MODIFIED KLENOW FRAGMENT AND APPLICATION THEREOF
20220411767 · 2022-12-29
Inventors
- Qingbin CHEN (Luohu District, Shenzhen, Guangdong, CN)
- Weiyue CHEN (Luohu District, Shenzhen, Guangdong, CN)
- Hongdan LI (Luohu District, Shenzhen, Guangdong, CN)
- Xia LIN (Luohu District, Shenzhen, Guangdong, CN)
- Wen WANG (Luohu District, Shenzhen, Guangdong, CN)
- Weiwei LUO (Luohu District, Shenzhen, Guangdong, CN)
- Lei SUN (Luohu District, Shenzhen, Guangdong, CN)
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P19/34
CHEMISTRY; METALLURGY
C12N9/1252
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are a modified Klenow fragment and an application thereof; specifically provided is a modified Klenow fragment, wherein at least one position or functionally equivalent position among F762, A842, I709 and P603 in the amino acid sequence of the modified Klenow fragment contains at least one amino acid substitution mutation. The modified Klenow fragment has higher DNA polymerase activity than a wild-type Klenow fragment and can be applied to sequencing.
Claims
1. An modified Klenow fragment having an amino acid sequence comprising at least one amino acid substitution mutation at at least one of positions F762, A842, I709 and P603, or at a functionally equivalent position thereto.
2. The modified Klenow fragment according to claim 1, wherein the amino acid substitution mutation is selected from at least one of the substitution mutations functionally equivalent to F762Y, A842K, A842H, A842R, I709K, I709H, I709R and P603K.
3. The modified Klenow fragment according to claim 2, wherein the modified Klenow fragment has an amino acid sequence comprising a substitution mutation functionally equivalent to F762Y; or substitution mutations functionally equivalent to F762Y and A842K; or a substitution mutation functionally equivalent to P603K; or substitution mutations functionally equivalent to F762Y, A842K and P603K.
4.-6. (canceled)
7. The modified Klenow fragment according to claim 2, wherein the modified Klenow fragment has an amino acid sequence comprising a substitution mutation functionally equivalent to A842K or A842H or A842R.
8. The modified Klenow fragment according to claim 2, wherein the modified Klenow fragment has an amino acid sequence comprising a substitution mutation functionally equivalent to I709K or I709H or I709R; or substitution mutations functionally equivalent to A842K and I709K; or substitution mutations functionally equivalent to F762Y, A842K and I709K; or substitution mutations functionally equivalent to F762Y and I709K.
9.-11. (canceled)
12. The modified Klenow fragment according to claim 1, wherein at least one end of the amino acid sequence of the modified Klenow fragment has a known sequence that is less than 12 amino acids in length.
13. The modified Klenow fragment according to claim 12, wherein the known sequence is located at the N-terminus of the amino acid sequence of the modified Klenow fragment.
14. The modified Klenow fragment according to claim 13, wherein the known sequence comprises 6-10 histidine residues.
15. The modified Klenow fragment according to claim 13, wherein the known sequence is selected from at least one of GSSHHHHHHSSG (SEQ ID NO:1) and HHHHHHHHHH (SEQ ID NO:7).
16.-19. (canceled)
20. A method for incorporating nucleotides into DNA, comprising interaction among (a) the modified Klenow fragment according to claim 1 or a mixture of modified Klenow fragments, (b) DNA and (c) a nucleotide solution.
21. (canceled)
22. The method according to claim 20, wherein (c) the nucleotide solution contains Mg.sup.2+, or Mn.sup.2+, or Mg.sup.2+ and Mn.sup.2+.
23. The method according to claim 22, wherein (a) the modified Klenow fragment comprises a substitution mutation functionally equivalent to A842K or A842H or A842R, or a substitution mutation functionally equivalent to I709K or I709H or I709R, or substitution mutations functionally equivalent to A842K and I709K, or substitution mutations functionally equivalent to F762Y, A842K and I709K, or substitution mutations functionally equivalent to F762Y and I709K, and (c) the nucleotide solution contains Mg.sup.2+ at a concentration of 5-10 mM but no Mn.sup.2+.
24. The method according to claim 22, wherein (a) the modified Klenow fragment comprises a substitution mutation functionally equivalent to F762Y, or substitution mutations functionally equivalent to F762Y and A842K, or a substitution mutation functionally equivalent to P603K, or substitution mutations functionally equivalent to F762Y, A842K and P603K, or a substitution mutation functionally equivalent to A842K or A842H or A842R, and (c) the nucleotide solution contains Mn.sup.2+ at a concentration of 0.1-5 mM but no Mg.sup.2+.
25. The method according to claim 22, wherein (a) an modified Klenow fragment having an amino acid sequence comprising substitution mutations functionally equivalent to A842K and I709K is involved, and (c) the nucleotide solution contains Mg.sup.2+ and Mn.sup.2+, wherein the Mg.sup.2+ has a concentration of 5-10 mM, and the Mn.sup.2+ has a concentration of 0.1-5 mM.
26. A kit for incorporating nucleotides into DNA, comprising at least one of the modified Klenow fragments according to claim 1.
27. The kit according to claim 26, wherein the kit further comprises a nucleotide solution.
28. The kit according to claim 27, wherein the nucleotide solution contains nucleotides labeled with a fluorescent molecule.
29. The kit according to claim 26, further comprising a nucleotide solution, wherein the modified Klenow fragment comprises a substitution mutation functionally equivalent to A842K or A842H or A842R, or a substitution mutation functionally equivalent to I709K or I709H or I709R, or substitution mutations functionally equivalent to A842K and I709K, or substitution mutations functionally equivalent to F762Y, A842K and I709K, or substitution mutations functionally equivalent to F762Y and I709K; and wherein the nucleotide solution contains Mg.sup.2+ at a concentration of 5-10 mM but no Mg.sup.2+.
30. The kit according to claim 26, further comprising a nucleotide solution, wherein the modified Klenow fragment comprises a substitution mutation functionally equivalent to F762Y, or substitution mutations functionally equivalent to F762Y and A842K, or a substitution mutation functionally equivalent to P603K, or substitution mutations functionally equivalent to F762Y, A842K and P603K, or a substitution mutation functionally equivalent to A842K or A842H or A842R; and wherein the nucleotide solution contains Mn.sup.2+ at a concentration of 0.1-5 mM but no Mg.sup.2+.
31. The kit according to claim 26, further comprising a nucleotide solution, wherein the modified Klenow fragment has an amino acid sequence comprising substitution mutations functionally equivalent to A842K and I709K, and wherein the nucleotide solution contains Mg.sup.2+ at a concentration of 5-10 mM and Mn.sup.2+ at a concentration of 0.1-5 mM.
32. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
DETAILED DESCRIPTION
[0078] The present application is described below with reference to the specific examples and drawings. It is to be noted that these examples are intended to be illustrative only and are not to be construed as limiting the present application. The examples without a specified particular technique or condition are performed in accordance with techniques or conditions described in literatures in the art or in accordance with the product specification. The reagents or instruments not provided with manufacturer are conventional and commercially available products.
[0079] In the specification, terms such as “one embodiment”, “some embodiments”, “one or some specific embodiments”, “one or some examples”, “exemplary” or the like, means that a particular feature, structure, material or characteristic described in reference to the embodiment or example is included in at least one embodiment or example of the present application. In the specification, the schematic description of the aforementioned terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, materials, structures and other characteristics described may be combined in any one or more embodiments or examples in an appropriate manner. Moreover, various embodiments or examples and features of various embodiments or examples described in this specification can be combined by one skilled in the art to the extent that they do not contradict each other.
1. Preparation of Recombinant Bacteria
[0080] 324-928aa of DNA polymerase I (UniPRotKB: P00582) is an amino acid fragment corresponding to the Klenow enzyme. The modified Klenow fragment in this example is one in which the N-terminus of the amino acid fragment of the Klenow enzyme has 1 tag sequence and a methionine, that is, the modified Klenow fragment is: methionine-tag sequence-amino acids at positions 324-928 of DNA polymerase I. The tag sequence consists of 12 amino acids: glycine-2 serines-6 histidines-2 serines-glycine (GSSHHHHHHSSG) (SEQ ID NO: 1), and corresponds to the nucleotide sequence: GGCAGCAGCCACCACCACCACCACCACAGCAGCGGT (SEQ ID NO: 2). Methionine corresponds to nucleotides ATG. The nucleotide sequence of the wild-type Klenow fragment in this example is identical to the nucleotide sequence corresponding to amino acids 324-928 of DNA polymerase I (UniPRotKB: P00582).
[0081] A gene encoding the modified Klenow fragment was synthesized, and the DNA fragment between the recognition sequences NcoI and XhoI of pET-28a (Novagen) was replaced with the modified Klenow fragment to obtain a recombinant vector, which was named V-PR. V-PR was introduced into E. coli BL21(DE3) (Tiangen Biotech (Beijing) Co., Ltd) to obtain a recombinant bacterium, which was named BL21-V-PR. BL21-V-PR expresses the modified Klenow fragment PR.
[0082] When the Klenow-encoding gene has no mutation, the Klenow fragment expressed by BL21-V-PR is PR0.
[0083] Nucleotide sequences comprising mutations in the Klenow-encoding gene region were synthesized. The modified Klenow fragments expressed by these codes are PR1, PR2, PR3, PR4, PR5, PR6, PR7, PR8 and PR9. The mutation sites and types in the modified Klenow fragments are shown in Table 1 below:
TABLE-US-00001 TABLE 1 Mutation site Mutation site modified corresponding to corresponding to Type of Klenow the site of DNA the site of Type of nucleotide fragment polymerase I fusion unit PR0 mutation mutation PR0 None None None None PR1 762 452 F762Y TTC-TAT PR2 842 532 A842K GCG-AAA PR3 709 399 I709K ATC-AAA PR4 603 293 P603K CCG-AAA PR5 762, 842 452, 532 F762Y, A842K TTC-TAT, GCG-AAA PR6 762, 842, 603 452, 532, 293 F762Y, A842K, TTC-TAT, CG-AAA, P603K CCG-AAA PR7 842, 709 532, 399 A842K, I709K GCG-AAA, TC-AAA PR8 762, 709 452, 399 F762Y, I709K TTC-TAT, ATC-AAA PR9 762, 842, 709 452, 532, 399 F762Y, A842K, TTC-TAT, CG-AAA, I709K ATC-AAA
2. Preparation of Klenow Fragment PR
2.1 Induction of Expression
[0084] The recombinant bacteria BL21-V-PR obtained in step 1 were inoculated into 5 mL of a Kan-LB medium (a liquid medium with 50 μg/mL kanamycin obtained by adding kanamycin to an LB medium) for culture at 37° C. and 220 rpm overnight; the resulting bacteria solution was inoculated into 30 mL of Kan-LB medium in a volume ratio of 1:50 for culture at 37° C. and 220 rpm for 4 h; the resulting bacteria solution was inoculated into 250 mL of Kan-LB medium in a volume ratio of 1:50 for culture at 37° C. and 220 rpm for 4 h. When OD600 reached about 0.6, IPTG (isopropyl β-D-thiogalactopyranoside) was added to the cultured bacterial solution until its final concentration was 0.5 mM. The resulting bacteria solution was cultured at 30° C. and 220 rpm overnight (about 16 h), and centrifuged at 8000 rpm for 10 min to collect BL21-V-PR bacteria. Meanwhile, a blank control with no IPTG added was set up so as to collect uninduced BL21-V-PR bacteria.
2.2 Disruption and Purification of Bacteria
[0085] BL21-V-PR bacteria of step 2.1 were resuspended in an affinity solution (50 mM Tris, 200 mM NaCl, 5% Glycerol, pH 7.5) in a bacteria-affinity solution ratio of 1 g:20 mL to obtain bacteria suspension 1, to which were then added phenylmethylsulfonyl fluoride, Triton X-100 and lysozyme to obtain bacteria suspension 2, with the final concentrations of phenylmethylsulfonyl fluoride, Triton X-100 and lysozyme being 0.25 mM, 0.5% (volume concentration) and 2.5 mg/100 mL, respectively. Bacteria suspension 2 was incubated at room temperature for 30 min, treated by sonication (40% power (about 400 W), 2 s of treatment followed by 2 s of resting, for a total of 30 min), and centrifuged at 12000 rpm and 4° C. for 30 min. The supernatant was collected.
[0086] The supernatant was filtered with a 0.45 μm syringe filter (Life Sciences) and then subjected to affinity chromatography (pre-packed column HisTrap HP, 5 mL, 17-5248-02, GE healthcare) on a Ni column, in which after the supernatant was loaded, the column was equilibrated with 10 CV of affinity buffer 1 (50 mM Tris, 200 mM NaCl, 10 mM imidazole, 5% Glycerol, PH 7.4), and eluted with 5 CV of 3% affinity buffer 2 (50 mM Tris, 1M NaCl, 500 mM imidazole, 5% Glycerol, PH 7.4) and then with 5 CV of 50% affinity buffer 2. Eluent corresponding to peaks greater than and equal to 100 mAU was collected.
[0087] The eluent corresponding to peaks greater than and equal to 100 mAU was dialyzed against ion buffer 1 (25 mM Tris, 50 mM NaCl, 5% Glycerol, PH 7.4) overnight. The dialyzed solution was subjected to cation exchange chromatography (pre-packed column HiTrap SP HP, 5 mL, 17-1152-01, GE healthcare), in which after the solution was loaded, the column was equilibrated with 10 CV of ion buffer 1, and eluted with 5 CV of 3% ion buffer 2 (50 mM Tris, 1M NaCl, 5% Glycerol, PH 7.40) and then with 5 CV of 50% ion buffer 2. Eluent corresponding to peaks greater than and equal to 100 mAU was collected, dialyzed against a dialysate (20 mM Tris, 200 mM KCl, 0.2 mM EDTA, 5% Glycerol) with a dialysis bag (spectrumlabs, 131267) for 24 h, and brought to 0.5 mg/mL with 50% glycerol contained. A purified Klenow fragment PR solution was thus obtained. The obtained Klenow fragment PRs were PR0, PR1, PR2, PR3, PR5, PR6, PR7, PR8 and PR9.
3. PR Protein Assay
(1) SDS-PAGE Electrophoresis
[0088] 20 μL of 1 mg/mL Klenow fragment PR obtained by step 2 was well mixed with 20 μL of a loading buffer (Sangon Biotech (Shanghai) Co., Ltd, C508321-0205) to obtain liquid 1; 10 μL of 0.05 mg/mL Klenow fragment PR obtained by step 2 was well mixed with 10 μL of the loading buffer to obtain liquid 2. 10 μL of each of liquid 1 and liquid 2 were subjected to SDS-PAGE electrophoresis, and the results are shown in
(2) Endonuclease Activity Assay
[0089] The modified Klenow fragment PR obtained by step 2 was assayed for endonuclease activity using the reaction system of Table 2:
TABLE-US-00002 TABLE 2 Reagent Required amount pUC19 500 ng Modified Klenow fragment PR 25 μL Reaction buffer 1 5 μL Making up to 50 μL with water
[0090] Reaction buffer 1: 10 mM Tris, 10 mM KCl, 1 mM MgSO.sub.4, pH 7.4.
[0091] The reaction system of Table 2 was incubated at 37° C. for 4 h, and then quenched with 1 μL of 0.5 M EDTA. The reaction product was purified using Gel Extraction Kit (omega bio-tek). The modified Klenow fragment PR was replaced with water as a negative control (NC). 1% agarose gel electrophoresis was then carried out. The pUC19 plasmid major band showed that pUC19 plasmids were not degraded, and the band is consistent with that of the gel electropherogram of the negative control, showing that the modified Klenow fragment PR was not polluted by endonuclease. All of PR0, PR1, PR2, PR3, PR4, PR5, PR6, PR7, PR8 and PR9 were not polluted by endonuclease. Their results are shown in
(3) DNase Activity Assay
[0092] The DNase activity was assayed using the kit from Thermo Fisher Scientific under Cat. #AM1970M.
[0093] Experimental procedures: DNase Alert Substrate was resuspended in 1 mL of TE buffer (Thermo Fisher Scientific, Cat. #AM1970M), and the complete dissolution of the substrate was ensured. The resuspended DNase Alert Substrate was added to a 384-well plate at 5 μL per well. 40 μL of the modified Klenow fragment PR enzyme obtained by step 2 was added to the wells, and the mixture was well mixed. A negative control and a positive control were set up. The negative control was a solution obtained by replacing the modified Klenow fragment PR1 enzyme solution with equal volume of nuclease-free water. The positive control was obtained as follows: 10× Nuclease Alert Buffer (invitrogen) was 10-fold diluted with nuclease-free water to obtain 1× solution, which was used to 5-fold dilute the standard DNase I (Thermo Fisher Scientific, Cat. #AM1970M); 2.5 μL of the resulting dilution was added into positive control wells, followed by 37.5 μL of nuclease-free water to make up the system, which was well mixed by shaking.
[0094] After incubation at 37° C. for 10 min, detection was performed with a Gen5 microplate reader. The Dnase activity of the modified Klenow fragment PR was calculated to be 0.002 U/μL according to the detected fluorescence value, indicating no DNASE activity. The Dnase activities of PR1, PR2, PR3, PR4, PR5, PR6, PR7, PR8 and PR9 are 0.001 U/μL, 0.001 U/μL, 0.001 U/μL, 0.001 U/μL 0.002 U/μL, 0.002 U/μL, 0.001 U/μL, 0.001 U/μL and 0.002 U/μL, respectively.
4. DNA Polymerase Activity Assay of Modified Klenow Fragment PR Using dNTP as Substrate
[0095] 20 μL of the modified Klenow fragment PR (0.5 mg/mL) obtained by step 2 was serially diluted 8-fold, 16-fold, 30-fold, 64-fold and 128-fold with an enzyme dilution buffer (20 mM pH 7.4 Tris and 100 mM KCl in a solvent of water) in a 96-well round bottom plate to finally obtain a 128-fold dilution of the modified Klenow fragment PR, which was then subjected to reaction in a reaction system of Table 3.
TABLE-US-00003 TABLE 3 Components Volume annealed mixture 2.5 μL 10 mM dNTP 1.25 μL 128-fold dilution of the modified Klenow 3 μL fragment PR Reaction buffer 2 12.5 μL H.sub.2O 5.75 μL
[0096] Reaction buffer 2: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl.sub.2, and 100 μg/mL BSA, pH 7.9, at 25° C. The components of the annealed texture in Table 3 and their proportions are shown in Table 4:
TABLE-US-00004 TABLE 4 Components Volume 30 μM template 2.5 μL 30 μM primer 2.5 μL 2 × reaction buffer 12.5 μL H.sub.2O 7.5 μL
[0097] H.sub.2O was used as a negative control, and the experiment was conducted in triplicate. The reaction system was incubated in a PCR amplifier at 37° C. for 30 min, then rapidly placed on ice, and quenched with 1 μL of 50 mM EDTA. The following were used: 2× reaction buffer: 10 mM Tris, 50 mM NaCl, pH 7.4; template: ATCTGAGGACACGGCCGTGTATTACTGTGCGAAGAGCATTGCTGCATCCAGTTTGCAAAGT (SEQ ID NO: 3); and primer: TAGACTCCTGT (SEQ ID NO: 4).
[0098] After the reaction was completed, 2 μL of reaction mixture was added to a 96-well plate with 38 μL of LTE buffer added in advance, and the resulting mixture was pipetted to be well mixed. 10 μL of the mixture was then added to a black flat-bottom 96-well plate with 40 μL of LTE buffer added in advance. 500 ng/mL λDNA was serially diluted in other wells of the 96-well plate by the 2-fold method, and 50 μL of the dilution of each dilution gradient was used as a standard and added to a new well. After Picogreen (Thermo Fisher Scientific) dye was 200-fold diluted with TE buffer, and then 50 μL of the dilution was added into the sample wells. The resulting mixture was well mixed, and left standing in the dark at room temperature for 2 min. Fluorescence was detected under the conditions of 480 nm excitation light and 520 nm emission light. The amount of polymerized dNTP for the 128-fold diluted enzyme solution of PR0 was measured to be 0.21 nmol, and the amount of polymerized dNTP for PR1, PR2, PR3, BG8, PR5, PR6, PR7, PR8 and PR9 was 0.34 nmol, 0.22 nmol, 0.35 nmol, 0.26 nmol, 0.27 nmol, 0.28 nmol, 0.3 nmol, 0.28 nmol and 0.35 nmol, respectively. DNA polymerase activity ratio=ratio of the amount of polymerized dNTP detected, and the specific calculation results are shown in table 5:
TABLE-US-00005 TABLE 5 DNA polymerase activity ratio PR1/PR0 1.62 PR2/PR0 1.05 PR3/PR0 1.67 PR4/PR0 1.24 PR5/PR0 1.29 PR6/PR0 1.33 PR7/PR0 1.43 PR8/PR0 1.33 PR9/PR0 1.67
[0099] The calculation results show that the polymerase activity of other PR mutants is improved compared to that of PR0.
5. Detection of Sequencing Effect
[0100] A synthesized known sequence was sequenced as a template using PR1, PR2, PR3, BG8, PR5, PR6, PR7, PR8, PR9 on a GenoCare™ sequencing platform. The control enzymes were the Klenow fragments of NEB™ (Cat. #M0407B) and Vazyme™ (N105-C1). The Genocare™ platform can be built by reference to the disclosure of CN201610209150.2, CN201710607295.2, and the sequencing can be performed by reference to the sequencing process in the article https://doi.org/10.1371/journal.pone.0188181 (Single molecule sequencing of the M13 virus genome without amplification). The synthesized known sequence is 5′-TATTGATTCTCAAACTTACTCAAAATTAATTTTTAAATAACATTCTAACAAAATACCTCACTGGG TGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTA-3′ (SEQ ID NO: 5). The flowcell probe used for sequencing in this example is 5′-TACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAG-3′ (SEQ ID NO: 6), with the 5′ end immobilized on the flowcell and linked to FAM fluorescence.
[0101] The sequencing was performed as follows:
[0102] 1) the template was hybridized with the flowcell probe;
[0103] 2) the fluorescence-labeled dNTP and Klenow enzyme were added into the flowcell, wherein the dNTP was stored in a buffer I to form a nucleotide solution, wherein the buffer I consists of 20 mM Tris-HCl, pH 8.8, 10 mM MgSO.sub.4, 10 mM (NH.sub.4).sub.2SO.sub.4, 10 mM HCl, and 0.1% Triton X-100; 100U of the Klenow fragment was added into the flowcell; and
[0104] 3) the sequencing was performed at 37° C.
[0105] To exclude the effect of the flowcell on the experimental results, sequencing assays were performed using the Klenow enzyme and the control enzyme of this example on the same flowcell.
[0106] The experimental results are as follows:
[0107] The sequencing capacity of the modified Klenow fragment was analyzed by comparing the sequencing results with those of the Klenow fragments of NEB™ and Vazyme™.
[0108] In this example, each enzyme was subjected to multiple (three or more) parallel sequencings, and the average read length herein refers to the arithmetic average value of the sequencing read lengths obtained after the corresponding enzyme was subjected to multiple parallel sequencings.
[0109] For example, in the sequencing experiment of PR1, PR1 was subjected to 3 parallel sequencings and an average read length of the 3 sequencings was calculated. Similarly, the Klenow fragments of PR1-Mn.sup.2+ and NEB™ were each subjected to 3 parallel sequencings and an average read length for each enzyme was calculated. The curves in
PR1:
[0110] PR1 shows better sequencing effect in a Mn.sup.2+-containing solution than in a Mg.sup.2+-containing solution, PR1 shows better sequencing effect in a Mn.sup.2+-containing solution than the Klenow fragments of NEB™ and Vazyme™, with the average read length being 1.17 times and 1.36 times that obtained using the latter two enzymes, respectively. The specific sequencing results are shown in
PR2:
[0111] PR2 shows better sequencing effect in a Mn.sup.2+-containing buffer than the Klenow fragments of NEB™ and Vazyme™, with the sequencing average read length being 1.03 times and 1.04 times that obtained using the latter two enzymes, and PR2 shows better sequencing effect in a Mn.sup.2+-containing buffer than in a Mg.sup.2+-containing buffer. The specific sequencing results are shown in
PR3:
[0112] Sequencing results of PR3: sequencing was performed using PR3 in a Mn.sup.2+-containing sequencing buffer, and the results show that the sequencing read lengths extensively stagnates at short fragments; sequencing was performed using PR3 in buffer I, and the results show that the average read length obtained is comparable to that obtained using the Klenow fragment of NEB™, with the former being 1.01 times the latter. In addition, PR3 was found to be effective in reducing the BRR in the sequencing results, which is 0.65 times that in the sequencing results of the Klenow fragment of NEB™. The specific sequencing results are shown in
PR4:
[0113] The sequencing results of PR4 were compared with those of the Klenow fragment of Vazyme™, showing that the average read length obtained using PR4 in sequencing in buffer I stagnates at short fragments; the average read length obtained using PR4 in sequencing in a Mn.sup.2+-containing buffer and the BRR in the sequencing results are comparable to those obtained using the Klenow fragment of Vazyme™. The average read length obtained using PR4 in sequencing in a Mn.sup.2+-containing buffer is 1.07 times that obtained using the Klenow fragment of Vazyme™. The specific sequencing results are shown in
PR5:
[0114] The sequencing results obtained using PR5 in sequencing in a Mn.sup.2+-containing buffer were compared with those obtained using PR1 and the Klenow fragment of Vazyme™, showing that the BRR in the sequencing results of PR5 is lower than those of PR1 and the Klenow fragment of Vazyme™, and the average read length obtained using PR5 is comparable to that obtained using the Klenow fragment of Vazyme™. The specific sequencing results are shown in Table 6 and
TABLE-US-00006 TABLE 6 PR5-Mn.sup.2+/PR1 PR5-Mn.sup.2+/Vazyme ™ BRR 0.78 0.96 Average length 0.96 1
PR6:
[0115] The sequencing results of PR6 were compared with those of the Klenow fragment of Vazyme™, showing that the average read length obtained using PR6 in sequencing in buffer I stagnates at short fragments; the average read length obtained using PR6 in sequencing in a Mn.sup.2+-containing buffer is comparable to that obtained using the Klenow fragment of Vazyme™, and the BRR in the sequencing results of PR6 is 0.82 times that of the Klenow fragment of Vazyme™. The specific sequencing results are shown in Table 7 and
TABLE-US-00007 TABLE 7 PR6/Vazyme ™ PR6-Mn.sup.2+/Vazyme ™ BRR 0.99 0.82 Average 0.67 1.04 length
PR7:
[0116] The results of several batches of experiments with PR7 and PR3 were compared and analyzed, and the sequencing results of PR7 and the Klenow fragment of Vazyme™ were compared. When the sequencing buffer is buffer I, the sequencing average read length in the sequencing results of PR7 is 1.15 times that obtained using the Klenow fragment of Vazyme™, and is shorter than that in the sequencing results of PR3; the BRR in the sequencing results of PR7 is lower than those of the Klenow fragment of Vazyme™ and PR3. Under conditions of different buffers, PR7 has different amplification capacities, with the best amplification capacity in the presence of Mg.sup.2+, and the sequencing read lengths in the sequencing results stagnate at short fragments in the presence of Mn.sup.2+ and the absence of Mg.sup.2+; besides, amplification can be effectively performed using PR7 in the simultaneous presence of Mn.sup.2+ and Mg.sup.2+, with the average read length obtained by sequencing being 1.12 times that obtained using the Klenow fragment of Vazyme™. The specific sequencing results are shown in Table 8 and
TABLE-US-00008 TABLE 8 PR7/ PR7/ PR7-Mn/ PR7-Mn—Mg/ Vazyme ™ PR3 Vazyme ™ Vazyme ™ BRR 0.44 0.97 0.78 1.18 Average 1.15 0.73 0.89 1.12 length
PR8:
[0117] Sequencing can be effectively performed using PR8 in buffer I, and the average read length in the sequencing results of PR8 is 9.43, which is shorter than that obtained using the Klenow fragment of Vazyme™. In addition, when sequencing is performed using PR8 in a Mn.sup.2+-containing solution, the sequencing read length stagnates at short fragments.
[0118] The specific sequencing results are shown in
PR9:
[0119] When sequencing is performed using PR9 in a Mn.sup.2+-containing solution, the sequencing read lengths stagnate at short fragments; the average read length in the sequencing results of PR9 is 10.59, which is shorter than that obtained using the Klenow fragment of Vazyme™. Sequencing can be effectively performed using PR9 in buffer I. The specific sequencing results are shown in
[0120] Although embodiments of the present application are illustrated and described above, it will be appreciated that the above embodiments are exemplary and not to be construed as limiting the present application, and that changes, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present application.