NANOCAGED ENZYMES WITH ENHANCED CATALYTIC ACTIVITY AND INCREASED STABILITY
20240158776 ยท 2024-05-16
Inventors
Cpc classification
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
C12N15/11
CHEMISTRY; METALLURGY
C12N11/04
CHEMISTRY; METALLURGY
International classification
C12N11/04
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present disclosure describes a nanoparticle comprising a three dimensional DNA nanocage and a payload biological macromolecule, and methods of assembly thereof.
Claims
1-19. (canceled)
20. A method of increasing the activity of an enzyme or antibody, the method comprising: trapping an enzyme or antibody in a first open half cage comprising M13 viral DNA; presenting a second open half cage which does not comprise an enzyme or antibody; assembling the first and second open half cages into a closed nanocage having an inner cavity and nanopores; wherein the inner cavity comprises the enzyme or antibody as a trapped enzyme or antibody respectively, and wherein the enzyme or antibody is less than 465 kDa in size.
21. The method of claim 20, wherein the activity is selected from increased catalytic activity, increased potency, or increased resistance to proteolytic digestion.
22. The method of claim 21, wherein the activity is increased resistance to proteolytic digestion by trypsin.
23. The method of claim 21, wherein the increased resistance to proteolytic digestion is more than 95% of the initial activity of the enzyme or antibody after incubation with trypsin for 24 h relative to that of respective free enzyme or antibody.
24. The method of claim 21, wherein the increased catalytic activity is more than six-fold higher for the trapped enzyme or antibody relative to that of the respective free enzyme or antibody.
25. The method of claim 20, wherein the trapped enzyme or antibody has a mean average cross-sectional size which is less than half the longest width of the inner cavity.
26. The method of claim 20, wherein the closed nanocage comprises a plurality of structural members, each of which independently comprises all or a portion of M13 viral DNA, in a three-dimensional lattice, wherein internal surfaces of the plurality of structural members form an inner cavity which is defined by at least three pairs of opposite walls, wherein a first structural member of the plurality of structural members is linked to a second structural member of the plurality of structural members by short bridge DNA strands, wherein the at least three pairs of opposite walls comprises a first pair, a second pair, and a third pair of opposite walls, and wherein each of the first pair of opposite walls comprises a thickness which is different from the other pairs of opposite walls.
27. The method of claim 20, wherein the nanocage comprises: a plurality of structural members comprising a single-stranded circular DNA sequence selected from p7308, p7560, p7704, p8064, p8634, and pEGFP, wherein internal surfaces of the plurality of structural members form an inner cavity which is defined by at least three pairs of opposite walls, wherein architectural arrangement of the structural members in the three dimensional body forms an arrangement selected from the group consisting of a honeycomb lattice, a single-walled square lattice, and a double-walled square lattice, and wherein the at least three pairs of opposite walls comprises a first pair, a second pair, and a third pair of opposite walls, and wherein each of the first pair of opposite walls comprises a thickness which is different from the other pairs of opposite walls.
28. The method of claim 26, wherein the dimensions of the three dimensional body is less than 100 nm?100 nm?100 nm.
29. The method of claim 26, wherein the dimensions of the three dimensional body is less than 75 nm?50 nm?50 nm in size.
30. The method of claim 26, wherein the dimensions of the inner cavity of the three dimensional body is less than 50 nm?50 nm?50 nm.
31. The method of claim 26, wherein the three dimensional body further comprises at least one nanopore.
32. The method of claim 26, wherein the at least one nanopore has a diameter of about 1 nm to about 5 nm.
33. The method of claim 26, wherein the three dimensional body comprises between 0.10 to 0.30 DNA helices per nm.sup.2.
34. The method of claim 26, wherein the three dimensional body comprises between 0.11 to 0.17 DNA helices per nm.sup.2.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0008] The patent or patent application file contains at least one drawing in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0009] The present invention will be better understood and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings, wherein:
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
DETAILED DESCRIPTION
[0077] The present disclosure describes a three dimensional nanocage assembly to encapsulate a biological macromolecule and methods of nanocage assembly. DNA nanostructures have emerged as promising molecular scaffolds to organize biomolecules at the nanoscale based on their programmable, sequence-driven self-assembly. For example, multi-enzyme cascades have been assembled on DNA nanostructures with precise control over the spatial arrangement to enhance catalytic activity by substrate channeling. Conversely, self-assembling DNA nanoboxes and -cages have shown promise in the delivery of macromolecular payloads such as antibodies and enzymes. Tubular DNA nanostructures have also been used to construct efficient enzyme cascade nanoreactors. The present invention is based at least in part on the inventors' development of a simple and robust strategy for encapsulating metabolic enzymes in DNA-templated nanocages, where nanoparticles comprising the nanocaged enzymes are obtained with high assembly yield and controlled packaging stoichiometry.
[0078] Accordingly, in a first aspect, provided herein is a nanoparticle useful for the transport and administration of therapeutic agents, bioactive compounds, biomolecular reagents, biocatalysts, and other molecular compounds of interest, referred to generally herein as payload molecules (e.g., nucleic acids, polypeptides, enzymes, antibodies, or phospholipids). As used herein, the term nanoparticle refers to a structural composition comprising a full closed nanocage and at least one payload biological macromolecule tapped within the inner cavity of the nanocage. As used herein, nanocage may refer to a three dimensional body comprising an inner cavity. The three dimensional body of the nanocage is an assembly of a plurality of structural members. The internal surfaces of the structural members form the edges of the inner cavity. In one embodiment, these structural members are, tubular, rod like or linear, and may be constructed using nucleic acids. In another embodiment, the structural members are assemblies of double stranded DNA. A full closed nanocage may be formed by the assembly of two half cages.
[0079] The nanocage may be assembled using any means known in the art in which a nano-scale structure if formed. Assembly methods include, but are not limited to, DNA origami, or assembly using liposomes, polymersomes, or virus-like particles. For example, nanocages can be assembled by genetic fusion, chemical crosslinking, surface co-immobilization, and encapsulation within polymer vesicles, or virus-like particles. As used herein, DNA origami may refer to an assembly technique that folds a single-stranded DNA template into a 2 or 3 dimensional target structure by annealing it with short staple strands. In one embodiment, the body of the nanocage comprises between 0.10 to 0.30 DNA helices per nm.sup.2. In another embodiment, the body of the nanocage comprises between 0.11 to 0.17 DNA helices per nm.sup.2.
[0080] In one embodiment, the DNA used to assembly the body of the nanocage is M13mp18 single-stranded DNA. M13mp18 DNA is a circular, single-stranded virus DNA of approximately 7249 nucleotides in length and was isolated from M13mp18,a M13 lac phage vector comprising single HindIII, SphI, SbfI, PstI, SalI (AccI/ HincII), XbaI, BamHI, SmaI (XmaI), KpnI (Acc65I), Sad and EcoRI sites within the gene encoding ?-Galactosidase. Generally, M13mp18 DNA is useful as a standard and has been tested as a template in the dideoxy-nucleotide termination method of sequencing DNA. Detailed sequences are available at neb.com/products/n4040-ml3mp18-single-stranded-dna#pd-description on the World Wide Web.
[0081] Other single-stranded circular DNA that can be used to fold a DNA nanocage include, without limitation, p7308, p7560, p7704, p8064, p8634, and pEGFP.
[0082] The nanocage may be formed in any architecture compatible with the chosen method of assembly. In one embodiment, the architecture of the structural members forms a square lattice, wherein the structural members and arranged in columns and rows. In another embodiment, the architecture of the structural members forms a honeycomb lattice (see
[0083] The nanocage may be any size to accommodate the encapsulation of the enzyme or macromolecule of interest. In one embodiment, the dimensions of the nanocage are less than 100 nm?100 nm?100 nm. In another embodiment, the dimensions of the nanocage are less than 75 nm?50 nm?50 nm. In another embodiment, the dimensions of the nanocage are about 40-70 nm?15-40 nm?15-40 nm.
[0084] The inner cavity of the nanocage is a hollow, open space enclosed within the nanocage to contain the macromolecule or enzyme of interest. The inner cavity will have dimensions smaller than those of the nanocage. In one embodiment, the dimensions of the inner cavity are less than 50 nm?50 nm?50 nm. In one embodiment, the dimensions of the inner cavity are less than 30 nm?30 nm?20 nm.
[0085] In some cases, a nanoparticle as provided herein encapsulates a biological macromolecule within the inner cavity of the nanocage. Any biological macromolecule having any purpose or function can be encapsulated as payload within a nanocage thereby forming a nanoparticle. Exemplary biological macromolecules include, without limitation, proteins, enzymes, antibodies, protein complexes, phospholipids, nucleic acids, and combinations thereof. In one embodiment, the biological macromolecule is an enzyme. The design and structure of the nanocage may be changed and adjusted to accommodate a variety of enzymes with any size, shape, morphology or function. In one embodiment the enzyme has a molecular weight between 10-600 kilodaltons (kDa). Preferably, the nanocage accommodates enzymes having a molecular weight equal to or less than about 600 kDa.
[0086] Without being limited to one particular theory or practice, the nanocage structure may be configured for a variety of functions in regards to the encapsulated enzyme or macromolecule. In embodiments in which the macromolecule is an enzyme, the nanocage may be configured such that the catalytic activity of the enzyme may be tested while the enzyme is encapsulated within the nanocage. The nanocage may also be configured such that the catalytic activity of the enzyme is enhanced when encapsulated within the inner cavity. The nanocage may also be configured such that the enzyme is stabilized against protease digestion or proteolytic degradation when encapsulated within the inner cavity.
[0087] The nanocage structure and assembly may be designed and assembled into a nanoparticle to accommodate a variety of macromolecular configurations within the inner cavity. For example, a single nanocage may encapsulate a payload including but not limited to, a single biological macromolecule, a pair of biological macromolecules, a plurality of biological macromolecule, assemblies of biological macromolecules, multi-component complexes of biological macromolecules, or combinations thereof. When the nanoparticle comprises a payload of multiple biological macromolecules, the macromolecules may be the same, or they may be an assembly of two or more different macromolecules.
[0088] A nanocage may comprise one or more nanopores. As used herein, nanopore may refer to a nano-scale passage, pore or opening in the nanocage. The nanopore may be configured to allow the passage of small molecule substrates, solvents, enzyme substrates and products and the like into and out of the nanocage. The nanopores are sized such that the enzyme encapsulated within the nanocage cannot escape. In one embodiment, the nanocage comprises at least one nanopore. In another embodiment, the nanocage comprises 1-200 nanopores. In another embodiment, the nanocage comprises 10-75 nanopores. The size of the nanopores is determined by the interaction, arrangement and architecture of the structural members of the body of the nanocage, such that nanopores may be formed in the gaps between the structural members. In one embodiment, the nanopores are between 1 and 5 nm in diameter. In another embodiment, the nanopores are between 1.5 and 3 nm in diameter.
[0089] In some embodiments, the enzyme may be non-covalently linked to the internal surface of the nanocage. In another embodiment, the enzyme may be covalently connected to the internal surfaces of the nanocage. In one non-limiting, exemplary embodiment, succinimidyl 3-(2-pyridyldithio) propionate (SPDP) chemistry may be used to crosslink a surface lysine residue on the biological macromolecule to a thiol-modified oligonucleotide. Other useful methods include, without limitation, aptamer-protein noncovalent interactions, NTA-hexahistidine interactions, click chemistry, disulfide and maleimide coupling, and SPDP and SMCC (N-Succinimidyl 3-(2-pyridyldithio)-propionate) cross-linking.
[0090] A half-cage of the body of the nanocage may be assembled utilizing DNA origami. DNA structures can be designed with caDNAno and single strand DNA may be used as the scaffold. To form the half-cage, single strand DNA may be mixed with corresponding staple strands and annealed. Excess staple strands may be removed by filtration.
[0091] An enzyme molecule may be attached to the open half-cage by any appropriate covalent or non-covalent chemistry such as, for example, include, without limitation, aptamer-protein noncovalent interactions, NTAhexahistidine interactions, click chemistry, disulfide and maleimide coupling, and SPDP and SMCC (N-Succinimidyl 3-(2-pyridyldithio)-propionate) cross-linking.
[0092] In some cases, two half-cages of the body of the nanocage are assembled by linking together half-cages. Linking may occur by incubating half-cages with DNA linkers. For example, DNA linkers may hybridize with sticky ends extending from the edge of DNA half-cages. Preferably, DNA linkers are complimentary to these sticky ends, and can be varied for different DNA cage sequences.
[0093] The present invention has been described in terms of one or more preferred embodiments, and it should be appreciated that many equivalents, alternatives, variations, and modifications, aside from those expressly stated, are possible and within the scope of the invention.
Example 1
[0094] The embodiment described here demonstrates a simple and robust strategy for the DNA nanocage-templated encapsulation of metabolic enzymes with high assembly yield and controlled packaging stoichiometry. With such an approach in hand, the hypothesis that the recently described, chaperone-like stabilizing impact of polyphosphate on metabolic protein enzymes together with the cryptic RNA binding properties of many enzymes may lead to beneficial effects when enzymes are surrounded by DNA nanocages, is tested.
Methods
[0095] The design and characterization of DNA half-cages and full-cages.
[0096] DNA origami half-cage and structures were designed with caDNAno, each used one M13mp18 ssDNA as the scaffold. Detailed design schemes are shown in
Enzyme-DNA cage assembly.
[0097] A 15-fold molar excess of oligonucleotide-conjugated enzyme was incubated with the DNA half-cage containing capture strands. Protein assembly was performed using an annealing protocol in which the temperature was gradually decreased from 37? C. to 4? C. over 2 h and then held constant at 4? C. using an established procedure. Two Enzyme-attached half cages were then assembled into a full cage by adding DNA linkers as described above. The DNA caged-enzymes were further purified by agarose gel electrophoresis to remove excess free enzymes.
Preparation, purification, and characterization of protein-DNA conjugates.
[0098] Protein-DNA conjugation- as shown in
[0099] TCEP-treated thiolated DNA (/5ThioC6-/-TTTTTCCCTCCCTCC (SEQ ID NO:1393) (P1), or /5ThioC6-D/-TTTTTGGCTGGCTGG (SEQ ID NO:1394) (P2) was incubated with the SPDP-modified enzymes at an enzyme-to-DNA ratio of 1:10 in 50 mM HEPES buffer (pH 7.4) for 1 h in the dark. Excess unreacted oligonucleotide was removed by ultrafiltration using Amicon 30 kD cutoff filters: washing one time with 50 mM HEPES (pH 7.4) containing 1 M NaCl and three times with 50 mM HEPES (pH 7.4). The high salt concentration in the first washing buffer helps remove DNA nonspecifically bound to the surface of the protein due to electrostatic interactions.
[0100] The absorbance values at 260 nm and 280 nm (A260 and A280) were recorded to quantify the enzyme-DNA complex concentrations and the labeling ratios using a Nanodrop spectrophotometer (Thermo Scientific) (
[0101] Dye labeling of DNA-conjugated proteins: The DNA-conjugated proteins were further labeled with spectrally distinct fluorescent dyes, which allow us to use native gel electrophoresis and single-molecule fluorescence to confirm the encapsulation of proteins within DNA nanocages. NHS-ester-modified dyes were reacted with the purified DNA-conjugated proteins from the above steps at a 20:1 ratio in 50 mM HEPES buffer, pH 8.5. Cy3 was directly labeled to the lysine residues on the protein surface. Excess dyes were then removed using 3-kD cutoff Amicon filters. The UV-Vis absorbance spectra of the purified dye-labeled proteins are shown in
[0102] Conjugate proteins to Cy3-labeled DNA: In order to perform the single-molecule enzyme activity assay, selected enzymes (G6pDH and ?-Gal) were conjugated to a Cy3-labeled DNA. First, NHS-ester-modified dyes were reacted with the 3 -amine of oligonucleotides at a 20:1 ratio in 50 mM HEPES buffer, pH 8.5. Excess dyes were then removed using 3-kD cutoff Amicon filters. Dye-modified oligonucleotides were then conjugated to proteins via the 5 -thiol using the SPDP chemistry described above. Fast Protein Liquid Chromatography (FPLC) was used to purify the protein-DNA-Cy3 conjugates for removing excess DNA-Cy3, and characterized with the UV-Vis absorbance spectra.
Enzyme-DNA Cage Assembly, Purification, and Characterization
[0103] The purified DNA half-cage containing capture strands was mixed with one of several enzyme-DNA conjugates at a 1:15 cage:enzyme ratio and annealed from 37? C. to 4? C. over 2 h in 1?TAE-Mg.sup.2+ buffer (containing 12.5 mM Mg(OAc)2). Twenty-four single-stranded DNA linkers were mixed with the two purified half-cages at a 5:1 linker: cage ratio to connect the two half-cages together by incubating at room temperature for 3 h. Agarose gel electrophoresis (2%, 1?TAE-Mg21 was employed to remove excess free enzymes (70V, 2h). The band of the DNA cage containing the enzyme was cut from the gel and extracted using a Freeze 'N Squeeze column (Bio-Rad). The DNA origami concentration was quantified by measuring the absorbance at 260 nm (A260) using an extinction coefficient of 0.109 nM.sup.?1cm.sup.?1.
DNA Sequences of the Designed Nanocages
[0104] Sequences of staple strands in the SH Full-Cage-Left cage are listed in SEQ ID NOs: 1-210.
[0105] Sequences of staple strands in the SH-right cage are listed in SEQ ID NOs:211-420.
[0106] AB-Linker strands are listed in SEQ ID NOs:421-444.
[0107] SH-probe strands are listed in SEQ ID NOs:445-450. The BOLD portions of the sequences are complementary to the ssDNA conjugated to the enzymes, and are located in the Left (SEQ ID NOs:445-447, top) and Right (SEQ ID NOs:448-450, bottom) half-cages.
TABLE-US-00001 34[53] ATGACCATAAATCGCCTGATAAATGGAGGGAGGG 48[53] TGTGTCGAAATCCCTCAGAACCGCGGAGGGAGGG 62[53] CACCCTCAGAGCGCAGCACCGTAAGGAGGGAGGG 51[117] TTTAGGCAGAGGCATTCAACGCCAACATGTAACCAGCCAGCC 61[117] CGAACAAAGTTACCAGAAAGTAAGCAGATAGCCCAGCCAGCC 75[117] GTAAGCGTCATACATGTGAATTTACCGTTCCACCAGCCAGCC
[0108] Sequences of staple strands in the SS-left half-cage are listed in SEQ ID NOs:451-669.
[0109] Sequences of staple strands in the SS-right half-cage are listed in SEQ ID NOs:670-890.
[0110] SS-linker strands are listed in SEQ ID NOs:891-908.
[0111] SS-probes are listed in SEQ ID NOs:909-914. The BOLD portions of the sequences are complementary to the ssDNA conjugated to the enzymes, and are located in the Left (SEQ ID NOs:909-911, top) and Right (SEQ ID NOs:912-914, bottom) half-cages.
TABLE-US-00002 94[44] GATATAAGTATAGTGACACAGACAGCCCTCATGGAGGGAGGG 104[50] CTTTTGATGATGTCAGTGCCTTGGAGGGAGGG 110[44] CATTGACAGGAGGATTTAAGCGTCATACATGGGGAGGGAGGG 87[115] GCAAGCAAATCAGGCTTATTTTGCACCCAGCTCCAGCCAGCC 93[109] ACAATTTTATCCAGAGCCTAATCCAGCCAGCC 103[115] GTAAGCAGATAGCTATAATAGAAAATTCATATCCAGCCAGCC
[0112] DNA sequences for DS Full-Cage design, cross sectional view
[0113] Sequences of staple strands in the DS-left half-cage are listed in SEQ ID NOs:915-1134.
[0114] Sequences of staple strands in the DS-right half-cage are listed in SEQ ID NOs:1135-1362.
[0115] DS-linker strands are listed in SEQ ID NOs:1363-1386.
[0116] DS-probes are listed in SEQ ID NOs:1387-1392. The BOLD portions of the sequences are complementary to the ssDNA conjugated to the enzymes, and are located in the Left (SEQ ID NOs:1387-1389, top) and Right (SEQ ID NOs:1390-1392, bottom) half-cages.
TABLE-US-00003 64[71] ATTCATTTCAATTACCCGCGCAGAGGCGAATTTTTTGGAGGGAGGG 74[76] TCAGATGATGGCAACAATAACTTTTGGAGGGAGGG 76[66] ATTATCATTTTTTATCATCATATTCCTGATTATTTTGGAGGGAGGG 34[149] TTCTGTGCAAAAGAAGGCACCAGGCTGACCGTAATCTTGACAAGAACCGGA TTTTCCAGCCAGCC 67[136] GCAAAAGACGGTGTACAGACCTTTTCCAGCCAGCC 73[131] GCATCAAAAAGATTAAGAGGAACTTCAAATATCGCGTTTTAATTTTCCAGC CAGCC
Single-molecule fluorescence microscopy.
[0117] All single-molecule measurements were performed at room temperature using a total internal reflection fluorescence (TIRF) microscope on PEGylated fused silica microscope slides. To passivate the microscope slides and functionalize the surface with biotin for selective immobilization of nanocages, a biotin- and PEG-coated surface was prepared by silylation with APTES, followed by incubation with a 1:10 mixture of biotin-PEG-SVA 5k:mPEG-SVA 5k as described previously. A flow channel was constructed as described elsewhere. To prepare the surface for enzyme or nanocage binding, a solution of 0.2 mg/mL streptavidin in T50 buffer (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM EDTA) was injected in to the flow channel, incubated for 10 min, and the excess streptavidin was flushed out thoroughly first with T50, then with 1? TAE-Mg2+.
[0118] Yield estimation by TIRF colocalization: All single-molecule measurements were performed at room temperature using a total internal reflection fluorescence (TIRF) microscope on PEGylated fused silica microscope slides. To passivate the microscope slides and functionalize the surface with biotin for selective immobilization of nanocages, a biotin- and PEG-coated surface was prepared by silylation with APTES, followed by incubation with a 1: 10 mixture of biotin-PEG-SVA 5k:mPEG-SVA 5k as described previously.sup.3. A flow channel was constructed as described elsewhere 3 . To prepare the surface for enzyme or nanocage binding, a solution of 0.2 mg/mL streptavidin in TSO buffer (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM EDTA) was injected in to the flow channel, incubated for 10 min, and the excess streptavidin was flushed out thoroughly first with TSO, then with 1?TAE-Mg.
[0119] The right half of the DNA origami cage was labeled with Cy5 dye inside the cavity, via hybridization of Cy5-labeled DNA to complementary handles incorporated into the structure. Each of the ssDNA conjugated enzymes (HRP, GOx, G6pD, LDH, MDH and ?-Gal) was covalently labeled with Cy3 as described in section 3 (Cy3-Enzyme-5-TTTTTCCCTCCCTCC, SEQ ID NO:1393), and then linked to the left half of the DNA origami cage via hybridization with complementary handles. Because Cy3 was directly labeled onto the enzyme surface, any observed Cy3 signal of the immobilized DNA nanocages came from the encapsulated enzymes. Linker strands were added to a 1:1 mixture of the two half-cages to encapsulate the enzymes in a full-cage. To capture DNA-modified enzymes in the absence of nanocage (as control) the microscope slide was incubated with 10-20 nM biotin-modified complementary DNA oligonucleotide (5-biotin-TTTTTGGAGGGAGGG, SEQ ID NO:1395) for 3 min, followed by 10 min incubation with 20-50 pM enzyme sample in 1? TAE-Mg buffer. Excess enzyme was flushed out with 400 uL buffer (channel volume 30 ?L). For the nanocage experiments, the samples were diluted to 20-50 pM in 1? TAE-Mg and immobilized on the streptavidin-coated PEG surface for 1 min, and the excess sample was flushed out with 400 (IL of 1?TAE-Mg. The DNA-modified enzymes were imaged with illumination at 532 nm (15 W/cm2), and the nanocage-encapsulated enzymes were imaged with simultaneous illumination at both 532 nm (15 W/cm2) and 640 nm (40 W/cm2) as described. Particle-finding and colocalization analysis were performed using custom-written scripts in IDL and MATLAB, using a threshold of 150 counts per frame for particle identification (typical particles showed 500-1,000 counts per frame in each detection channel). The enzyme encapsulation yield, defined as the fraction of assembled nanocages containing enzyme(s), was estimated by dividing N.sub.caloc by the total number of particles containing a right half-cage, N.sub.right (Table 3).
[0120] Estimation of enzyme copy number per nanocage: The number of enzyme copies per nanocage (N.sub.enz) was determined by single-molecule photobleaching (SMPB). First, the number of Cy3 photobleaching steps was determined separately for unencapsulated as well as half-cage and full-cage-encapsulated enzymes. For this, the donor channel data of all single molecules were idealized in QuB (http://www.qub.buffalo.edu) using a six-state model. The histogram of the photobleaching steps was then acquired using a custom-written MATLAB script.
[0121] Representative intensity traces exhibiting one, two, and three photobleaching steps are shown in
Single-Molecule Enzymology
[0122] Single-molecule enzyme activity assay: Prior to single-molecule activity measurement, streptavidin-modified slides were incubated for 2 min with neutravidin-coated fluorescent beads (Invitrogen, 0.04 p.m diameter, excitation/emission; 550/605 nm) at 106-fold dilution and the excess flushed out with 1? TBS buffer. These beads (5-8 per field of view) were used as fiducial markers to correct for drift of the microscope stage and/or slide (
[0123] To image enzyme activity, 300 ?L of substrate solution in 1? TBS buffer (pH 7.5, 1 mM Mg.sup.2+, and 10% (w/v) PEG8000) (Table 5) was injected into the flow channel. Movies were recorded for 5 min (9,091 frames) at 35 ms frame exposure time immediately after injecting the substrate solution. In case of G6pDH, the activity was measured in the same field of view under identical laser illumination and microscope settings, with or without glucose-6-phosphate (G6p) (
[0124] Burst analysis: Burst analysis was carried out using a modified Rank Surprise (RS) method6 recently utilized to analyze the binding of fluorescent DNA probes to a riboswitch. Briefly, Interspike Intervals (ISIs) were determined by calculating the time in between individual fluorescent spikes for each molecule (
[0125] Comparing bulk and single-molecule enzyme activity: Unlike our single-molecule assay, the bulk measurement of enzyme activity cannot explicitly determine the fraction of active enzyme molecules present in the solution (it is well known that a fraction of enzyme molecules loses their activity during oligonucleotide conjugation, buffer exchange and the purification process). However, the observed bulk activity is contributed not only by enzyme turnover rate but also by the fraction of enzyme molecules that are still active. Both of these contributing factors need to be accounted for to directly compare the single-molecule enzyme activity with the bulk measurements. Therefore, in the single-molecule experiment, the overall activity of free, half-cage and full-cage enzymes were calculated by multiplying the turnover rate with the fraction of active molecules for the given sample.
Bulk solution enzyme assay.
[0126] A 96-well-plate reader was used to monitor enzyme activity through absorbance changes of the samples. The enzyme samples and substrates were loaded in the wells of the 96-well plate with a final concentration of caged enzymes 0.5 nM in 1? TBS (Tris buffered saline with 1 mM MgC12, pH 7.5) for most assays.
Enzymes and substrates: Glucose-6-phosphate dehydrogenase (G6pDH, Leuconostoc mesenteroides), malic dehydrogenase (MDH, porcine heart), lactate dehydrogenase (LDH, rabbit muscle), glucose oxidase (GOx, Aspergillus niger), horseradish peroxidase (HRP) and ?-galactosidase (?-Gal, E. coli) were purchased from Sigma (St. Louis, MO). Pyruvate, oxaloacetate (OAA), glucose 6-phosphate (G6P), glucose, resorufin ?-D-glucopyranoside (RBG), ?-nicotinamide adenine dinucleotide (NAD), resazurin (RESA) and phenazine methosulfate (PMS) were obtained from Sigma-Aldrich. ABTS (2,2-Azino-bis[3-ethylbenzothiazoline-6-sulfonic acid] diammonium salt) was purchased from Pierce (Rockford, IL), polyphosphate (100) is ordered from Kerafast.
DNA strands:
[0127] Single-stranded MI3mp18 DNA was purchased from New England Biolabs. Staple strand oligonucleotides were obtained from Integrated DNA Technologies (IDT) on 96-well plates and used without further purification. Thiol-modified DNA oligonucleotides were also purchased from IDT, and were purified by denaturing PAGE before use.
Crosslinking reagents:
[0128] N-Succinimidyl 3-(2-pyridyldithio)propionate (SPDP) and tris(2-carboxyethyl)phosphine (TCEP) were obtained from Pierce. Dimethyl sulfoxide (DMSO) was purchased from Sigma.
Buffers:
[0129] Phosphate buffered saline (PBS), HEPES sodium salt, Tris buffered saline (TBS), Tris base, acetic acid, EDTA, and magnesium acetate were purchased from Sigma. 1?TAE/Mg.sup.2+ buffer (pH 8.0) is prepared by 40 mM Tris, 20 mM acetic acid, 2 mM EDTA and 12.5 mM magnesium acetate.
Dye-labeling reagents:
[0130] NHS-Cy3, Cy5 amine reactive dyes were purchased from GE Healthcare Life Sciences. NHS-AlexaFluor?555 and AlexaFluor?647 amine reactive dyes were obtained from Life Technologies.
[0131] Amicon centrifugal filters were purchased from Millipore.
[0132] PEG 8000 was purchased from Promega.
Surface PEGylating reagents:
[0133] APTES (3-Aminopropyl)triethoxysilane was purchased from Sigma-Aldrich. mPEG-SV A 5k and biotin-PEG-SY A 5k were obtained from Laysan Bio, Inc.
TEM imaging:
[0134] TEM grids (400 mesh, copper grid coated with ultrathin carbon, Ted Pella) were glow discharged (Emitech K1 OOX). 2 ?l concentrated samples were deposited onto the grids for 1 min, washed with 10 (11 DI water for 5 sec, stained with 10 (11 1% uranyl formate twice (2 sec for the first time and 15 sec for the second time), and imaged using Philips CMI2 transmission electron microscope.
Enzyme activity assay:
[0135] A 96-well-plate reader was used to monitor enzyme activity through absorbance changes of the samples. The enzyme samples and substrates were loaded in the wells of the 96-well plate with a final concentration of caged enzymes of 0.5 nM in 1?TBS (Tris buffered saline with 1 mM MgCl.sub.2, pH 7.5) for most assays. The DNA cage concentration was determined by the A260 value as described above. For a typical GOx and HRP assay, 1 mM Glucose and 2 mM ABTS was used as substrate and enzyme activity was measured by monitoring the increase in absorbance at 410 nm (ABTs-1). For a typical G6pDH assay, 1 mM G6P and 1 mM NAD+were used as substrates, and enzyme activity was measured by monitoring the increased absorbance at 340 nm due to the reduction of NAD+to NADH. For a typical LDH assay, 2 mM pyruvate and 1 mM NADH were used as substrates, and enzyme activity was measured by monitoring the decreased absorbance at 340 nm due to the oxidation of NADH to NAD+. For a typical MDH assay, 2 mM OAA and 1 mM NADH were used as substrates, and enzyme activity was measured by monitoring the decrease in absorbance at 340 nm. For a typical ?-Gal assay, 100 ?M RBG was used as substrate and enzyme activity was measured by monitoring fluorescence intensity, with excitation at 532 nm and emission at 590 nm.
Trypsin assay:
[0136] Enzyme activity was measured after incubation with or without trypsin (1 ?M) at 37? C. for 24 h in 1? TAE-10 mM Mg buffer (pH 8.0). Activity assay conditions: 1 mM Glucose, 1 mM ABTS, 1 nM of free GOx and HRP in pH 7.5, 1? TBS buffer containing 1 mM MgCl.sub.2, and monitoring absorbance at 410 nm. In the DNA cage experiment, all conditions were the same except for incubating 1 nM DNA cage-encapsulated GOx and HRP with trypsin.
Results
[0137] Enzyme encapsulation strategy.
[0138] As shown in
[0139] The formation of half and full DNA nanocages was first characterized using transmission electron microscopy (TEM) (
[0140] As a demonstration of an enzyme cascade, a glucose oxidase (GOx)-attached half-cage was incubated with a horseradish peroxidase (HRP)-attached halfcage at a stoichiometric ratio of 1:1, followed by the addition of bridge strands into solution to assemble a full DNA nanocage containing a GOx/HRP pair. The inner cavity of a full nanocage is of sufficient size to encapsulate this enzyme pair (GOx is 10 nm32 and HRP 5 nm in diameter33). Unencapsulated enzyme and excess short DNA strands were removed using agarose gel electrophoresis (AGE). Details of the enzyme-DNA conjugation and optimization of the assembly are shown in
Characterization of enzyme encapsulation.
[0141] To verify the presence of both enzymes within a DNA nanocage, the co-localization of a Cy3-labeled GOx (green emission) and a Cy5-labeled HRP (red emission) was quantified by dual-color fluorescence gel electrophoresis where a gel band with overlapped green and red color was identified (
[0142] Activity characterization of nano-caged enzymes.
[0143] To evaluate the effect of DNA nanocages on enzyme activity, an encapsulated GOx/HRP pair was tested (
[0144] To separate the proximity effect from the charge density effect, control experiments of DNA nanocages encapsulating only a single GOx or HRP enzyme are designed, which clearly do not allow for substrate channeling between two proximal enzymes. For example, an equimolar mixture of two separate nanocages encapsulating either a single GOx or a single HRP (Full[GOx]+Full[HRP]) exhibited an 4-fold increase in overall activity compared to the unencapsulated control enzymes. Similarly, an equimolar mixture of two half-cages encapsulating either a single GOx or a single HRP already showed an increase in overall activity by 3-fold. Since there was no proximity effect in the case of two enzymes encapsulated into two different nanocages, the local environment modified by a DNA nanocage appears to be more important for the observed activity enhancement. Similarly, a half-cage was almost as effective in activity enhancement (3-fold) as a full-cage, suggesting that enzyme access to substrate does not play a role in this enhancement. Interestingly, a similar enhancement was reported previously upon conjugation of enzymes to a giant multi-branched DNA scaffold, without further explanation.
[0145] To test the generality of nanocage activity observations, the activity of six different enzymes upon encapsulation within DNA nanocages are evaluated. As shown in Table 1, five of them (GOx, HRP, G6pDH, MDH, and LDH) exhibited higher activity in nanocages than the free enzyme, with enhancements ranging from 3- to 10-fold.
[0146] Detailed kinetic analyses show that the K.sub.M (the Michaelis-Menten constant) varies little between encapsulated and free enzyme for most substrates (ranging from 0.5 to 2.4-fold of the free enzyme), suggesting that the porous DNA cages do not substantially hinder diffusion of small-molecule substrates. In contrast, a large increase in turnover number (k cat) was observed for these five enzymes (ranging from 3.5- to 9.6-fold of the free enzyme), suggesting an inherently higher catalytic activity of the proteins. For all the raw kinetics data, please see
[0147] In contrast to these five enzymes, ?-Gal is strongly inhibited upon encapsulation, possibly due to its large size (16 nm in diameter,
[0148] To gain more detailed mechanistic insight into the enhancement of catalytic turnover, a novel single-molecule fluorescence assay to characterize the activity of individual enzymes with and without encapsulation was applied (
[0149] Compared to a control without substrate, more frequent fluorescent spikes were observed with the addition of glucose-6-phosphate substrate (
[0150] The activity enhancement for DNA cage-encapsulated enzymes is consistent with recent reports of enhanced enzyme activity upon attachment to a long double-stranded DNA molecule (XIDNA), a 2D rectangular DNA origami, or a DNA scaffold that bound to enzyme substrates, and further suggests that it may be a widespread effect of enzyme-DNA interactions. Several mechanisms have been previously proposed to explain these observed enhancements, including micro-environment composed of giant and ordered DNA molecules, molecular crowding and the substrates affinity to DNA scaffolds. We further suggested that the negatively charged phosphate backbones of DNA might also contribute to the activity enhancement. DNA is a negatively charged biopolymer due to its closely spaced backbone phosphates (leading to a linear negative charge density of 0.6 e/A). Thus, upon encapsulation within a DNA nanocage, an enzyme is exposed to an environment full of negative charges that may resemble the relative abundance of polyanionic molecules and surfaces (including RNA and phospholipid membranes) within the cell. Phosphate is a known kosmotropic anion that increases the extent of hydrogen-bonded water structures (termed high-density or structured water). A DNA nanocage is thus expected to attract a strongly bound hydration layer of hydrogen-bonded water molecules inside its cavity. Multiple studies have described that proteins are more stable and active in a highly ordered, hydrogen-bonded water environment, possibly due to stabilization of the hydrophobic interactions of a folded protein through an increase in the solvent entropy penalty upon unfolding.
[0151] Consistent with this model, polyphosphate has been shown to act as a generic chaperone stabilizing a variety of enzymes. To further test whether this mechanism is at work in our nanocages, we titrated the concentration of NaCl (known to consist of chaotropic ions) for the purpose of interrupting hydrogen-bonded water molecules. Consistent with our hypothesis, the activity of encapsulated enzymes significantly decreased with increasing NaCl concentration (reduced to 25% activity with 1 M NaC1 as shown in
[0152] To further test this model, we investigated the effect of DNA helix density on the encapsulated enzyme activity. As shown in
[0153] Nanocaged enzymes are protected from proteolysis. Self-assembled DNA nanostructures previously were found to be more resistant against nuclease degradation than single- or double-stranded DNA molecules. Similarly, DNA nanocages should protect encapsulated enzymes from deactivation and aggregation under challenging biological conditions. As shown in
TABLE-US-00004 TABLE 1 Enzyme kinetic data (values of K.sub.M and k.sub.cat) for each individual enzyme encapsulated inside a DNA full-cage in comparison with the values for the free enzymes in solution. Molecular Free enzyme Encapsulated enzyme Enzyme pI weight Substrate K.sub.M (?M) k.sub.cat (s?1) K.sub.M (?M) k.sub.cat (s?1) GOx 4.2 160 kDa Glucose 6,200 ? 900 240 ? 10 3,000 ? 600 1,300 ? 50.sup. HRP 8.8 44 kDa H.sub.2O.sub.2 2.3 ? 0.5 32 ? 1 4.3 ? 0.6 290 ? 5 ABTS 2,600 ? 400 59 ? 5 2,500 ? 200 560 ? 20 G6pDH 4.3 100 kDa Glucose-6- 220 ? 20 130 ? 3 310 ? 30 460 ? 10 phosphate NAD+ 510 ? 50 100 ? 3 590 ? 40 480 ? 10 MDH 10.0 70 kDa NADH 180 ? 50 51 ? 5 270 ? 50 460 ? 30 LDH 5.0 140 kDa NADH 7.2 ? 1.3 46 ? 2 17.0 ? 1.5 190 ? 5 ?-Gal 4.1 465 kDa RBG 58.7 ? 16.0 8.5 ? 0.6* 95.5 ? 18.9 1.6 ? 0.1* ABTS, 2,2-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid); GOx, glucose oxidase; HRP, horseradish peroxidase; LDH, lactic acid dehydrogenase; MDH, malic dehydrogenase; pI isoelectric point. The pI values of the enzymes were obtained from brenda-enzymes.org *k.sub.cat values for ?-Gal groups were not calibrated
TABLE-US-00005 TABLE 2 Estimation of the concentration and DNA labeling ratio of the purified DNA-conjugated enzymes by measuring absorbance at 260 and 280 nm. Concentration of HRP-P1-Cy3 was estimated by the unique absorbance at 405 nm. ?260 ?260 ?260 ?260 DNA-to- Protein A260/ (M.sup.?1 (M.sup.?1 A260/ (M.sup.?1 (M.sup.?1 A260/ Protein Conc. Dye DNA A280 cm.sup.?1) cm.sup.?1) Protein A280 cm.sup.?1) cm.sup.?1) Sample A280 A260 A280 Ratio (?M) (?M) P1- 1.27 115200 90709 GOx 0.63 168336 267200 GOx-P1- 1.18 13.50 14.10 3.09 25.77 37.00 Cy3 Cy3 P1- 1.27 115200 90709 ?-Gal 0.59 573534.9 972093 ?-Gal-P1- 0.63 1.34 2.11 0.74 2.03 1.10 Cy3 Cy3 P1- 1.27 115200 90709 G6pDH 0.52 61594 118450 G6pDH- 1.00 11.15 11.17 2.30 34.17 53 Cy3 P1-Gy3 P2- 1.60 130100 81313 MDH 0.72 14112 19600 MDH-P2- 1.49 1.47 0.99 1.63 6.49 8 AF647 AF647 P2- 1.60 130100 81313 LDH 0.57 115504.8 202640 LDH-P2- 0.83 2.83 3.41 0.84 12.59 22 AF647 AF647 A.sub.260 (DNA-protein) = ?.sub.260 (protein) * Conc. (protein) + ?.sub.260 (DNA) * Conc. (DNA) A.sub.280 (DNA-protein) = ?.sub.280 (protein) * Conc. (protein) + ?.sub.280 (DNA) * Conc. (DNA)
TABLE-US-00006 TABLE 3 Enzyme encapsulation efficiency calculation. Enzyme encapsulation was calculated by taking the ratio of the number of colocalized molecules (i.e., both enzyme and right half-cage) to the total number of molecules containing the right half-cage. N is the number of particles analyzes, N.sub.coloc is the number of particles containing both fluorophores, and N.sub.right is the number of particles showing evidence of the right half-cage. N N.sub.coloc N.sub.right N.sub.coloc/N.sub.right HRP 176 156 165 0.94 GOx 205 197 201 0.98 G6pDH 218 209 214 0.98 LDH 1229 826 1008 0.82 MDH 363 335 348 0.96 ?-Gal 284 115 179 0.64
TABLE-US-00007 TABLE 4 Calculation of enzyme copies per DNA nanocage. The percentage of molecules exhibiting a given number Cy3 photobleaching steps Cy3 Steps for both the encapsulated and unencapsulated enzymes are provided. The mean number of enzymes per cage (N.sub.enz) was calculated by taking the ratio of ?.sub.Cy3_Encap to ?.sub.Cy3_Unencap. N is the total number of particles analyzed. Cy3 Steps Cy3 Steps (% molecules) (% molecules) N One Two Three ?.sub.Cy3_Encap One Two Three ?.sub.Cy3_Unencap N.sub.enz HRP 176 86 13 1 1.15 92 8 0 1.08 1.0 G6pDH 218 87 10 3 1.16 93 7 0 1.07 1.1 ?-Gal 284 93 6 1 1.08 88 9 3 1.15 0.9
TABLE-US-00008 TABLE 5 Conditions for the single-molecule enzyme activity assay Solution Concentration 10X TBS, pH 7.5 1X Resazurin Glucose-6-phosphate 50 nM (G6p) 1 nM Phenazine Methosulfate (PMS) 12.5 ?M Mg.sup.2+ (MgCl.sub.2) 1 mM NAD.sup.+ 1 mM PEG 8000 10% (w/v)
Discussion
[0154] In summary, we have developed a method for using a DNA nanocage to efficiently encapsulate enzymes with high yield. Using single-molecule characterization, we were able to quantify the copies of encapsulated enzymes per cage with demonstrated one enzyme per cage. Upon encapsulation, five of six tested metabolic enzymes exhibit turnover numbers 4- to 10-fold higher than that of the free enzyme. Conversely, the K.sub.M values remain similar between encapsulated enzymes and free enzymes, indicating an uninterrupted diffusion of small-molecule substrates and products through the nanopores in the DNA cage. Application of a novel single-molecule enzyme assay showed that both the fraction of active enzyme molecules and their individual turnover numbers increase as a consequence of encapsulation.
[0155] It is therefore proposed, without being bound to any particular theory or mechanism of action, that the unique local environment created within a DNA nanocage, particularly the high density of negatively charged phosphate groups, enhances the activity of encapsulated enzymes, where the tightly bound, highly structured water layers on DNA surface may stabilize the active enzyme conformations. This effect appears consistent with recent independent evidence that many conserved metabolic enzymes are stabilized by polyphosphate and associate non-specifically with nucleic acids through cryptic binding sites thus taking advantage of the high polyanionic DNA and RNA contents of the cell. DNA nanocages therefore may serve as a molecular tool to precisely sculpt the properties of the local environment of enzymes in smart-material and biotechnological application. DNA nanocages also demonstrated their value in protecting encapsulated enzymes from biological degradation through proteases.
REFERENCES
[0156] 1. Chen, A. H. & Silver, P. A. Designing biological compartmentalization. Trends. Cell. Biol. 12, 662-670 (2012). [0157] 2. Hurtley, S. Location, Location, Location. Science 326, 1205 (2009). [0158] 3. Kertelf, C. A., Heinhorst, S. & Cannon, G. C. Bacterial microcompartments. Annu. Rev. Microbiol. 64, 391-408 (2010). [0159] 4. Kerfelf, C. A., Sawaya, M. R., Tanaka, S., Nguyen, C. V., Phillips, M., Beeby, M. & Yeates, T. O. Protein structures forming the shell of primitive bacterial organelles. Science 309, 936-938 (2005). [0160] 5. Graff, A., Winterhalter, M. & Meier, W. Nanoreactors from polymer-stabilized liposomes. Langmuir 17, 919-923 (2001). [0161] 6. Hartl, F. U. Molecular chaperones in cellular protein folding Nature 381, 571-580 (1996). [0162] 7. Comellas-Aragones, M. et al. A virus-based single-enzyme nanoreactor. Nature Nanotech. 2, 635-639 (2007). [0163] 8. Liu, Y. et al. Biomimetic enzyme nanocomplexes and their use as antidotes and preventive measures for alcohol intoxication. Nature Nanotech. 8, 187-192 (2013). [0164] 9. Sang, L. & Coppens, M. Effects of surface curvature and surface chemistry on the structure and activity of protein adsorbed in nanopores. Phys. Chem. Chem. Phys. 13, 6689-6698 (2011). [0165] 10. Vriezema, D. M., Aragones, M. C., Elemans, J., Cornelissen, J., Rowan, A. E. & Nolte, R. J. M. Self-assembled nanoreactors. Chem. Rev. 105, 1445-1490 (2005). [0166] 11. Bruns, N. & Tiller, J. C. Amphiphilic network as nanoreactor for enzymes in organic solvents. Nano Lett. 5, 45-48 (2005). [0167] 12. Betancor , L., and Luckarift, H. R. Bioinspired enzyme encapsulation for biocatalysis. Trends. Biotechnol. 26, 566-572 (2008). [0168] 13. Fiedler, J. D., Brown. S. D., Lau. J. & Finn. M. G. RNA-directed packaging of enzymes within virus-like particles. Angew. Chem. Int. Ed. 49, 9648-9651 (2010). [0169] 14. Douglas, S. M., Dietz, H., Liedl, T., Hogberg, B., Graf, F. & Shih, W. M. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature 459, 414-418 (2009). [0170] 15. Han, D., Pal, S., Nangreave, J., Deng, Z., Liu, Y. & Yan, H. DNA origami with complex curvatures in three-dimensional space. Science 332, 342-346 (2011). [0171] 16. Ke, Y., Ong, L. L., Shih, W. M. & Yin, P. Three-dimensional structures self-assembled from DNA bricks. Science, 338, 1177-1183 (2012). [0172] 17. Kuzyk, A. et al. DNA-based self-assembly of chiral plasmonic nanostructures with tailored optical response. Nature 483, 311-314 (2012). [0173] 18. Langecker, M., Arnaut, V., Martin, T., List, J., Renner, S., Mayer, M., Dietz, H., & Simmel, F. Synthetic lipid membrane channels by designed DNA nanostructures. Science 338, 932-936 (2012). [0174] 19. Fu, J., Liu, M., Liu, Y., Woodbury, N. W. & Yan, H. Interenzyme substrate diffusion for an enzyme cascade organized on spatially addressable DNA nanostructure. J. Am. Chem. Soc. 134, 5516-5519 (2012). [0175] 20. Fu, J., Liu, M., Liu, Y. & Yan, H. Spatially-Interactive Biomolecular Networks Organized by Nucleic Acid Nanostructures, Acc. Chem. Res. 45, 1215-1226 (2012). [0176] 21. Wilner, O . I., Weizmann, Y., Gill, R., Lioubashevski, O., Freeman, R. & Willner, I. Enzyme cascades activated on topologically programmed DNA scaffolds. Nature Nanotechnol. 4, 249-254 (2009). [0177] 22. Andersen. E. S. et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature 459, 73-76 (2009). [0178] 23. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science 335, 831-834 (2012). [0179] 24. Juul, S., et al. Temperature-Controlled Encapsulation and Release of an Active Enzyme in the Cavity of a Self-Assembled DNA Nanocage. ACS Nano 7, 9724-9734 (2013). [0180] 25. Fu, Y., et al. Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors. J. Am. Chem. Soc. 135, 696-702 (2013). [0181] 26. Linko, V., Eerikainen, M. & Kostiainen, M. A modular DNA origami-based enzyme cascade nanoreactor. Chem. Commun. 51, 5351-5354 (2015). [0182] 27. Gray M. J., et al. Polyphosphate is a primordial chaperone. Mol. Cell. 53, 689-699 (2014). [0183] 28. Cie?la, J. Metabolic enzymes that bind RNA: yet another level of cellular regulatory network? Acta Biochim Pol. 53, 11-32 (2006). [0184] 29. Bellot, G., McClintock, M. A., Lin, C. X., Shih, W. M. Recovery of intact DNA nanostructures after agarose gel-based separation. Nat. Methods. 8, 192-194 (2011). [0185] 30. Liu, M., Fu, J., Hejesen, C., Yang, Y., Woodbury, N. W., Gothelf, K., Liu, Y., and Yan, H. A DNA Tweezer-Actuated Enzyme Nanoreactors, Nat. Commun. 6, 712-719 (2013). [0186] 31. Fu, J., Yang, Y. R., Johnson-Buck, A., Liu, Y., Walter, N. G., Woodbury, N. W., and Yan, H. Multi-enzyme complexes on DNA scaffolds capable of substrate channeling with an artificial swinging arm, Nature Nanotechnol. 9, 531-536 (2014). [0187] 32. Hecht, H. J., Kalisz, K., Hendle, J., Schmid, R. D., Schomburg, D. Crystal structure of glucose oxidase from Aspergillus niger refined at 2-3 A resolution. J. Mol. Biol. 229, 153-172 (1993). [0188] 33. Henriksen, A., Schuller, D. J., Gajhede, M. Structural interactions between horseradish peroxidase C and the substrate benzhydroxamic acid determined by X-ray crystallography. Biochemistry 37, 8054-8060 (1998). [0189] 34. Widom, J. R., Dhakal, S., Heinicke, L. A. & Walter, N. G. Single-molecule tools for enzymology, structural biology, systems biology and nanotechnology: an update. Arch. Toxicol. 88, 1965-1985 (2014). [0190] 35. Veitch, N. C. Horseradish peroxidase: a modern view of a classic enzyme. Phytochemistry 65, 249-259 (2004). [0191] 36. Chapman, A. D., Cortes, A., Dafforn, T. R., Clarke, A. R. & Brady, R. L. Structural basis of substrate specificity in malate dehydrogenases: crystal structure of a ternary complex of porcine cytoplasmic malate dehydrogenase, alpha-ketomalonate and tetrahydoNAD. J Mol Biol. 285, 703-712 (1999). [0192] 37. Rowland, P., Basak, A. K., Gover, S., Levy, H. R. & Adams, M. J. The three-dimensional structure of glucose 6-phosphate dehydrogenase from Leuconostoc mesenteroides refined at 2.0 A resolution. Structure 15, 1073-1087 (1994). [0193] 38. Lovell, S. L. & Winzor, D. J. Effects of phosphate on the dissociation and enzymic stability of rabbit muscle lactate dehydrogenase. Biochemistry 13, 3527-3531 (1974). [0194] 39. Hecht, H. J., Kalisz, H. M., Hendle, J., Schmid, R. D. & Schomburg D. Crystal structure of glucose oxidase from Aspergillus niger refined at 2.3 A resolution. J Mol Biol. 229, 153-172 (1993). [0195] 40. Jacobson, R. H., Zhang, X. J., DuBose, R. F. & Matthews, B. W. Three-dimensional structure of beta-galactosidase from E. coli. Nature 369, 761-766 (1994). [0196] 41. Erkelenz, M., Kuo, C. H. & Niemeyer, C. M. DNA-Mediated Assembly of Cytochrome P450 BM3 Subdomains, J. Am. Chem. Soc. 133, 16111-16118 (2011). [0197] 42. Rudiuk, S., Venancio-Marques, A. & Baigl, D. Enhancement and modulation of enzymatic activity through higher-order structural changes of giant DNA-protein multibranch conjugates. Angew. Chem. Int. Ed. 51, 12694-12698 (2012). [0198] 43. English, B. P., et al. Ever-fluctuating single enzyme molecules: Michaelis-Menten equation revisited. Nat. Chem. Bio. 2, 87-94 (2006). [0199] 44. Liu, B., Baskin, R. J. & Kowalczykowski, S. C. NA unwinding heterogeneity by RecBCD results from static molecules able to equilibrate. Nature 500, 482-485 (2013). [0200] 45. Ramanathan, A., Savol, A., Burger, V., Chennubhotla, C. S. & Agarwal, P. K. Protein Conformational Populations and Functionally Relevant Substates. Acc. Chem. Res. 47, 149-156 (2014). [0201] 46. Hammes, G. G., Benkovic, S. J. & Hammes-Schiffer, S. Flexibility, Diversity, and Cooperativity: Pillars of Enzyme Catalysis. Biochemistry 50, 10422-10430 (2011). [0202] 47. Ramanathan, A. & Agarwal P. K. Evolutionarily Conserved Linkage between Enzyme Fold, Flexibility, and Catalysis. PLoS Biol. 9, 1-17 (2011). [0203] 48. Timm, C. & Niemeyer, C. M. Assembly and Purification of Enzyme-Functionalized DNA Origami Structures. Angew. Chem. Int. Ed. 54, 6745-6750 (2015). [0204] 49. Lin, J. & Wheeldon, I. Kinetic Enhancements in DNAEnzyme Nanostructures Mimic the Sabatier Principle ACS Catal. 3, 560-564 (2013). [0205] 50. Gao, Y., Roberts, C. C., Zhu, J., Lin, J., Chang, C. A. & Wheeldon, I. Tuning Enzyme Kinetics through Designed Intermolecular Interactions Far from the Active Site. ACS Catal. 5, 2149-2153 (2015). [0206] 51. Zhao, H. Effects of ions and other compatible solutes on enzyme activity, and its implication for biocatalysis using ionic liquids. J. Mol. Catal. B-Enzym. 37, 16-25 (2005). [0207] 52. Moelberta, S., Normandb, B. & Rios, P. D. L. Kosmotropes and chaotropes: modelling preferential exclusion, binding and aggregate stability. Biophys. Chem. 112, 45-57 (2004). [0208] 53. N Leberman, R. & Soper, A. K. Effect of high salt concentrations on water structure. Nature 378, 364-366 (1995). [0209] 54. N Jana, B., Pal, S., Maiti. P. K., Lin. S., Hynes, J. T. & Bagchi, B. Entropy of Water in the Hydration Layer of Major and Minor Grooves of DNA. J. Phys. Chem. B 110, 19611-19618 (2006). [0210] 55. N Chuprina, V. P., Heinemann, U., Nurislamov, A. A., Zielenkiewicz, P., Dickerson, R. E. & Saenger W. Molecular dynamics simulation ofthe hydration shell ofa B-DNA decamer reveals two main types of minor-groove hydration depending on groove width. Proc. Nati. Acad. Sci. USA 88, 593-597 (1991). [0211] 56. Zhao, H., Olubajo, O., Song, Z., Sims, A. L., Person, T. E., Lawal, R. A. & Holley, L. A. Effect of kosmotropicity of ionic liquids on the enzyme stability in aqueous solutions. Bioorg. Chem. 34, 15-25 (2006). [0212] 57. Timasheff, S. N. Proteinsolvent preferential interactions, protein hydration, and the modulation of biochemical reactions by solvent components. Proc. Natl. Acad. Sci. 99, 9721-9726 (2002). [0213] 58. N Levy, Y. & Onuchic, J. N. Water and proteins: A lovehate relationship. Proc. Natl. Acad. Sci. USA 101, 3325-3326 (2004) [0214] 59. N Grey, M. J. et al. Polyphosphate is a Primordial Chaperone. Mol. Cell. 53, 689-699 (2014). [0215] 60. Marcus, Y. Effects of ions on the structure of water: structure making and breaking. Chem. Rev. 109, 1346-1370 (2009). [0216] 61. Mei, Q., Wei, X., Su, F., Liu, Y., Yongbull, C., Johnson, R., Lindsay, S., Yan, H., Meidrum, D. Stability of DNA origami nanoarrays in cell lysate. Nano Lett. 11, 1477-1482 (2011). [0217] 62. Jiang, Q., Song, C., Nangreave, J., Liu, X., Lin, L., Qiu, Z., Wang, Z., Zou, G., Liang, X., Yan, H., Ding, B. DNA origami as a carrier for circumvention of drug resistance. J. Am. Chem. Soc. 134, 13396-13403 (2012). [0218] 63. Castello, A. et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell 149, 1393-1406 (2012) [0219] 64. Wong, C. M., Wong, K. H. and Chen, X. D. Glucose oxidase: natural occurrence, function, properties and industrial application. Appl. Microbiol. Biotechnol. 78, 927-38 (2008). [0220] 65. Guo, S., Cao, R., Lu, A., Zhou, Q., Lu, T., Ding, X., Li, C. and Huang, X. One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III). J. Biol. Inorg. Chem. 13, 587-597 (2008). [0221] 66. Sung, J. Y. & Lee, Y. N. Isoforms of glucose 6-phosphate dehydrogenase in Deinococcus radiophilus. J. Microbiol. 45, 318-325 (2007). [0222] 67. Horikiri, S., Aizawa, Y., Kai, T., Amachi, S., Shinoyama, H. and Fujii, T. Electron acquisition system constructed from an NAD-independent D-lactate dehydrogenase and cytochrome c2 in Rhodopseudomonas palustris No. 7. Biosci. Biotechnol. Biochem. 68, 516-522 (2004). [0223] 68. Eanes, R.Z., and Kun, E. Separation and characterization of aconitate hydratase isoenzymes from pig tissues. Biochim. Biophys. Acta 227, 204-210 (1971). [0224] 69. Fu, J., Liu, M., Liu, Y., Woodbury, N. W. & Yan, H. Interenzyme Substrate Diffusion for an Enzyme Cascade Organized on Spatially Addressable DNA Nanostructures. J. Am. Chem. Soc. 134, 5516-5519 (2012). [0225] 70. Liu, M., Fu, J., Hejesen, C., Yang, Y., Woodbury, N. W., Gothelf, K., Liu, Y. & Yan, H. A DNA Tweezer-Actuated Enzyme Nanoreactor. Nature Commun. 4, 1-5 (2013). [0226] 71. Abelson, J. et al. Conformational dynamics of single pre-mRNA molecules during in vitro splicing Nat. Struct. Mal. Biol. 17, 504-512 (2010). [0227] 72. Michelotti, N. et al. A bird's eye view tracking slow nanometer-scale movements of single molecular nano-assemblies. Methods Enzymol. 475, 121-148 (2010). [0228] 73. Blanco, M. & Walter, N. G. Analysis of Complex Single-Molecule FRET Time Trajectories. Method. Enzymol. 472, 153-178 (2010). [0229] 74. Gourevitch, B. & Eggermont, J. J. A nonparametric approach for detection of bursts in spike trains. Journal of Neuroscience Methods 160, 349-358 (2007). [0230] 75. Rinaldi, A. J., Lund, P. E., Blanco, M. R. & Walter, N. G. The Shine-Dalgamo sequence of riboswitch-regulated single mRNAs shows ligand-dependent accessibility bursts. Nat. Commun., 8976 (2015).