STRAIN WITH IMPROVED AROMATIC AMINO ACID PRODUCTION CAPACITY BY YEEO GENE INACTIVATION

20220411834 · 2022-12-29

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed is a mutant strain having improved aromatic amino acid production capability due to inactivation or weakening of activity of an FMN/FAD exporter protein which is expressed by yeeO gene.

Claims

1. A mutant strain having improved aromatic amino acid production capability due to inactivation or weakening of activity of an FMN/FAD exporter protein which is expressed by yeeO gene.

2. The mutant strain of claim 1, wherein the yeeO gene consists of the nucleotide sequence of SEQ ID NO: 1.

3. The mutant strain of claim 1, wherein the aromatic amino acid is at least one of L-tryptophan and L-phenylalanine.

4. The mutant strain of claim 1, which is obtained by insertion, substitution or deletion of one or more nucleotides in the nucleotide sequence of the yeeO gene.

5. The mutant strain of claim 1, which is derived from a strain of the genus Escherichia.

6. The mutant strain of claim 5, wherein the strain of the genus Escherichia is Escherichia coli.

7. A method for producing an aromatic amino acid, comprising steps of: culturing the mutant strain of claim 1 in a medium; and recovering an aromatic amino acid from the cultured mutant strain and the medium.

8. The method of claim 7, wherein the aromatic amino acid is at least one of L-tryptophan and L-phenylalanine.

Description

MODE FOR INVENTION

[0028] Hereinafter, one or more specific embodiments will be described in more detail with reference to examples. However, these examples are for illustrating one or more embodiments, and the scope of the present invention is not limited to these examples.

Example 1: Construction of yeeO gene-deleted strains

[0029] yeeO gene-inactivated mutant strains were constructed from parent strains (accession numbers: KFCC11660P and KCCM10016) by a one-step inactivation method (One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko KA, Wanner BL., Proc Natl Acad Sci USA. 2000 Jun 6;97(12):6640-5).

[0030] The KFCC11660P strain and the KCCM10016 strain are Escherichia coli strains. For homologous recombination of the fourth fragment, pKD46 (GenBank accession number AY048746), a Red recombinase plasmid, was introduced into each of the strains, and pKD46 was removed before introduction of pCP20.

[0031] The yeeO gene was deleted by homologous recombination between the yeeO gene and a DNA fragment containing an antibiotic resistance gene, and then the yeeO gene was inactivated by removing the antibiotic resistance gene from the recombined DNA fragment. The specific process is as follows.

[0032] (1) Construction of first fragment

[0033] PCR reaction (total volume: 50 μl) was performed using a pKD13 plasmid (Genbank accession number: AY048744) and a primer pair of yeeO PF and yeeO PR having a portion of the yeeO gene sequence shown in Table 1 below and a portion of the pKD13 plasmid sequence under the following conditions, thus obtaining a first amplified fragment of about 1.4 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 2 min at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. The first fragment contained the kanamycin resistance gene derived from the pKD13 plasmid.

TABLE-US-00001 TABLE 1 SEQ ID NO Sequence yeeO 1 ttgttgaggcacatcttaacggcgaaaaatcttttgtcaaacccgatttttaaattccccaactgtttgccg tttctatcaacagtttgttgcatttgcagacaatttgttggcgaaaatctttgcagctttgctgattctccct cattatttgaaatgtggtttcactttctgcaattaaggtcggctttgaatatctcctctgctttacgccaggt tgttcacggcactcgctggcacgctaaacgcaagagctacaaagtgttgttctggcgcgagataaccc cgcttgctgttcctatcttcatggagaatgcctgtgtcctgttgatgggggttctgagcacttttctggtca gctggctgggaaaagatgcgatggccggcgtgggattggcggacagcttcaatatggtcattatggc tttttttgctgctatcgatcttggtactactgtcgttgtggcatttagtctcggtaagcgggatcgacgac gagcgagggtggcgacgcggcagtcattggtgatcatgacgttgtttgccgtactgttggcaacgctt attcatcattttggcgaacaaattattgatttcgtcgcgggtgatgccacgacagaagttaaagcactgg cgttgacttatctggagctgacggtactcagttatccagcagctgccatcactcttattggtagcggggc acttcgtggtgcagggaatacgaaaataccgctattgattaacggtagcctgaatattcttaatattatta ttagcggcatattgatttacggccttttctcctggccgggactgggatttgtcggggcagggctgggtt taaccatttctcgttatattggcgcagttgcaattttgtgggtgctggcgattggttttaatcctgcgctaa ggatttcgttaaagagctattttaaaccgctgaattttagcattatctgggaagtcatggggattggtatt cccgcgagtgtcgaatcagtgttatttaccagtggtcggttattaacccaaatgttcgttgccgggatgg ggaccagtgttattgccggaaattttatcgcgttttcaattgcggctcttatcaacttacccggaagtgcg ctcggctctgcttctacgatcattacaggccgaaggttgggggtagggcagatagcgcaagcagaga ttcagttgcggcatgtgttctggctttccactcttggattaacggccatcgcctggctaacggctcccttt gccggggttatggcatcgttttacacccaggatccacaggttaaacatgtcgttgtgattctgatttggc taaatgctttatttatgcctatttggtccgcctcatgggtgctacccgctggatttaaaggtgctcgtgat gcccgttacgccatgtgggtttcgatgttgagcatgtggggttgtcgggttgtagtcggttatgtgctg ggaatcatgcttggctggggtgtggttggtgtctggatgggaatgtttgccgactgggctgtgcggg ccgtgctgttttactggcgaatggttactggacgttggctatggaaataccctcgacccgagccgcaaa agtgtgaaaaaaagccagttgtgtcggaataa yeeO_HF1 2 cgtaactatg tctggcgctt yeeO_HR1 3 aaacggcaaa cagttgggga yeeO_PF 4 tccccaactg tttgccgttt gtgtaggctg gagctgcttc yeeO_PR 5 gtttattccg acacaaetgg ctgtcaaaca tgagaattaa yeeO_HF2 6 ccagttgtgt cggaataaac g yeeO_HR2 7 agactcgatt aagcgcacga yeeO_CF 8 cctatgttgc tcttgggctt yeeO_CR 9 aggcaaagtg gcaattacgc

[0034] (2) Construction of Second Fragment

[0035] To obtain an upstream fragment of the yeeO gene, PCR reaction (total volume: 50 μl) was performed using the genomic DNA of E. coli MG1655 as a template and the primers yeeOHF1 and yeeOHR1 shown in Table 1 above under the following conditions, thus obtaining a second amplified fragment of about 0.3 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 30 sec at 72° C., followed by 5 min at 72° C. and 10 min at 12° C.

[0036] (3) Construction of Third Fragment

[0037] To obtain a downstream fragment of the yeeO gene, PCR reaction (total volume: 50 μl) was performed using the genomic DNA of E. coli MG1655 as a template and the primers yeeOHF2 and yeeOHR2 shown in Table 1 above under the following conditions, thus obtaining a third amplified fragment of about 0.3 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 30 sec at 72° C., followed by min at 72° C. and 10 min at 12° C.

[0038] (4) Construction of Fourth Fragment

[0039] The first fragment, second fragment and third fragment amplified in the above experiment could be ligated into a single fragment due to the complementary sequences of the primers during amplification. These fragments were subjected to PCR (total volume: 50 μl) without primers under the following conditions, thus obtaining a fourth amplified single fragment having a size of about 2 kb: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 2 min and 30 sec at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. The fourth fragment contained a portion of the yeeO gene and the kanamycin antibiotic resistance gene. Specifically, it consisted of a portion of the 5′ fragment of the yeeO gene, the kanamycin antibiotic resistance gene, and a portion of the 3′ fragment of the yeeO gene.

[0040] (5) Introduction of Fourth Fragment and Deletion of yeeO

[0041] The obtained fourth fragment was introduced by electroporation into each of the KFCC11660P and KCCM10016 strains, which are Escherichia coli strains containing the Red recombinase plasmid pKD46 (GenBank accession number: AY048746). The fourth fragment was replaced with yeeO by homologous recombination using the Lambda Red recombination system, whereby yeeO was deleted.

[0042] Thereafter, PCR reaction was performed on the cell line showing kanamycin resistance to confirm whether the yeeO gene was deleted. The PCR reaction (total volume: 20 μl) was performed using the yeeO_CF and yeeO_CR primers shown in Table 1 above under the following conditions: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 55° C., and 3 min at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. It was confirmed that, when the original yeeO gene was present, about 2.5 kb (before deletion) was produced, whereas when the fragment was inserted into the chromosome, about 2.2 kb which is a decreased length was produced.

[0043] (6) Antibiotic Resistance Gene Removal and Selection

[0044] To remove the antibiotic resistance marker gene from the strain in which deletion of the yeeO gene was confirmed, FLP recombination was induced by introducing a pCP20 plasmid into the strain. Thereafter, the yeeO -deleted strain was cultured in LB plate medium with or without antibiotics to confirm that the antibiotic resistance marker gene was removed.

Example 2: Culture of yeeO-Deleted Strain and Evaluation of Aromatic Amino Acid Production

[0045] Each of the E. coli strain KFCC11660PΔyeeO obtained by the method of Example 1 and KFCC11660P was cultured in the tryptophan-producing medium shown in Table 2 below.

[0046] In addition, each of the E. coli strain

[0047] KCCM10016PΔyeeO obtained by the method of Example 1 and KCCM10016 was cultured in the phenylalanine-producing medium shown in Table 2 below.

[0048] For culture, 1 vol % of each of the KFCC11660PΔyeeO , KFCC11660P, KCCM10016ΔyeeO , and KCCM10016 strains was inoculated into a flask containing 10 mL of the tryptophan-producing medium or phenylalanine-producing medium having the composition shown in Table 2 below, and cultured with shaking at 200 rpm at 37° C. for 70 hours. Then, the concentrations of L-amino acids obtained from the strains were compared.

TABLE-US-00002 TABLE 2 Tryptophan-producing medium Phenylalanine-producing medium Component Content Component Content Glucose 80.0 g/L Glucose 80.0 g/L (NH.sub.4) .sub.2SO.sub.4 20.0 g/L (NH.sub.4) .sub.2SO.sub.4 20.0 g/L K.sub.2HPO.sub.4 0.8 g/L K.sub.2HPO.sub.4 1.0 g/L K.sub.2SO.sub.4 0.4 g/L KH.sub.2PO.sub.4 1.0 g/L MgCl.sub.2 0.8 g/L K.sub.2SO.sub.4 0.4 g/L Fumaric acid 1.0 g/L MgCl.sub.2 1.0 g/L Yeast extract 1.0 g/L Fumaric acid 0.5 g/L (NH.sub.4) .sub.6Mo.sub.7O.sub.24 0.12 ppm Yeast extract 1.0 g/L H.sub.3BO.sub.3 0.01 ppm Glutamic acid 0.5 g/L CuSO.sub.4 0.01 ppm CaCl.sub.2 5.00 ppm MnCl.sub.2 2.00 ppm MnCl.sub.2 2.00 ppm ZnSO.sub.4 0.01 ppm ZnSO.sub.4 1.00 ppm CoCl.sub.2 0.10 ppm CoCl.sub.2 0.10 ppm FeCl.sub.2 10.00 ppm FeCl.sub.2 10.00 ppm Thiamine_HCl 20.00 ppm Thiamine_HCl 20.00 ppm L-Tyrosine 200.00 ppm L-Tyrosine 200.00 ppm L-phenylalanine 300.00 ppm CaCO.sub.3 3% CaCO.sub.3 3% — —

[0049] As a result of the above experiment, as shown in Tables 3 and 4 below, it was confirmed that the production of tryptophan and phenylalanine increased in the case of the strains in which the yeeO gene was inactivated.

[0050] Referring to Tables 3 and 4 below, it was confirmed that, when the yeeO gene in the KFCC11660P strain was inactivated, the production of L-tryptophan increased by 10% or more, and when the yeeO gene in the KCCM10016 strain was inactivated, the production of L-phenylalanine increased by 15% or more.

TABLE-US-00003 TABLE 3 Strain L-tryptophan (g/L) KFCC11660P 4.18 KFCC11660PΔyeeO 4.65

TABLE-US-00004 TABLE 4 Strain L-phenylalanine (g/L) KCCM10016 3.48 KCCM10016ΔyeeO 4.14