ESCHERICHIA COLI FOR SYNTHESIZING L-VALINE, CONSTRUCTION METHOD AND USE THEREOF

20240158737 ยท 2024-05-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides an Escherichia coli for synthesizing L-valine, a construction method and use thereof. The Escherichia coli of the invention is designated as Escherichia coli W3110 and was deposited in China Center for Type Culture Collection (Address: Bayi Road, Wuchang District, Wuhan City, Hubei Province) under the Accession No. CCTCC M 2022293 on Mar. 18, 2022. The recombinant Escherichia coli takes Escherichia coli as a starting strain, and a transcription regulation factor is overexpressed to obtain a recombinant Escherichia coli. The recombinant Escherichia coli for synthesizing L-valine of the invention is fermented in a 5 L fermentor with trace dissolved oxygen to test strains, the yield of L-valine reaches 112 g/L, and the OD of the bacterium is 104.

    Claims

    1. An Escherichia coli for synthesizing L-valine, wherein the Escherichia coli is designated as Escherichia coli W3110 and was deposited in China Center for Type Culture Collection (Address: Bayi Road, Wuchang District, Wuhan City, Hubei Province) under the Accession No. CCTCC M 2022293 on Mar. 18, 2022.

    2. A recombinant Escherichia coli for synthesizing L-valine, wherein the recombinant Escherichia coli takes the Escherichia coli according to claim 1 as a starting strain, and in the recombinant Escherichia coli, dicarboxylic acid reductisomerase gene ilvC, dihydroxyacid dehydratase gene ilvD and branched chain amino acid aminotransferase gene ilvE are overexpressed; branched-chain amino acid transporter gene brnQ is knocked out, and branched-chain amino acid output protein gene brnFE is integrated into the site of the knocked-out branched-chain amino acid transporter gene brnQ; phosphogluconate dehydratase gene edd and KHG/KDPG aldolase gene eda are integrated; and a transcription regulation factor is overexpressed to obtain the recombinant Escherichia coli.

    3. The recombinant Escherichia coli for synthesizing L-valine according claim 2, wherein the transcription regulation factor is a positive transcription regulation factor and/or a negative transcription regulation factor; the positive transcription regulation factor is a DNA binding transcription double regulator pdhR, a DNA binding transcription double regulator crp and a DNA binding transcription double regulator lrp; and the negative transcription regulation factor is RNA polymerase sigma factor rpoS.

    4. The recombinant Escherichia coli for synthesizing L-valine according claim 2, wherein an operon ilvIH containing a mutation site is integrated into Escherichia coli, wherein the mutation site is ilvH gene G41A or/and C50T.

    5. The recombinant Escherichia coli for synthesizing L-valine according claim 2, wherein the transcription regulation factor takes ptrc99A or ptrc28A as a vector.

    6. A method for constructing the recombinant Escherichia coli according to claim 2, comprising steps of: taking the Escherichia coli for synthesizing L-valine as a starting strain, and overexpressing a transcription regulation factor, wherein the transcription regulation factor is a positive transcription regulation factor and/or a negative transcription regulation factor; the positive transcription regulation factor is a DNA binding transcription double regulator pdhR, a DNA binding transcription double regulator crp and a DNA binding transcription double regulator lrp; and the negative transcription regulation factor is RNA polymerase sigma factor rpoS; and/or overexpressing dicarboxylic acid reductisomerase gene ilvC, dihydroxyacid dehydratase gene ilvD and branched chain amino acid aminotransferase gene ilvE; and/or knocking out branched-chain amino acid transporter gene brnQ, integrating branched-chain amino acid output protein gene brnFE into the site of the knocked-out branched-chain amino acid transporter gene brnQ, and making double copies of the brnFE gene; and/or integrating phosphogluconate dehydratase gene edd and KHG/KDPG aldolase gene eda to obtain the recombinant Escherichia coli; and/or integrating an operon ilvIH containing a mutation site into Escherichia coli, wherein the mutation site is ilvH gene G41A or/and C50T.

    7. Use of the recombinant Escherichia coli according to claim 2 in fermentation synthesis of L-valine.

    8. The use according to claim 7, wherein the fermentation is carried out in conditions of: pyruvate as a precursor, a dissolved oxygen content of 10-20%, a fermentation time of 24-72 h, a temperature of 35-40? C., and a rotational speed of 210-230 rpm.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0039] To make the content of the invention more comprehensible, the invention will be described in further detail below according to specific embodiments of the invention and in conjunction with the accompanying drawings, wherein:

    [0040] FIG. 1 shows the yield of L-valine of recombinant strain CP17 identified at the 5 L fermentor level according to the invention.

    DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

    [0041] The invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the invention, but the embodiments described are not intended to limit the invention.

    [0042] The materials and methods involved in the following embodiments are as follows: [0043] (1) Media: [0044] Seed medium (g/L): Glucose 20, Yeast Extract 10, Tryptone 6, KH.sub.2PO.sub.4 1.2, MgSO.sub.4.Math.7H.sub.2O 0.5, FeSO.sub.4.Math.7H.sub.2O 0.01, MnSO.sub.4.Math.H.sub.2O 0.01, VB1 0.0013, and VH 0.0003, where the phenol red solution has a volume concentration of 2%, pH is controlled at about 6.5, and the medium is sterilized at a temperature of 115? C. and a pressure of 0.75 MPa for 15 min.

    [0045] Fermentation medium (g/L): Glucose 20, Yeast Extract 2, Tryptone 4, KH.sub.2PO.sub.4 2, Sodium Citrate 1, MgSO.sub.4.Math.7H.sub.2P 0.7, FeSO.sub.4.Math.7H.sub.2O 0.1, MnSO.sub.4.Math.H.sub.2O 0.1, VB1 0.008, and VH 0.0002, where the phenol red solution has a volume concentration of 2%, pH is controlled at about 7.0, and the medium is sterilized at a temperature of 121? C. and a pressure of 0.75 MPa for 15 min. [0046] (2) Gene knockout or integration: Referring to CRISPR/Cas9 gene editing technology, the system needs donor DNA fragment, pREDCas9 plasmid and pGRB cleavage plasmid for gene knockout or integration. pREDCas9 includes Red recombinant system, Cas9 protein expression system, pGRB elimination system, azithromycin resistance gene and temperature sensitive system, and the suitable temperature is 32? C. The pGRB plasmid contains gRNA-Cas9 binding region sequence, terminator sequence and ampicillin resistance gene, and the suitable temperature is 37? C. gRNA transcribed from pGRB carries Cas9 protein to recognize the target site of PAM (protospacer adjacent motifs) gene by base pairing, and realize double-strand break in DNA of interest. pGRB plasmid is constructed by recombining the fragment containing the target site of PAM gene with a linearized vector fragment. [0047] (3) Transformation of pREDCas9 plasmid: The pREDCas9 plasmid is electroporated into the competent starting strain used in the invention, resuscitated for 2 h and coated on an LB plate containing azithromycin, and cultured in an incubator at 32? C. for 10-12 h. A single colony is selected for PCR verification to screen positive transformants. [0048] (4) Transformation of pGRB and recombinant DNA fragments: Donor DNA and pGRB plasmid are electroporated into electrocompetent cells containing pREDCas9. Lambda-Red recombinase is induced by 0.1 mM IPTG for expression, resuscitated for 2 h and coated on an LB plate containing ampicillin and azithromycin, and cultured at 32? C. for 10-12 h. A single colony is selected for PCR verification. Positive recombinants are selected by colony PCR verification. [0049] (5) Related primers involved in the present invention:

    TABLE-US-00001 UP-yjiT-S: (SEQIDNO:1) AATAGTTGTTGCCGCCTGAGT UP-yjiT-A: (SEQIDNO:2) AGAGTGTACGCTTAACGATTGTTAATATTATAAATAGACTGAAT GAATATCTTAACCTTATCAGACTGATGGGCTTCTTAACACCCTT ATAAGTGTAAAGCCACGAAAACGGTTGCTGATTGCAAAACAGGC AGCAAAGTCCC brnFE-S2: (SEQIDNO:3) GCAATCAGCAACCGTTTTCGTGGCTTTACACTTATAAGGGTGTT AAGAAGCCCATCAGTCTGATAAGGTTAAGATATTCATTCAGTCT ATTTATAATATTAACAATCGTTAAGCGTACACTCTGTGCAAAAA ACGCAAGAGATTC brnFE-A2: (SEQIDNO:4) ACATCCCTTCACAGGTAGTGCTTTTAGAAAAGATTCACCAGTCC AACA DN-yjiT-S: (SEQIDNO:5) TGTTGGACTGGTGAATCTTTTCTAAAAGCACTACCTGTGAAGGG ATGT DN-yjiT-A: (SEQIDNO:6) CAGGGCTTCCACAGTCACAAT brnFE-JD-S2: (SEQIDNO:7) TTCGCTATTGTGCAGTTTCTC brnFE-JD-A2: (SEQIDNO:8) ATTGCAAAACAGGCAGCAAAGTCC UP-yghX-S (SEQIDNO:9) GCGCAACGTAGAACAGGAATT UP-yghX-A: (SEQIDNO:10) AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATG ATTAATTGTCAAGATTGAAGCGCCTTTACTACTCC ilvIH.sup.mut-S1: (SEQIDNO:11) TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTC ACACAGGAAACAGACCATGGAGATGTTGTCTGGAGCC ilvIH.sup.mut-A1: (SEQIDNO:12) AGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTCAACGCATT ATTTTATCGCCG DN-yghX-S: (SEQIDNO:13) TGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGTCATAGTAA TCCAGCAACTCTTGTG DN-yghX-A: (SEQIDNO:14) GAGCAGGTATTTACGTGAACCG gRNA-yghX-S: (SEQIDNO:15) AGTCCTAGGTATAATACTAGTGGTGCCTGACGACCATAAAAGTT TTAGAGCTAGAA gRNA-yghX-A: (SEQIDNO:16) TTCTAGCTCTAAAACTTTTATGGTCGTCAGGCACCACTAGTATT ATACCTAGGACT

    Example 1

    [0050] An Escherichia coli for synthesizing L-valine and a construction method therefor, specifically including the following steps:

    [0051] 1. L-valine producing strains are obtained through ARTP mutagenesis and high-throughput screening.

    [0052] The invention first constructs a biosensor based on an Lrp-type transcription regulation factor, and then uses an ARTP mutagenesis system to construct a mutant library of Escherichia coli W3110. The time of treatment of wild Escherichia coli using ARTP is set to 40 s, and its lethality is between 99.4%. About 5?100 single colonies are screened out on a 96-well microtiter plate. L-valine producing strains are obtained by multiple rounds of mutagenesis and screening. The highest producing strain is CP1. The producing strain CP1 is cultured in the seed medium at 37? C. and 220 rpm for 12 h, to prepare a seed culture. The prepared seed culture is inoculated in the fermentation medium at an inoculation amount of 2% (v/v), and cultured at 37? C. and 220 rpm for 24 h to prepare a fermentation broth. The yield of L-valine reaches 2.9 g/L.

    [0053] Although the production of L-valine has achieved a zero breakthrough through ARTP mutagenesis, it is still necessary to strengthen the branch synthesis pathway from pyruvate to L-valine. The synthesis of L-valine from pyruvate involves three enzymes: dicarboxylic acid reductisomerase (encoded by ilvC gene), dihydroxyacid dehydratase (encoded by ilvD gene) and branched chain amino acid aminotransferase (encoded by ilvE gene). The ilvED gene is first integrated by segmental integration. This gene carries exogenous cleavage plasmid sgRNA at the end. Then the ilvC gene is integrated at this gene locus. In order to enhance the metabolic carbon flow from pyruvate pool to L-valine, CP2 is constructed by using CP1 as a starting strain and integrating P.sub.trc-ilvCDE into CP1, and fermented in a shake flask for 24 h. The yield of L-valine is 8.9 g/L and the bacterial OD is 36.1.

    [0054] Efficient efflux and blocking of transport of L-valine into cells are effective strategies for reducing L-valine content in cells and weakening its feedback inhibition on key enzymes. There are two different transport systems for BCAAs in Escherichia coli. LivFGHMJ and LivFGHMK are two ATP-dependent high affinity BCAA transport systems. BrnQ is a low affinity BCAA transporter. The brnQ gene for L-valine uptake is knocked out to increase the yield of L-valine. BrnFE from Corynebacterium glutamicum (encoded by brnFE) has been proved to be an effective transporter of L-valine.

    [0055] The brnFE gene is integrated into CP2 by taking CP2 as a starting strain, and upstream homologous arms (UP-brnQ-S and UP-brnQ-A3) and downstream homologous arms (DN-brnQ-S3 and DN-brnQ-A) of the gene locus brnQ as well as primers of the gene brnFE of interest (brnFE-S1 and brnFE-A1) are designed through primer 5. PCR amplification is performed by using the genome of Escherichia coli W3110 as a template to obtain upstream and downstream homologous arms and an intermediate fragment of interest, and then overlap PCR amplification is performed by using the recovered fragment as a template to obtain a donor DNA fragment. The pGRB plasmid containing the target site is constructed. Primers (gRNA-brnQ-S and gRNA-brnQ-A) are annealed to prepare a fragment containing a PAM gene target site, which is ligated with the linearized pGRB and transformed into chemically competent Escherichia coli DH5a. Positive colonies are selected to obtain pGRB-brnQ plasmid. The integrated fragment of brnFE gene and plasmid pGRB-brnQ are electroporated into electrocompetent cells containing pREDCas9 plasmid. The positive colonies containing the gene brnFE of interest are screened. The primers (brnFE-JD-S1 and brnFE-JD-A1) are identified, and plasmids pGRB-brnQ and pREDCas9 are both eliminated to obtain a strain CP3. This can further increase the yield of L-valine. The strain CP3 is fermented in a shake flask for 24 h. The yield of L-valine is 16.2 g/L and the bacterial OD is 39.4.

    [0056] 2. Comparative transcriptome analysis of L-valine producing strains under different dissolved oxygen conditions and regulation of transcription regulation factors

    [0057] The regulation of single-gene transcription level in metabolic pathway often cannot significantly improve the titer of target products, and even leads to the imbalance of carbon-nitrogen metabolic network and cofactor network. The global regulator (gTME) can activate or inhibit the co-expression of multiple genes in specific metabolic pathways, so transcription factors with specific functions can be expressed according to different metabolic regulation requirements, thus effectively increasing the synthesis of target metabolites. Comparative transcriptomics has been applied to analyze different transcription levels, and is an effective method to identify proteins that play an important role in the synthesis and metabolism of target products.

    [0058] Trace dissolved oxygen can inhibit the TCA cycle of the competitive pathway of L-valine synthesis, so as to strengthen the branch pathway of L-valine synthesis. Transcriptome analysis of impact of different dissolved oxygen conditions on gene expression shows that Escherichia coli producing strain CP exhibits a significant difference in L-valine synthesis under different dissolved oxygen conditions. In order to identify the gene expression level under different dissolved oxygen conditions, L-valine producing strain CP3 is cultured at a 5 L fermentor level, and transcriptome is measured by sampling under different dissolved oxygen conditions. A 5 L fermentor test is carried out. Fed-batch fermentation is carried out in a 5 L bioreactor to simulate the impact of dissolved oxygen on L-valine production. Firstly, the strain is cultured at the fermentor level to 16 h. When the bacterial OD reaches the maximum, the ventilation is reduced, and the dissolved oxygen level in the fermentation broth is maintained at 30% by adjusting the ventilation and rotational speed. Then the high dissolved oxygen condition is still 30%. The high dissolved oxygen condition is used as a control group, designated as G01. Under a low dissolved oxygen condition, the dissolved oxygen level in the fermentation broth is maintained at 10% by reducing the ventilation and rotational speed. The low dissolved oxygen condition is used as an experimental group and designated as G02. After fermentation for 48 h, samples are taken for transcriptome measurement. As can be learned through the observation of the yield of L-valine, the yield of L-valine is 76 g/L under low dissolved oxygen and 65 g/L under high dissolved oxygen. Under low dissolved oxygen, after 30 h after inoculation, the yield of L-valine increases obviously, and the bacterial OD and glucose consumption rate remain unchanged.

    [0059] Comparative transcriptome analysis of G01 and G02 samples shows that obviously distinct genes related to metabolism of Escherichia coli are selected and overexpressed. 10 transcription regulation factors related to carbon metabolism of Escherichia coli are selected. The genome of CP3 is ligated to ptrc99A plasmid and overexpressed to construct strains CP4-CP14 respectively (in which CP4 is a control group, that is, electroinjected with 99A empty plasmid). The results of 24 h shake flask fermentation test show that the positive transcription regulation factor is pdhR, crp and lrp, and the negative transcription regulation factor was RNA polymerase sigma factor rpoS. The results showed that the positive transcription regulation factor is DNA binding transcription double regulator pdhR, DNA binding transcription double regulator crp and a DNA binding transcription double regulator lrp, and the negative transcription regulation factor is RNA polymerase sigma factor rpoS.

    [0060] For the strain CP9 constructed by overexpression of the gene pdhR, the yield of L-valine has the most significant increase, reaching 15 g/L, which is 37.6% higher than that of the control group. For the strains CP10 and CP11 constructed by overexpression of the genes crp and lrp, the yield of L-valine reaches 13 g/L and 12.1 g/L respectively, which are respectively 19.3% and 11.1% higher than that of the control group. In order to eliminate the impact of plasmid on the fermentation process, the plasmid test shows that the gene pdhR increases the yield of L-valine most significantly, and then the gene pdhR is integrated into the genome of CP3 to construct a strain CP15, in which case the yield of L-valine reaches 15.9 g/L.

    [0061] Taking CP15 as a starting strain, the antisense strand of the gene rpoS is overexpressed. The antisense RNA complements and pairs with the mRNA of the gene rpoS normally expressed in cells, thus preventing the normal translation of the gene rpoS and achieving an inhibition effect. In order to eliminate the restriction of the gene rpoS on L-valine synthesis, a strain CP16 is constructed by overexpressing the antisense strand of the gene rpoS using antisense RNA interference strategy. Antisense RNA is used to inhibit the translation of mRNA encoded by the gene rpoS into rpoS. The results of shake flask fermentation show that the yield of L-valine reaches 17.4 g/L, exhibiting an increase of 9.4%. 3. Entner-Doudoroff pathway is designed reasonably to improve and control NADPH regeneration

    [0062] The Entner-Doudoroff pathway of Zymomonas mobilis is introduced, and intracellular redox balance is maintained through cofactor engineering, to realize self-balance of cofactors and promote efficient synthesis of target products. Insufficient supply of cofactors often affects the efficiency of biocatalysis. Under the condition of oxygen-limited fermentation, the supply of NADH is maintained vigorous through glycolysis metabolism, and NADH may even be overproduced. 2 mol NADPH is consumed for synthesis of every 1 mol L-valine, leading to imbalance of intracellular redox level. The invention systematically analyzes the production network of L-valine in Escherichia coli and designs a redox equilibrium route for synthesizing L-valine by glucose fermentation.


    Glucose+2 NADPH=L-Valine+2 NADH(Equation 1)

    By constructing a balanced redox metabolic network to produce L-valine, a synergistic strategy is proposed. This design should reduce the pressure of cell growth while producing L-valine at high yield.

    [0063] The genes P.sub.trc-edd and P.sub.trc-eda are integrated on the Escherichia coli genome CP16 to construct a strain CP17. The fragments P.sub.trc-edd and P.sub.trc-eda are used to form phosphogluconate dehydrase gene edd and KHG/KDPG aldolase gene eda in the genome of Zymomonas mobilis. For design of primers, a promoter is attached to the primers. The yield of L-valine reaches 19.3 g/L, which is 10.6% higher than that of the control group.

    [0064] The gene brnFE is integrated by taking CP17 as a starting strain, and upstream homologous arms (UP-yjiT-S and UP-yjiT-A) and downstream homologous arms (DN-yjiT-S and DN-yjiT-A) of the pseudogene locus yjiT as well as primers of the gene brnFE of interest (brnFE-S2 and brnFE-A2) are designed through primer 5. PCR amplification is performed by using the genome of Escherichia coli W3110 as a template to obtain upstream and downstream homologous arms and an intermediate fragment of interest, and then overlap PCR amplification is performed by using the recovered fragment as a template to obtain a donor DNA fragment. The pGRB plasmid containing the target site is constructed. Primers (gRNA-yjiT-S and gRNA-yjiT-A) are annealed to prepare a fragment containing a PAM gene target site, which is ligated with the linearized pGRB and transformed into chemically competent Escherichia coli DH5a. Positive colonies are selected to obtain pGRB-yjiT plasmid. The integrated fragment of brnFE gene and plasmid pGRB-yjiT are electroporated into electrocompetent cells containing pREDCas9 plasmid. The positive colonies containing the gene brnFE of interest are screened. The primers (brnFE-JD-S2 and brnFE-JD-A2) are identified, and plasmids pGRB-yjiT and pREDCas9 are both eliminated to obtain a strain CP18.

    [0065] The gene ilvIH.sup.mut is integrated by taking CP18 as a starting strain, and upstream homologous arms (UP-yghX-S and UP-yghX-A) and downstream homologous arms (DN-yghX-S and DN-yghX-A) of the pseudogene locus yghX as well as primers of the gene ilvIH.sup.mut of interest (ilvIH.sup.mut-S1 and ilvIH.sup.mut-A1) were designed through primer 5. PCR amplification is performed by using the genome of Escherichia coli W3110 as a template to obtain upstream and downstream homologous arms and an intermediate fragment of interest, and then overlap PCR amplification is performed by using the recovered fragment as a template to obtain a donor DNA fragment. The pGRB plasmid containing the target site is constructed. Primers (gRNA-yghX-S and gRNA-yghX-A) are annealed to prepare a fragment containing a PAM gene target site, which is ligated with the linearized pGRB and transformed into chemically competent Escherichia coli DH5a. Positive colonies are selected to obtain pGRB-yghX plasmid. The integrated fragment of ilvIH.sup.mut gene and plasmid pGRB-yghX are electroporated into electrocompetent cells containing pREDCas9 plasmid. The positive colonies containing the gene ilvIH.sup.mut of interest are screened. The primers (UP-yghX-S and DN-yghX-A) are identified, and plasmids pGRB-yghX and pREDCas9 are both eliminated to obtain a strain CP19.

    Example 2

    [0066] Based on the strain CP19, fed-batch fermentation is carried out in a 5 L fermentor under a trace dissolved oxygen condition.

    [0067] The dissolved oxygen condition is very important for synthesis of L-valine by fermentation. In the metabolic network of Escherichia coli, L-valine synthesis pathway and TCA cycle form a competitive relationship. By controlling the dissolved oxygen condition to inhibit aerobic respiration of cells, more precursor pyruvate is saved for L-valine synthesis. The dissolved oxygen condition is controlled at 10-20%, and the strains are fermented in a 5 L bioreactor under trace dissolved oxygen, with a fermentation cycle of 48 h. The results are as shown in FIG. 1. The yield of L-valine reaches 112 g/L and the bacterial OD reaches a maximum of 104.

    [0068] Apparently, the above-described embodiments are merely examples provided for clarity of description, and are not intended to limit the implementations of the invention. Other variations or changes can be made by those skilled in the art based on the above description. The embodiments are not exhaustive herein. Obvious variations or changes derived therefrom also fall within the protection scope of the invention.