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M obtained in Example 1 were respectively inoculated to LB medium and cultured at 37? C. for 10-12h, the resulting inocula were respectively inoculated to LB medium containing kanamycin (with the final concentration of 50 mg/L) with 2% incubating volume, amplified and cultured at 37? C. When OD600 of the culture medium reached 0.6-0.8, isopropyl-?-D-thiogalactopyranoside (IPTG) was added with the final concentration of 0.1 mM to carry out induced expression at 28? C. for 10 hours. The wet cells were harvested by centrifugation and washed with normal saline twice.

Example 3: Purification of the Nitrilase Mutants

(17) (1) Binding buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) was added to the wet cells obtained in example 2, the cells were resuspended, ultrasonic broken (400 W, 25 min, 1 s breaking, 1 s pause) and centrifuged (12000?g, 10 min). The supernatant was a crude enzyme solution for separation and purification. (2) After pre-filling a 20 mL Ni-NTA affinity column, an equilibrium buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) was used to equilibrate the column at a flow rate of 2 mL/min. (3) After the Ni-NTA column was washed with 8-10 column volume, the obtained crude enzyme solution was applied onto the Ni-NTA column at a flow rate of 1 mL/min, and the target protein bound to the column. After loading, a large amount of unbound protein impurities which did not bind to the resin would be directly removed. (4) An equilibrium buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 50 mM imidazole, pH 8.0) was used to elute the weakly adsorbed protein impurities at a flow rate of 2 mL/min. (5) A protein elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 250 mM imidazole, pH 8.0) was used to elute and collect the target protein at a flow rate of 2 mL/min. (6) The collected enzyme solution was dialyzed with a dialysis bag (Economical Biotech Membrane, 14KD, purchased from Sangon Biotech (Shanghai) Co., Ltd.) with a sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (50 mM, pH 7.0) as the dialysate, and the resulting retention was obtained which contained the purified nitrilase solution. (7) The purified proteins were analyzed by SDS-PAGE, and the results of protein electrophoresis are shown in FIG. 1.

Example 4 Activity Determination of the Nitrilases

(18) The activity of the purified nitrilases from example 3 was determined. A reaction system (10 mL) for nitrilase activity assay was as follows: a sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 200 mM 1-cyanocyclohexylacetonitrile, and 0.4 mg of the purified nitrilase solution. The reaction solution was preheated at 35? C. for 10 min and then reacted at 180 rpm for 10 min. 200 ?L of the supernatant was sampled, and 4 ?L of 6M HCl was added to terminate the reaction, the conversion rate of 1-cyanocyclohexyl acetic acid was determined by liquid chromatography (Shimadzu LC-16) external standard method, and the high performance liquid chromatogram of the 1-cyanocyclohexyl acetic acid is shown in FIG. 8.

(19) The column was J&KCHEMICA?C-18 column (250 mm?4.6 mm, 5 ?m), and the mobile phase was a buffer (0.58 g/L diammonium phosphate, 1.83 g/L sodium perchlorate, pH was adjusted to 1.8 by perchloric acid, the solvent was deionized water and acetonitrile in a ratio of 76:24 (v/v), the flow rate was 1 mL/min, the ultraviolet detection wavelength was 215 nm, and the column temperature was 40? C.

(20) Enzyme activity definition (U): the amount of enzyme required to catalyze the formation of 1 ?mol of 1-cyanocyclohexyl acetic acid per minute at 35? C., in a pH 7.0, 100 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer was defined as 1 U. The relative activity of the mutants, AcN-T151V and AcN-C223A was 1.17 and 1.31 times that of the original nitrilase AcN-M, and the initial activity of the mutant AcN-C250G and the combinatorial mutant AcN-T151V/C223A/C250G was only 90.38% and 84.71% that of the original nitrilase AcN-M, the results are shown in FIG. 2.

Example 5: Determination of Thermal Stability of the Nitrilase Mutant at 50? C.

(21) The thermal stability of the purified nitrilases from example 3 was measured. A certain amount of the purified nitrilases was taken into a 50 mL sterile polypropylene centrifuge tube and stored in a constant temperature water bath at 50? C. The proteins were sampled for measurement of activity of the protein at different time intervals according to the method as described in example 4. With the activity of the protein before the storing as a control, residual activities (referred to as RA) of the proteins at every time interval were calculated. With time (h) as the abscissa and the natural logarithm of the relative residual activity (Ln(RA)) as the ordinate, linear fitting was performed (the results are shown in FIG. 3), and the slope k was obtained. According to the formula of one-step inactivation model

(22) t 1 2 = Ln 2 k ,
the half-life of the enzyme protein

(23) t 1 2
can be obtained.

(24) The half-life of the original nitrilase AcN-M was determined to be 13.6 h, the half-life of the mutant AcN-T151V was 14 h, the half-life of the mutant AcN-C223A was 14.2 h, the half-life of the mutant AcN-C250G was 19.9 h, the half-life of the combinatorial mutant T151V/C223A/C250G was 23.6 h, and the results are shown in FIG. 2.

(25) TABLE-US-00002 TABLE 2 the half-life of the nitrilase mutants at 50? C. nitrilase thermal stability at 50? C. (h) AcN-M 13.6 ? 1.5 AcN-T151V 14 ? 2 AcN-C223A 14.2 ? 2 AcN-C250G 19.9 ? 2 AcN-T151V/C223A/C250G 23.6 ? 2

Example 6: Activity Determination of the Recombinant E. coli Containing the Nitrilase

(26) The recombinant E. coli BL21(DE3)/pET28b(+)-AcN-T151V, E. coli BL21(DE3)/pET28b(+)-AcN-C223A and E. coli BL21(DE3)/pET28b(+)-AcN-C250G, the combinatorial mutant E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G and the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M obtained by cultivation in example 2 were subjected to activity determination. A reaction system (10 mL) for nitrilase activity assay was as follows: a sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 200 mM 1-cyanocyclohexylacetonitrile, and 10 g/L the wet cells of the recombinant E. coli. The reaction solution was preheated at 35? C. for 10 min and then reacted at 180 rpm for 10 min. 200 ?L of the supernatant was sampled, the conversion rate of 1-cyanocyclohexyl acetic acid was determined by liquid chromatography (Shimadzu LC-16) external standard method under the same conditions in example 4. The relative activity of E. coli BL21(DE3)/pET28b(+)-AcN-T151V. E. coli BL21(DE3)/pET28b(+)-AcN-C223A and E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G, the recombinant E. coli strains containing the corresponding nitrilase mutant, was 1.02, 1.32 and 1.54 times that of the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M, however, the initial activity of E. coli BL21(DE3)/pET28b(+)-AcN-C250G was only 86.9% that of the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M, the results are shown in FIG. 4.

Example 7: Determination of Thermal Stability of the Recombinant E. coli Containing the Nitrilase Mutants at 50? C.

(27) The resting cells of the recombinant E. coli containing the nitrilase mutants, E. coli BL2 (DE3)/pET28b(+)-AcN-T151V, E. coli BL21(DE3)/pET28b(+)-AcN-C223A and E. coli BL21(DE3)/pET28b(+)-AcN-C250G, the combinatorial mutant E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G and the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M, obtained in example 2, were respectively suspended in sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0) to obtain a 100 g/L bacterial suspension, and stored in a constant temperature water bath at 50? C. The bacterial suspension was sampled for measurement of activity of the resting cells at different time intervals according to the method as described in example 6. With the activity of the resting cells before stored in a constant temperature water bath at 50? C. as a control, residual activities of the resting cells at each time interval were calculated, and the results were shown in FIG. 5.

Example 9: Hydrolysis of 1M 1-cyanocycloalkaneacetonitrile by the Recombinant E. coli Containing the Nitrilase Mutant

(28) 0.5 g of wet cells of E. coli the combinatorial mutant E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G and the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M, obtained by the method as described in example 2, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0) respectively, 1.48 g of 1-cyanocyclohexylacetonitrile was added with the final concentration of 1M, and the reaction was carried out in a constant temperature water bath at 35? C. The reaction solution was sampled at different time intervals, centrifuged at 12000 rpm, and the precipitates were discarded. The supernatant was analyzed for the concentration of the product by high performance liquid chromatography. The HPLC conditions were as described in example 4.

(29) As shown in FIG. 6, the mutant, E. coli BL21(DE3)/pET28b(+)-AcN-AcN-T151V/C223A/C250G could completely hydrolyze the substrate within 2 h, which was much faster than E. coli BL21(DE3)/pET28b(+)-AcN-M.

Example 10: Hydrolysis of 1.2 M 1-cyanocycloalkaneacetonitrile by the Recombinant E. coli Containing the Nitrilase Mutant

(30) 0.5 g of wet cells of the combinatorial mutant E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G and the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M, obtained by the method as described in example 2, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0) respectively, 1.78 of 1-cyanocyclohexylacetonitrile was added with the final concentration of 1.2M, and the reaction was carried out in a constant temperature water bath at 35? C. The reaction solution was sampled at different time intervals, centrifuged at 12000 rpm, and the precipitates were discarded. The supernatant was analyzed for the concentration of the product by high performance liquid chromatography. The HPLC conditions were as described in example 4.

(31) As shown in Table 3, the mutant, E. coli BL21(DE3)/pET28b(+)-AcN-AcN-T151V/C223A/C250G could completely hydrolyze the substrate within 4 h, which was much faster than E. coli BL21(DE3)/pET28b(+)-AcN-M. The results are shown in FIG. 7.

(32) TABLE-US-00003 TABLE 3 hydrolysis of 1.2 M 1-cyanocycloalkaneacetonitrile by the recombinant E. coli containing the nitrilase mutant reaction temperature reaction yield strains ( ? C ) time (h) (%) E. coli BL21(DE3)/pET28b(+)-AcN-M 35 4 95 E. coli BL21(DE3)/pET28b(+)- 35 4 99 AcN-T151V/C223A/C250G

Example 11: Hydrolysis of 1 M 1-cyanocycloalkaneacetonitrile by the Immobilized Cells

(33) 2 g of the wet cells of the combinatorial mutant E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G and the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M, obtained by the method as described in example 2, were suspended in 20 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), diatomite was added into the suspension with the final concentration of 0.006 g/mL, and the mixture was stirred at room temperature for 1 h. Subsequently, a 5% (w/w) polyethyleneimine aqueous solution was added into the mixture, and stirred at room temperature for 1 hour. Finally, a 25% (w/w) glutaraldehyde aqueous solution was added and the mixture was stirred for 0.5 hour, and the immobilized cells were obtained by vacuum filtration. Wherein, the volume of the polyethyleneimine aqueous solution was 3% of the volume of the buffer, and the volume of the glutaraldehyde aqueous solution was 1% of the volume of the buffer.

(34) Immobilized cells prepared from 0.5 g of the wet cells were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 1.48 g of 1-cyanocyclohexylacetonitrile was added (with the final concentration of 1 M) and the reaction was carried out in a constant temperature water bath at 25? C. Wherein, the immobilized cells prepared from the original strain E. coli BL21(DE3)/pET28b(+)-AcN-M was subjected to the reaction for 7-8 hours per batch, the immobilized cells prepared from E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G was subjected to the reaction for 4-6 hours per batch. After the completion of each batch of the reaction, vacuum filtration was carried out for the solid-liquid separation, and the resulting reaction solution was analyzed by high performance liquid chromatography for profiling the concentration of the product according to the method described in example 4, and the immobilized cells were taken out and applied into the next batch of reaction. The results were shown in Table 4.

(35) TABLE-US-00004 TABLE 4 hydrolysis of 1 M 1-cyanocycloalkaneacetonitrile by the immobilized cells reaction conversion number time per rate of Strains batch (h) (%) batches E. coli BL21(DE3)/pET28b(+)- 7-8 >99 5 AcN-M E. coli BL21(DE3)/pET28b(+)- 4-6 >99 7 AcN-T151V/C223A/C250G

Example 12: Treatment of 1-Cyanocyclohexyl Acetic Acid by Flocculence Method

(36) 1.245 kg of the reaction solution from example 11 was added with 1% polyaluminum chloride to flocculate for 4 h and 1% diatomite to adsorb for 2 h, the mixture was filtrated with Buchner funnel to obtain the filtrate, the filtrate was added with a certain amount of hydrochloric acid to adjust the pH to about 2.0 and an equal volume of dichloromethane, and stirred in a three-necked flask for 20 minutes, then the reaction solution was transferred to a separatory funnel, and allowed to stand for about 10 minutes for separation, the lower layer was taken out, spin steamed and dried in an oven, thereby obtaining 158 g of solid 1-cyanocyclohexyl acetic acid.

Example 13: Synthesis of Gabapentin from 1-Cyanocyclohexyl Acetic Acid by Chemical Method

(37) 78.3 g of the 1-cyanocyclohexyl acetic acid from example 12 was dissolved in water and added with sodium hydroxide solution to adjust the pH to about 10, the concentration to 1M and the volume to 470 mL. The resulting solution was added with 20% Raney nickel catalyst, reacted under the conditions of 110? C., 2.0 MPa, 450 rpm and hydrogenation for about 4-5 h, and filtered while hot to obtain 582.5 g of hydrogenation conversion liquid. The hydrogenation conversion liquid was put in a three-necked flask, added with hydrochloric acid to adjust the pH to about neutral, and heat reflux reacted at 100? C. for about 4 h. The resulting solution was extracted with dichloromethane, rotary steamed and dried, thereby obtaining 56.3 g of solid gabapentin-lactam. The yield of this step was about 81%.

(38) 15.3 g g of the gabapentin-lactam was dissolved in 50 ml of HCl solution, heat reflux reacted at 150 rpm for about 4 h, and naturally cooled to room temperature. The unreacted gabapentin-lactam was extracted with dichloromethane, the water phase was cooled at 0-4? C. for 1 hour, then filtered to obtain white crystals, and dried at 40? C. to obtain gabapentin hydrochloride. The mother liquor was recycled and reused. 36.4 g of the gabapentin was dissolved in 50 ml water at 40? C., then 12.5 ml toluene was added, and the pH was adjusted to 7.0-7.5 with 200 g/L sodium carbonate, stirred for 30 min, then recrystallized with methanol or isopropanol to obtain pure gabapentin. The mother liquor was recycled again for the next crystallization and purification, and the final yield of gabapentin reached 80%.