COMPOSITION FOR DETECTING PATHOGENS, AND KIT AND METHOD THEREFOR

20220411852 · 2022-12-29

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a composition for detecting multiple encephalitis/meningitis/respiratory pathogens. The composition includes primer sequences for the pathogens as shown in SEQ ID NOs: 1-7, 9-23 and 25-32, in which SEQ ID NOs: 1-7 and 9-16 carry fluorescent reporter groups. In addition, the present invention further provides a use of the foregoing composition in the preparation of a kit, and a related kit and a method for using the same.

    Claims

    1. A composition, comprising: a primer pair for Haemophilus influenzae, sequences of which are respectively as shown in SEQ ID NO: 1 and SEQ ID NO: 17; a primer pair for Streptococcus pneumoniae, sequences of which are respectively as shown in SEQ ID NO: 2 and SEQ ID NO: 18; a primer pair for Neisseria meningitidis, sequences of which are respectively as shown in SEQ ID NO: 3 and SEQ ID NO: 19; a primer pair for Listeria monocytogenes, sequences of which are respectively as shown in SEQ ID NO: 4 and SEQ ID NO: 20; a primer pair for Escherichia coli, sequences of which are respectively as shown in SEQ ID NO: 5 and SEQ ID NO 21; a primer pair for Japanese encephalitis virus, sequences of which are respectively as shown in SEQ ID NO: 6 and SEQ ID NO: 22; a primer pair for an enterovirus, sequences of which are respectively as shown in SEQ ID NO: 7 and SEQ ID NO: 23; a primer pair for human herpesvirus 6, sequences of which are respectively as shown in SEQ ID NO: 9 and SEQ ID NO: 25; a primer pair for varicella-zoster virus, sequences of which are respectively as shown in SEQ ID NO: 10 and SEQ ID NO: 26; a primer pair for Nipah virus, sequences of which are respectively as shown in SEQ ID NO: 11 and SEQ ID NO: 27; a primer pair for Powassan virus, sequences of which are respectively as shown in SEQ ID NO: 12 and SEQ ID NO: 28; a primer pair for West Nile virus, sequences of which are respectively as shown in SEQ ID NO: 13 and SEQ ID NO: 29; a primer pair for Herpes simplex virus type 1, sequences of which are respectively as shown in SEQ ID NO: 14 and SEQ ID NO: 30; a primer pair for Herpes simplex virus type 2, sequences of which are respectively as shown in SEQ ID NO: 15 and SEQ ID NO: 31; and a primer pair for Cryptococcus neoformans, sequences of which are respectively as shown in SEQ ID NO: 16 and SEQ ID NO: 32.

    2. The composition according to claim 1, wherein sequences SEQ ID NOs: 1-7 and 9-16 carry fluorescent reporter groups.

    3. The composition according to claim 2, wherein the sequences SEQ ID NOs: 1-7 and 9-16 carry fluorescence quenching groups.

    4. The composition according to claim 3, wherein the fluorescent reporter group and the fluorescence quenching group are spaced apart by 15-25 nt.

    5. The composition according to claim 1, wherein sequences SEQ ID NO: 1 to SEQ ID NO: 4 have a first fluorescent reporter group; sequences SEQ ID NO: 5 to SEQ ID NO: 7 have a second fluorescent reporter group; sequences SEQ ID NO: 9 to SEQ ID NO: 12 have a third fluorescent reporter group; and sequences SEQ ID NO: 13 to SEQ ID NO: 16 have a fourth fluorescent reporter group; Wherein the first fluorescent reporter group, the second fluorescent reporter group, the third fluorescent reporter group and the fourth fluorescent reporter group are different from one another.

    6. The composition according to claim 5, wherein the first fluorescent reporter group, the second fluorescent reporter group, the third fluorescent reporter group and the fourth fluorescent reporter group are independently selected from FAM, HEX, ROX, CY5, VIC, JOE and TAMRA.

    7. The composition according to claim 6, wherein the first fluorescent reporter group is FAM, the second fluorescent reporter group is HEX, the third fluorescent reporter group is ROX, and the fourth fluorescent reporter group is CY5.

    8. The composition according to claim 1, wherein molar ratio of sequences SEQ ID NOs: 1-7 and 9-16 to sequences SEQ ID NOs: 17-23 and 25-32 is 1:2-2:1.

    9. The composition according to claim 8, wherein the molar ratio of sequences SEQ ID NOs: 1-7 and 9-16 to sequences SEQ ID NOs: 17-23 and 25-32 is 1:0.95-0.85.

    10. The composition according to claim 8, wherein the molar ratio of sequences SEQ ID NOs: 1-7 and 9-16 to sequences SEQ ID NOs: 17-23 and 25-32 is 1:0.9.

    11. The composition according to claim 1, wherein the composition further includes an internal standard.

    12. The composition according to claim 11, wherein the internal standard includes a human endogenous housekeeping gene.

    13. The composition according to claim 11, wherein the composition includes a primer pair for the internal standard, sequences of which are respectively as shown in SEQ ID NO: 8 and SEQ ID NO: 24.

    14. A kit, comprising the composition according to claim 1.

    15. The kit according to claim 14, wherein the kit further comprises a reagent for extracting a sample.

    16. The kit according to claim 15, wherein the sample is a cerebrospinal fluid.

    17. The kit according to claim 14, wherein the kit further includes a DNA/RNA extraction reagent, dNTPs, Mg.sup.2+, a Taq polymerase, and a PCR buffer solution.

    18. A method for detecting a pathogen, wherein the method comprises: providing a sample to undergo detection; adding the composition according to claim 1 to the sample to undergo detection, so as to perform amplification by PCR; and acquiring a change in fluorescence signal intensity to generate a melting curve, so as to qualitatively analyze a detected target sequence.

    19. The method according to claim 10, wherein the melting curve is analyzed at 50° C. to 95° C., and fluorescence is collected once with every rise of 0.5° C.

    20. The method according to claim 10, wherein the fluorescence signal intensity is a fluorescence signal intensity of an amplification product of a specific primer.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0044] FIG. 1 illustrates a schematic diagram of multi-platform application of the composition according to the present invention;

    [0045] FIG. 2 illustrates a positive test result in a FAM channel according to an example of the present invention;

    [0046] FIG. 3 illustrates a positive test result in a HEX channel according to an example of the present invention;

    [0047] FIG. 4 illustrates a positive test result in a ROX channel according to an example of the present invention;

    [0048] FIG. 5 illustrates a positive test result in a CY5 channel according to an example of the present invention.

    DETAILED DESCRIPTION OF EMBODIMENTS

    [0049] Generally speaking, with the present invention, multiple pathogens, especially 15 particular pathogens, may be detected at the same time in the same tube containing reagents. Thus, more target detection information may be provided for a doctor in one test for a nucleic acid sample, especially those difficult to sample such as a cerebrospinal fluid. In addition, in the present invention, the whole process of PCR amplification and product analysis is carried out under single-tube closed conditions, reducing pollution in molecular detection and allowing real-time monitoring of the reaction process.

    [0050] More specifically, based on the technical principle of generation of fluorescence signals through hybridization of fluorescent products after amplification of fluorescent primers, four targets are amplified at the same time according to different Tm values of products by using a melting curve in a single-color fluorescence channel, so as to detect and analyze the four targets in the single-color fluorescence channel.

    [0051] The present invention will be described in detail below in conjunction with specific embodiments and examples. The advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these specific embodiments and examples are intended to describe the present invention, instead of limiting the present invention.

    [0052] In the following, unless otherwise specified, all reagents, instruments, and the like are commercially available.

    EXAMPLE 1

    [0053] Sequences

    [0054] 30 primer sequences and 2 internal standard sequences: SEQ ID NO: 01-SEQ. ID NO: 32 were used,

    [0055] in which SEQ. ID NO: 08 and SEQ ID NO: 24 were an internal standard primer pair.

    [0056] SEQ ID NOs: 1-7, 9-23 and 25-32 were used for specifically detecting Haemophilus influenzae (HI), Streptococcus pneumoniae (SP),Neisseria meningitidis (NM), Listeria monocytogenes (LM), Escherichia coli (ECO), Japanese encephalitis virus (JEV), an enterovirus (EV), human herpesvirus 6 (HHV6), varicella-zoster virus (VZV), Nipah virus (NVD), Powasen virus (POWV), West Nile virus (WNV), Herpes simplex virus type 1 (HSV-1), Herpes simplex virus type 2 (HSV-2) and Cryptococcus neoformans (CN).

    TABLE-US-00001 TABLE 1 Primer and internal standard sequences BHQ1-CACCAGAATACAACA(T-FAM)CGCATT SEQ. ID NO: 01 BHQ1-AACCACGAGTAAGAG(T-FAM)GATGA SEQ. ID NO: 02 BHQ1-AATTCTGCCGTAAGCCGCA(T-FAM)C SEQ. ID NO: 03 BHQ1-AATAACAGCAATTCAAG(T-FAM)GCAAG SEQ. ID NO: 04 BHQ1-CGGGTGAAGGTTATCTCTA(T-HEX)GAACT SEQ. ID NO: 05 BHQ1-GTAAACAAGGCTTCACTGA(T-HEX)CGT SEQ. ID NO: 06 BHQ1-TGAAAGTTCCATAGGAGATAGCG(T-HEX) SEQ. ID NO: 07 GA BHQ1-GACTTCAGCATGGCGGTG(T-HEX)T SEQ. ID NO: 08 BHQ2-CTATAGCAGCGCCCAA(T-ROX)GCCAA SEQ. ID NO: 09 BHQ2-CTCACGTCTATCCTTAT(T-ROX)CCCA SEQ. ID NO: 10 BHQ2-AGCAGGAAGCCAGTTGA(T-ROX)CCA SEQ. ID NO: 11 BHQ2-AGACACAACAGCGTT(T-ROX)GGGCAACA SEQ. ID NO: 12 BHQ2-GGCTGGGAGATTTAGCA(T-CY5)CAC SEQ. ID NO: 13 BHQ2-GCGCGACCGACAGCAC(T-CY5)CACA SEQ. ID NO: 14 BHQ2-CCTTGTTTTCGACCGGCACCC(T-CY5)A SEQ. ID NO: 15 BHQ2-ATCTCTCTGCATCCG(T-CY5)GACA SEQ. ID NO: 16 AATATGCAGCTTCATCATGACCT SEQ. ID NO: 17 CCCCTAAAATAACCGCCTTCA SEQ. ID NO: 18 CTTCCGTCAGACTGAGTTGCC SEQ. ID NO: 19 CAATCAAATGTAGTTGGTCCGTT SEQ. ID NO: 20 AAAGCCAGTAAAGTAGAACGGTTTG SEQ. ID NO: 21 TGTTCTCCCAATCGCTTTGCT SEQ. ID NO: 22 CTTGCCTGTATCCAATCGATGACT SEQ. ID NO: 23 TAGCAACAACTGAATAGCCAAGGT SEQ. ID NO: 24 GCACCTCCTTTGTATGTCGACTC SEQ. ID NO: 25 ACCGTATCCGCGTATAACAGT SEQ. ID NO: 26 CACATTGCAGTTTCCCTTCATCGATA SEQ. ID NO: 27 TCAAGTAGCCAGTCACTCACCG SEQ. ID NO: 28 CGACAGTCATCACATAGTATGCAC SEQ. ID NO: 29 GCGTAACACGTACACCCCGGCAT SEQ. ID NO: 30 GACACCCAGGACCAGGTTCGT SEQ. ID NO: 31 CTTAAGTTCAGCGGGTAGTCC SEQ. ID NO: 32

    Example 2

    [0057] DNA/RNA Extraction

    [0058] DNA/RNA was extracted by adopting a paramagnetic particle method. The following operations were carried out in a sample treatment room:

    [0059] An appropriate number of 1.5-mL sterilized centrifuge tubes were taken, which were respectively labeled a negative control, a positive control and a sample to undergo detection, respectively. 300 μL of a DNA/RNA extraction solution was added to each tube.

    [0060] 200 μL of the sample to undergo detection, the negative control or the positive control was added to each tube. The tube was covered with a cap, and shaken for 10 seconds for through mixing, and subjected to a short spin.

    [0061] 100 μL of a DNA/RNA extraction solution 2-mix was added to each tube by sucking up after through mixing, and the tube was shaken for 10 seconds for through mixing, and left to stand for 10 minutes at room temperature.

    [0062] After the short spin, the centrifuge tubes were placed on a separator, and the solution was sucked out slowly after 3 minutes (pay attention not to touch the brown substance adhered to the tube wall).

    [0063] 600 μL of a DNA/RNA extraction solution 3 and 200 μL of a DNA/RNA extraction solution 4 were added to each tube, and the tube was shaken for 5 seconds for through mixing and subjected to a short spin, and then the centrifuge tube was placed on the separator again.

    [0064] After about 3 minutes, the supernatant separated into two layers. A pipette tip was inserted into the bottom of the centrifuge tube, the liquid was slowly sucked up from the bottom and completely discarded. The tube was left to stand for 1 minute and then the residual liquid at the bottom of the tube was completely sucked up and discarded.

    Example 3

    [0065] PCR Reaction

    [0066] 50 μL of PCR-mix (Mg.sup.2+, dNTPs, MMLV, Taq enzyme, primer, PCR buffer solution) was added to each tube. The PCR-mix was sucked up with a pipette tip to elute the brown residue adhered to the wall of the centrifuge tube. The operation was repeated several times to elute the residue as completely as possible, and then all the eluted brown mixture was transferred to a 0.2-mL PCR reaction tube, and the tube was covered with a cap and transferred to an amplification test region.

    [0067] The following analysis was carried out by using a Hongshi SLAN-96P full-automatic medical PCR analysis system.

    [0068] A fluorescent PCR reaction system was as shown in Table 2. A PCR amplification procedure was as shown in Table 3.

    TABLE-US-00002 TABLE 2 PCR reaction system Volume/concentration Component in each reaction Mg.sup.2+ 4 mM dNTPs (100 mM) 0.25 mM MMLV(10 U/μL) 10U Taq enzyme 5 U/μL) 5U SEQ ID NOs: 1-16 100 nM SEQ ID NOs: 16-32 50 nM PCR buffer solution (1.5x) Up to 50 μL

    TABLE-US-00003 TABLE 3 PCR amplification procedure Number Step Temperature Time of cycles Reverse transcription 50° C. 30 min 1 Pre-denaturation 94° C. 5 min 1 Denaturation 94° C. 15 s 45 Annealing 60° C. 30 s Melting curve analysis 50° C. to 95° C. Fluorescence 1 is collected once with every rise of 0.5° C.

    Example 4

    [0069] A positive plasmid of each target was used as a template to simulate a clinical sample. Multiple PCR tests were carried out on a Hongshi fluorescent quantitative PCR instrument.

    [0070] Based on the technical principle of generation of fluorescence signals through hybridization of products after amplification of fluorescent primers, a target was detected by adopting a melting curve method. Whether there was a characteristic peak at Tm was used as a criterion for determining negative and positive test results. If there was a characteristic peak at a specific Tm temperature, the test result was positive; if not, the test result was negative.

    [0071] In the exemplary example, exemplarily, the first temperature may be roughly set to 67° C.±1° C.; the second temperature may be roughly set to 71° C.±1° C.; the third temperature may be roughly set to 75° C.±1° C.; the fourth temperature may be roughly set to 81° C.±1° C. Exemplarily, melting curve peaks of the targets HI, ECO, HHV6 and WNV may be set to the first temperature, i.e., 67° C.±1° C.; melting curve peaks of the targets SP, JEV, VZV and HSV1 may be set to the second temperature, i.e., 71° C.±1° C.; melting curve peaks of the targets NM, EV, NVD and HSV2 may be set to the third temperature, i.e., 75° C.±1° C.; melting curve peaks of the targets LM, POWV and CN may be set to the fourth temperature, i.e., 81° C.±1° C.; and a melting curve peak of the internal standard IC may be set to the fourth temperature.

    [0072] Target detection signals were FAM, HEX, ROX and CY5. Results were as shown in FIG. 2 to FIG. 5.

    [0073] Result Analysis

    [0074] A. FAM channel (refer to FIG. 2):

    [0075] A melting curve peak appeared at the temperature of about 67° C., which confirmed the presence of the pathogen Haemophilus influenzae (HI).

    [0076] A melting curve peak appeared at the temperature of about 71.5° C., which confirmed the presence of the pathogen Streptococcus pneumoniae (SP).

    [0077] A melting curve peak appeared at the temperature of about 76.5° C., which confirmed the presence of the pathogen Neisseria meningitidis (NM).

    [0078] A melting curve peak appeared at the temperature of about 82° C., which confirmed the presence of the pathogen Listeria monocytogenes (LM).

    [0079] B. HEX channel (refer to FIG. 3):

    [0080] A melting curve peak appeared at the temperature of about 67.1° C., which confirmed the presence of the pathogen Escherichia coli (ECO).

    [0081] A melting curve peak appeared at the temperature of about 71.8° C., which confirmed the presence of the pathogen Japanese encephalitis virus (JEV).

    [0082] A melting curve peak appeared at the temperature of about 76.3° C., which confirmed the presence of the pathogen enterovirus (EV).

    [0083] A melting curve peak appeared at the temperature of about 81.5° C., which confirmed that the internal standard was positive.

    [0084] C. ROX channel (refer to FIG. 4):

    [0085] A melting curve peak appeared at the temperature of about 64.9° C., which confirmed the presence of the pathogen human herpesvirus 6 (HHV6).

    [0086] A melting curve peak appeared at the temperature of about 71.9° C., which confirmed the presence of the pathogen varicella-zoster virus (VZV).

    [0087] A melting curve peak appeared at the temperature of about 76.2° C., which confirmed the presence of the pathogen Nipah virus (NVD).

    [0088] A melting curve peak appeared at the temperature of about 82.2° C., which confirmed the presence of the pathogen Powassan virus (POWV).

    [0089] D. CY5 channel (refer to FIG. 5):

    [0090] A melting curve peak appeared at the temperature of about 63.9° C., which confirmed the presence of the pathogen West Nile virus (WNV).

    [0091] A melting curve peak appeared at the temperature of about 71.1° C., which confirmed the presence of the pathogen Herpes simplex virus type 1 (HSV-1).

    [0092] A melting curve peak appeared at the temperature of about 76.1° C., which confirmed the presence of the pathogen Herpes simplex virus type 2 (HSV-2).

    [0093] A melting curve peak appeared at the temperature of about 80.8° C., which confirmed the presence of the pathogen Cryptococcus neoformans (CN).

    [0094] Although the present invention has been described in detail with reference to examples of the present invention, these examples are provided for describing, instead of limiting the present invention. Other examples that can be obtained according to the principle of the present invention still belong to the scope defined by the claims of the present invention.

    Reference to an Electronic Sequence Listing

    [0095] The contents of the electronic sequence listing (CU700SequenceListing.xml; Size: 35,412 bytes; and Date of Creation: Sep. 2, 2022) is herein incorporated by reference in its entirety.