GENE FOR EFFICIENTLY EXPRESSING HYALURONIC ACID HYDROLASE AND EXPRESSION METHOD THEREOF
20240150742 ยท 2024-05-09
Assignee
Inventors
- Hao Wang (Shandong, CN)
- Tianmeng ZHANG (Shandong, CN)
- Rongrong XU (Shandong, CN)
- Youheng ZHANG (Shandong, CN)
- Xueping GUO (Shandong, CN)
- Jingkun HAO (Shandong, CN)
Cpc classification
C12N2523/00
CHEMISTRY; METALLURGY
C12Y302/01035
CHEMISTRY; METALLURGY
C12N9/2474
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is a gene for efficiently expressing hyaluronic acid hydrolase. A nucleotide sequence of the gene is represented by SEQ ID NO: 4. By truncating a segment of a signal peptide sequence at the N-terminus of a full-length hyaluronic acid hydrolase gene, the Pichia pastoris engineering strain of high level expression genetic engineering hyaluronic acid hydrolase is constructed. The enzyme activity of the hyaluronic acid hydrolase in a fermentation broth obtained by high-density fermentation using the constructed Pichia pastoris engineering strain is up to 4.7?10.sup.5 U/mL.
Claims
1. A gene for efficiently expressing hyaluronic acid hydrolase, having a nucleotide sequence as shown in SEQ ID NO.4.
2. A protein encoded by the gene of claim 1, having a sequence as shown in SEQ ID NO.5.
3. A recombinant expression vector, comprising the nucleotide sequence of claim 1.
4. The recombinant expression vector of claim 3, wherein a plasmid backbone is a Pichia pastoris vector of pPIC series, or pGAP series, or pAO815, preferably pPIC9K.
5. A Pichia pastoris, comprising the expression vector of claim 3.
6. A method for producing hyaluronic acid hydrolase, comprising the step of: producing the hyaluronic acid hydrolase by using a recombinant Pichia pastoris strain comprising the gene of claim 1.
7. The method of claim 6, wherein the Pichia pastoris is a strain of GS115, KM71 or SMD1168.
8. The method of claim 6, wherein the method comprises producing the hyaluronic acid hydrolase through fermentation by BMMY medium and methanol induction.
9. The method of claim 8, wherein conditions of the fermentation are as follows: fermentation temperature is 25? C.-30? C., and 0.5%-1% (v/v) methanol is supplemented every 24 hours during fermentation process to induce expression for 96 hours.
10. The method of claim 6, wherein the method comprises producing the hyaluronic acid hydrolase through fermentation by BSM medium and methanol induction.
11. The method of claim 10, wherein the method comprises steps of: inoculating Pichia pastoris into a seed medium to obtain a seed liquid; inoculating the seed liquid into a BSM fermentation medium for fermentation to obtain a fermentation broth containing the hyaluronic acid hydrolase, wherein a fermentation process sequentially comprise four stages: initial fermentation, feeding, starvation culture, and methanol induction.
12. The method of claim 11, wherein conditions of the initial fermentation are as follows: fermentation temperature is 25? C.-30? C., and pH is 5-7.
13. The method of claim 11, wherein a time of the starvation culture is 2-3 hours.
14. The method of claim 11, wherein the methanol induction is performed at a temperature of 25? C.-30? C. for 80-120 hours.
15. The method of claim 11, wherein the method further comprises purifying the fermentation broth.
16. The method of claim 15, wherein the purification is performed by affinity chromatography using nickel column media and gradient elution using 100-500 mM imidazole buffer.
17. Use of the protein of claim 2 in the preparation of hyaluronic acid-containing adjuvants, foods and cosmetics.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION
[0033] The present application will be further described below in conjunction with the examples, and it should be understood that the examples are only used to further illustrate and explain the present application, and are not intended to limit the present application.
[0034] Unless otherwise defined, related technical and scientific terms in the present description have the same meaning as those commonly understood by one of ordinary skill in the art. Although methods and materials similar or identical to those described herein may be used in experiments or practical applications, the materials and methods are described below. In case of conflict, the present description, including definitions therein, shall prevail. In addition, the materials, methods and examples are illustrative and not restrictive. The present application is further described below in conjunction with specific examples, but is not intended to limit the scope of the present application.
[0035] As used herein, the term gene or coding sequence refers to a nucleotide sequence in vitro or in vivo that encodes a gene product. In some instances, the gene consists of or essentially consists of coding sequence, that is, a sequence that encodes the gene product. In other instances, the gene comprises additional, non-coding, sequence. For example, the gene may or may not include regions preceding and following the coding region, e.g., 5 untranslated (5 UTR) or leader sequences and 3 UTR or trailer sequences, as well as intervening sequences (introns) between individual coding segments (exons).
[0036] As used herein, the terms polypeptide, peptide, and protein are used interchangeably herein to mean a polymer of amino acid residues. That is, the description for the polypeptide is also applicable to the peptide and protein, and vice versa. The terms apply to a natural amino acid polymer and an amino acid polymer in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length,
[0037] As used herein, the term polynucleotide or nucleotide means a single-stranded or double-stranded deoxyribonucleotide, deoxyribonucleoside, ribonucleoside or ribonucleotide and polymers thereof. Unless specifically limited, the terms cover nucleic acids containing known analogs of natural nucleotides that have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise limited specifically, the terms also mean oligonucleotide analogs, including PNAs (peptide nucleic acids), DNA analogs used in antisense techniques (phosphorothioate, phosphoramidate, etc.), etc. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conserved modified variants (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences.
[0038] As used herein, the term vector is used to describe a nucleic acid molecule that may be engineered to contain a cloned polynucleotide or polynucleotides that may be amplified in a host cell. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, or no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of the vector is a plasmid, which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as expression vectors. Recombinant expression vectors can comprise a nucleic acid of the present application in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on basis of the host cells to be used for expression, that is operably linked to the nucleic acid sequence to be expressed.
[0039] As used herein, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells by replacing at least one codon of the natural sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the natural amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be especially dependent on the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.
[0040] Codon optimization can be achieved, for example, by transforming nucleotide sequences of one species into the genetic sequence of a different species. Optimal codons help to achieve faster translation rates and high accuracy. As a result of these factors, translational selection is expected to be stronger in highly-expressed genes. However, while optimal codon usage is contemplated herein for expression of disclosed proteins, all possible codons are contemplated for use herein for nucleic acids encoding any disclosed protein.
[0041] As used herein, the term signal peptide means a short peptide (usually 16-30 amino acids) present at the N-terminus of the majority of newly synthesized proteins that are destined to enter the secretory pathway. It may also be referred to as signal sequence, targeting signal, localization signal, localization sequence, transit peptide, leader sequence or leader peptide. The signal peptide is normally cleaved off from the protein by a signal peptidase.
[0042] Specifically, firstly, for the full-length gene sequence of hyaluronic acid hydrolase of odontomachusmonticola, the codon optimization is performed according to the codon preference of Pichia pastoris to obtain a codon-optimized hyaluronic acid hydrolase gene, the sequence of which is shown in SEQ ID NO. 1. The protein sequence encoded by it is shown in SEQ ID NO. 2, which is consistent with the amino acid sequence encoded by the hyaluronic acid hydrolase gene of the wild-type odontomachusmonticola. Further, a segment of a signal peptide sequence (SEQ ID NO.3) is truncated at the N-terminus of the codon-optimized hyaluronic acid hydrolase gene to obtain the gene for highly expressing hyaluronic acid hydrolase of the present application, the sequence of which is shown in SEQ ID NO.4, and the protein sequence encoded by it is shown in SEQ ID NO.5. Removing the nucleotide sequence shown in SEQ ID NO.3 from the N-terminus of the codon-optimized hyaluronic acid hydrolase gene as shown in SEQ ID NO.1 does not cause translation frameshift, hyaluronic acid hydrolase can be expressed and the expression level and/or enzymatic activity of the recombinant hyaluronic acid hydrolase can be significantly improved. The method for truncating the signal peptide at the N-terminus may be any method known in the art.
[0043] The hyaluronic acid hydrolase of odontomachusmonticola belongs to the third type of hyaluronidase which is endo-?-N-acetylglucosaminidase, and can hydrolyze the ?-1,4glycosidic bond of hyaluronic acid to produce the final product having a reducing end of N-acetylglucosamine. In addition, this type of enzyme has a wider substrate spectrum compared with the second type of hyaluronic acid hydrolase of leech, and also has a certain catalytic activity on the structures of chondroitin, chondroitin sulfate and dermatan sulfate. The hyaluronic acid hydrolase of odontomachusmonticola can enrich the types of hyaluronic acid hydrolysates, and may have a wider range of applications than hyaluronidase catalysis.
[0044] Pichia pastoris is a type of yeast in methylotrophic yeast that can utilize methanol as the sole carbon source and energy source. Like other yeasts, it mainly exists in the form of haploid in the asexual growth phase. When the environmental nutrition is limited, two zygotic haploid cells with different physiological types are often induced to mate and fuse into a diploid. Another biological feature of Pichia pastoris is that the alcohol oxidase required for methanol metabolism is sorted into the peroxisome, resulting in regionalization. When glucose is used as carbon source, there are only one or a few small peroxisomes in the thalluses, while when methanol is used as carbon source, peroxisomes account for almost 80% of the entire cell volume, and AOX increases to 35%-40% of total cell protein. Therefore, when the foreign protein gene is inserted by homologous recombination in front of the AOX gene, a large amount of expression can be obtained. At the same time, according to the characteristics of methanol yeast that can form peroxisomes, this system may be used to express some toxic proteins and easily degraded enzymes, and may also be used to study the biogenesis of cell-specific regionalization and its mechanism and function, providing inspiration for similar studies in higher animals.
[0045] As shown in
[0046] The present application also provides a recombinant expression vector comprising the nucleotide sequence of the present application. Further, the backbone of the recombinant expression vector is the Pichia pastoris vector of pPIC series or pGAP series or pAO815, preferably the vector pPIC9K. The Pichia pastoris vector pPIC series includes pPIC9K, pPIC3.5K, pPICZ?A,B,C, pPIC9K-His, pPICZA,B,C, etc, with the alcohol oxidase gene promoter PAOX1 as the promoter. The Pichia pastoris vector of pGAP series includes pGAPZ?A, pGAPZ?B, pGAPZ?C, pGAPZA, pGAPZB, pGAPZC, etc., with the glyceraldehyde-3-phosphate dehydrogenase promoter P.sub.GAP as the promoter. The vector pPIC9K is a Pichia pastoris protein expression vector. The kana resistance gene exists in the pPIC9K vector, which allows the use of kana resistance to screen polyclonal copies in yeast. The rest of the vector is exactly the same as the pPIC9 vector. The host bacteria of Pichia pastoris that may be used with the pPIC9K vector include a strain of KM71, GS115 or SMD1168.
[0047] The present application also provides a Pichia pastoris comprising the above-mentioned expression vector, that is, an expression vector comprising the nucleotide sequence as shown in SEQ ID NO.4.
[0048] The present application also provides a method for expressing the hyaluronic acid hydrolase gene of the present application, comprising the step of: [0049] producing the hyaluronic acid hydrolase by using a recombinant Pichia pastoris strain containing the hyaluronic acid hydrolase gene of the present application or the Pichia pastoris provided by the present application.
[0050] In a specific embodiment, the method comprises producing the hyaluronic acid hydrolase through fermentation by BMMY medium and methanol induction.
[0051] The composition of the BMMY medium is yeast extract 10 g/L, peptone 20 g/L, K.sub.2HPO.sub.4 3 g/L, KH.sub.2PO.sub.4 11.8 g/L, YNB 3.4 g/L, ammonium sulfate 10 g/L, biotin 4?10.sup.?4 g/L, and methanol 10 mL/L.
[0052] In a preferred embodiment, conditions of the fermentation are as follows: the fermentation temperature is 25? C.-30? C., and 0.5%-1% (v/v) methanol is supplemented every 24 hours during fermentation process to induce expression for 96 hours.
[0053] In a more preferred embodiment, the recombinant Pichia pastoris P. pastoris GS115/pPIC9K-?N24HYAL_OM.sup.opt containing the hyaluronic acid hydrolase gene of the present application is used as a production strain to produce the hyaluronic acid hydrolase by fermentation. The specific fermentation conditions are as follows: [0054] P. pastoris GS115/pPIC9K-?N24HYAL_OM.sup.opt is inoculated in 40 mL of YPD medium, cultured at 30? C. for 24 hours, and then the seed culture solution is inoculated into 40 mL of BMGY medium at 10% of the inoculum amount for 24 hours of culture. The thalluses are centrifuged, washed, and transferred to the induction medium BMMY, and 1% (v/v) methanol is supplemented every 24 hours to induce expression for 96 hours.
[0055] The present application also provides another method for expressing the hyaluronic acid hydrolase gene of the present application, comprising the following steps: [0056] Pichia pastoris is inoculated into a seed medium to obtain a seed liquid; [0057] the seed liquid is inoculated into the BSM fermentation medium for fermentation to obtain a fermentation broth containing hyaluronic acid hydrolase, wherein the fermentation process sequentially includes four stages: initial fermentation, feeding, starvation culture, and methanol induction.
[0058] The composition of BSM medium is glycerol 40 g/L, K.sub.2SO.sub.4 18 g/L, KOH 4.13 g/L, 85% H.sub.3PO.sub.4 26.7 mL/L, CaSO.sub.4.Math.2H.sub.2O 0.93 g/L, MgSO.sub.4.Math.7H.sub.2O 14.9 g/L, and filter-sterilized PTM14.4 mL/L. The formula of PTM1 is: CuSO.sub.4.Math.5H.sub.2O 6 g/L, KI 0.09 g/L, MnSO.sub.4.Math.H.sub.2O 3 g/L, H.sub.3BO.sub.3 0.02 g/L, MoNa.sub.2O.sub.4.Math.2H.sub.2O 0.2 g/L, CoCl.sub.2.Math.6H.sub.2O 0.92 g/L, ZnCl.sub.2 20 g/L, FeSO.sub.4.Math.7H.sub.2O 65 g/L, biotin 0.2 g/L, and H.sub.2SO.sub.4 5.0 mL.
[0059] In the first stage of initial fermentation, the fermentation temperature is 25? C.-30? C., and the pH is 5-7. The pH is controlled by automatic addition of ammonia water.
[0060] In the second stage of feeding, after the glycerol in the BSM medium is exhausted, the batch feeding stage is entered, and 50% (v/v) glycerol (containing 12 mL/L PTM1) is supplemented by exponential feeding, while the rotation speed is set to couple with dissolved oxygen DO. In a preferred embodiment, the feeding rate is 13.5 mL/h/L, 16.2 mL/h/L, 19.2 mL/h/L, 22.8 mL/h/L, 27.2 mL/h/L and 32.4 mL/h/L respectively for the first 6 hours, and is set to 30 mL/h/L for the following 6 hours.
[0061] In the third stage of starvation culture, starvation culture is performed for 2-3 hours until the residual glycerol is exhausted, wherein the starvation culture is to study the effect of a single factor on the growth of microorganisms or the production of metabolites, the cells that have been cultured to a certain stage are separated from the medium, and cultured for a certain period of time without the nutrient matrix to exhaust endogenous nutrients accumulated in the cells.
[0062] In the fourth stage of methanol induction, the methanol induction is performed at a temperature of 25? C.-30? C. for 80-120 hours.
[0063] In a preferred embodiment, pure methanol containing 12 mL/L PTM1 is fed with the final concentration maintained at 1.8% (v/v), while the fermentation temperature is adjusted to 25? C., the rotation speed is increased to 1000 rpm, and the feeding rate of the methanol and the final concentration of the methanol in the medium are controlled online in real time by a methanol detector.
[0064] The method of the present application further includes further purifying the above-mentioned fermentation broth.
[0065] In a preferred embodiment, the hyaluronic acid hydrolase protein is purified by affinity chromatography using nickel column media and gradient elution using 100-500 mM imidazole buffer.
[0066] The enzymatic activity characterization of the hyaluronic acid hydrolase produced by fermentation is determined by the plate transparent circle method, and the enzymatic activity of the fermentation broth supernatant is determined by the 3,5-dinitrosalicylic acid method (DNS).
[0067] The definition of activity unit (U) of hyaluronic acid hydrolase is as follows: the amount of enzyme required to release 1 ?g glucose reducing equivalent of reducing sugar from hyaluronic acid sugar chain per hour at pH 5.5 and 38? C.
[0068] DNS reducing sugar assay: the hyaluronic acid hydrolase of odontomachusmonticola hydrolyzes the ?-1,4glycosidic bond of hyaluronic acid to produce a reducing sugar product with a hydroxyl group at the reducing end. The amount of reducing sugar product relative to glucose reducing equivalents produced by hydrolysis of hyaluronic acid is measured by the DNS reducing sugar method, to calculate the catalytic activity of hyaluronic acid hydrolase.
[0069] The present application also provides use of the protein as shown in SEQ ID NO. 5 in the preparation of hyaluronic acid-containing adjuvants, foods and cosmetics.
EXAMPLE
Example 1 Construction of an Expression System Containing Codon-Optimized Hyaluronic Acid Hydrolase Gene (HYAL_OMopt)
[0070] Based on the full-length gene sequence of hyaluronic acid hydrolase of odontomachusmonticola (Genbank: FX985505.1) published in the NCBI database, the codon optimization was carried out according to the codon preference of Pichia pastoris. As shown in
Example 2 Construction of an Expression System Containing the Gene for Highly Expressing Hyaluronic Acid Hydrolase (?N24HYAL_OM.SUP.opt.)
[0071] Using the above-mentioned pPIC9K-HYAL_OM.sup.opt recombinant expression vector as a template, primers were designed. A segment of the signal peptide sequence at the N-terminus of the full-length hyaluronic acid hydrolase gene was truncated to obtain a genetically engineered hyaluronic acid hydrolase gene fragment.
[0072] The primer sequences are as follows:
TABLE-US-00001 UpstreamprimerF: (SEQIDNO.6) 5-CCGGAATTCATGAAGACACTACGCGGCTC-3; DownstreamprimerR: (SEQIDNO.7) 5-ATTTGCGGCCGCTCAATGATGATGATGGTGGT GATGAAGGGTGAACTTCTT-3;
[0073] It should be noted that the GAATTC sequence in the upstream primer is the introduced EcoRI restriction enzyme cutting site, the GCGGCCGC sequence in the downstream primer is the introduced NotI restriction enzyme site, and the reverse complementary sequence of the ATGATGATGATGGTGGTG sequence in the downstream primer encodes 6?His-tag tags.
[0074] The amplified genetically engineered hyaluronic acid hydrolase gene fragment was subjected to EcoRI and NotI double enzyme digestion, then cloned into the linear expression vector pPIC9K treated with the same digestion, and transformed into E. coli TOP10. The recombinant expression plasmid pPIC9K-?N24HYAL_OM.sup.opt was obtained under the premise of no frameshifting, and the recombinant sequence was correct after DNA sequencing and comparison. The recombinant plasmid was linearized by restriction endonuclease SalI and then electro-transformed into P. pastoris GS115 cells. The recombinant transformants were screened by Geneticin G418 to obtain the recombinant strain P. pastoris GS115/pPIC9K-?N24HYAL_OM.sup.opt with high-copy hyaluronic acid hydrolase gene.
Example 3 Heterologous Expression of Hyaluronic Acid Hydrolase by Recombinant Pichia pastoris
[0075] The obtained recombinant engineering strain P. pastoris GS115/pPIC9K-HYAL_OM.sup.opt and P. pastoris GS115/pPIC9K-?N24HYAL_OM.sup.opt were respectively subjected to shake flask fermentation culture. The fermentation steps were as follows: a single clone was picked, inoculated in 40 mL of YPD medium (yeast extract 10 g/L, peptone 20 g/L, glucose 20 g/L), and cultured at 30? C., 200 rpm for 24 hours. It was transferred to 40 mL of initial expression medium BMGY (yeast extract 10 g/L, peptone 20 g/L, K.sub.2HPO.sub.4 3 g/L, KH.sub.2PO.sub.4 11.8 g/L, YNB 3.4 g/L, ammonium sulfate 10 g/L, biotin 4?10.sup.?4 g/L, glycerol 10 mL/L) at 10% inoculum amount, and cultured at 30? C., 200 rpm for 24 hours. The thalluses were collected by centrifugation, washed with normal saline, and then changed to 40 mL of induction expression medium BMMY (yeast extract 10 g/L, peptone 20 g/L, K.sub.2HPO.sub.4 3 g/L, KH.sub.2PO.sub.4 11.8 g/L, YNB 3.4 g/L, ammonium sulfate 10 g/L, biotin 4?10.sup.?4 g/L, methanol 10 mL/L) for culture, pure methanol was added to the medium every 24 hours to a final concentration of 1.0% (v/v) to induce expression for 96 hours.
[0076] The fermentation supernatant was detected by SDS-PAGE protein electrophoresis, and the results are shown in
Example 4 Enzymatic Activity Detection of Shake Flask Fermentation Supernatant of the Recombinant Strain
[0077] The reducing sugar equivalent produced by the hydrolysis of hyaluronic acid was determined by DNS method, and the activity of hyaluronic acid hydrolase was calculated by standard curve with analytically pure glucose. 1 mL of reaction system: 10 ?L of fermentation supernatant (the boil-inactivated fermentation supernatant with an equal volume was used as the blank) and 190 ?L of 50 mM citric acid buffer (pH 5.5) were added to 800 ?L of 2 mg/mL hyaluronic acid substrate solution, and incubated at 38? C. for 15 min. After the reaction, the mixture was immediately placed in a boiling water bath for 2 min to inactivate the enzyme to terminate the reaction. The treated 1 mL reaction solution was added to 2 mL DNS (potassium sodium tartrate tetrahydrate 248 g/L, 3,5-dinitrosalicylic acid 6.3 g/L, 2M NaOH 250 mL/L, phenol 5.136 g/L, sodium sulfite 5 g/L) solution. The obtained mix was shake to mix well, subjected for boiling water bath together with the glucose standard curve sample for 10 min, and then cooled to room temperature in an ice bath. 7 mL of deionized water was added and shaking was performed to mix well. The absorbance was measured at 540 nm, and converted into the amount of reducing sugar produced by the reaction. The crude enzymatic activity of the fermentation supernatant of the recombinant engineering strain was calculated according to the glucose standard curve. The results are shown in
Example 5 High-Density Culture of Recombinant Strains in a 5-L Fermenter
[0078] The recombinant strain P. pastoris GS115/pPIC9K-?N24HYAL_OM.sup.opt was subjected to high density culture in a 5-L fermentor. The single colony on the YPD plate was transferred to 50 mL of YPD liquid medium, cultured at 220 rpm, 30? C. for 24 hours, and the culture solution was inoculated into 200 mL of BMGY medium at 10%, and cultured at 30? C., 220 rpm for 24 hours. The 200 mL seed solution cultured for 24 hours was added into a 5-L fermenter containing 2 L BSM fermentation medium (glycerol 40 g/L, K.sub.2SO.sub.4 18 g/L, KOH 4.13 g/L, 85% H.sub.3PO.sub.4 26.7 mL/L, CaSO.sub.4.Math.2H.sub.2O 0.93 g/L, MgSO.sub.4.Math.7H.sub.2O 14.9 g/L, filter-sterilized PTM14.4 mL/L; the formula of PTM1 is: CuSO.sub.4.Math.5H.sub.2O 6 g/L, KI 0.09 g/L, MnSO.sub.4.Math.H.sub.2O 3 g/L, H.sub.3BO.sub.3 0.02 g/L, MoNa.sub.2O.sub.4.Math.2H.sub.2O 0.2 g/L, CoCl.sub.2.Math.6H.sub.2O 0.92 g/L, ZnCl.sub.2 20 g/L, FeSO.sub.4.Math.7H.sub.2O 65 g/L, biotin 0.2 g/L, H.sub.2SO.sub.4 5.0 mL). The initial fermentation parameters were set as temperature of 30? C., pH of 5.5, aeration volume of 2.0 vvm and rotation speed of 500 rpm. During the fermentation process, the pH was controlled at 5.5 by automatically adding ammonia water. After the glycerol in the BSM medium was exhausted, the batch feeding stage was entered. 50% (v/v) glycerol (containing 12 mL/L PTM1) was supplemented by exponential feeding, while the rotation speed was set to couple with dissolved oxygen DO. The feeding rate was 13.5 mL/h/L, 16.2 mL/h/L, 19.2 mL/h/L, 22.8 mL/h/L, 27.2 mL/h/L and 32.4 mL/h/L respectively for the first 6 hours, and is set to 30 mL/h/L for the following 6 hours. After the feeding, the stage of starvation culture was entered. The starvation culture was performed for 2-3 hours until the residual glycerol was exhausted. The stage of methanol induction was entered. The pure methanol containing 12 mL/L PTM1 was fed with the final concentration maintained at 1.8% (v/v), while the fermentation temperature was adjusted to 25? C., the rotation speed was increased to 1000 rpm, and the feeding rate of the methanol and the final concentration of the methanol in the medium were controlled online in real time by a methanol detector. After entering the stage of methanol induction, samples were taken at regular intervals to detect the enzymatic activity of the fermentation supernatant.
[0079] The detection results of enzymatic activity are shown in
Example 6 Purification of Genetically Engineered Hyaluronic Acid Hydrolase
[0080] Six polyhistidine purification tags were introduced at the C-terminus of the genetically engineered hyaluronic acid hydrolase, and could specifically bind to nickel ions to purify the protein. Firstly, the nickel column media was filled into an affinity chromatography column, and then the nickel column was activated with 5 column volumes of binding buffer (20 mM sodium phosphate, 0.5 NaCl, 20 mM imidazole, pH 6.0). An appropriate amount of ultrafiltration concentrated fermentation supernatant filtered through 0.22 ?m was added, impurities were eluted with 5 column volumes of binding buffer, and then the target protein was gradient eluted with 10 column volumes of elution buffer having 100 mM, 200 mM, 300 mM, and 500 mM imidazole, respectively. The eluent was verified by SDS-PAGE, and the results are shown in
TABLE-US-00002 Sequencelisting SEQIDNO.1: atgatcccacccgcacgtgactcgcttatgtttgtctttgcgactgcggtaatcgctagt 60 tttttcggtagcgcaaagacactacgcggctcttccccacagcaattcgacgtatactgg 120 aatgtgccaactttcatgtgtcacaagcacggtatgaaatttgaagagctgaaagatttc 180 ggtatacaccagaacgcaatggatatgtttcgcggcgaagaaattgcgattctttatgac 240 cctggcatgtttcccgcccttctagtagataaagatggatacgtcactaaacggaacggt 300 ggggtgccgcaagaggggaacctcaaggaacatttagaaacctttagaaagcatctgacg 360 acacaaattccggacgagagctttagcgggataggaatcatagactttgagagttggaga 420 ccgattttcaggcagaactgggcgtcactcgagccctataaaactttgtccataaagttg 480 gagagggaaaaacacccattttggtcggaggcagctgtgaagaaggaggccaaacgtcga 540 ttcgagaaatccgggcgaatatttatggaggaaaccctcaaaatggccaaaaaactaaga 600 ccgaaagcaaagtggggctattatgggtatccccactgtttcaatcaaacccctggacag 660 cagtcggttcactgcaatcggcaaacgatgatggaaaatgacggtatgagttggctgttt 720 acactcgaagacgttcatgctcccagcgtttacctacgattggaaatcaaggaggatgac 780 cggccttcattcgtgaaaggccgggtttccgaggccttaaggttagccgctaaatcgtct 840 tcaaaacaacgtatcctaccttactactggttcatttatcaggataagaaggatgagttc 900 ttaacggaaaaggatacacaaaacactataaatatgatcgctaatctgggatctaatggt 960 ttcataatttggggatctagtgacgatgtcaacacggaacgcaaatgcaaggatttacag 1020 caatacgtaaaggaagtcttgggcccagcgattaagaagttcacccttcattga 1074 SEQIDNO.2: MetIleProProAlaArgAspSerLeuMetPheValPheAlaThrAla 151015 ValIleAlaSerPhePheGlySerAlaLysThrLeuArgGlySerSer 202530 ProGlnGlnPheAspValTyrTrpAsnValProThrPheMetCysHis 354045 LysHisGlyMetLysPheGluGluLeuLysAspPheGlyIleHisGln 505560 AsnAlaMetAspMetPheArgGlyGluGluIleAlaIleLeuTyrAsp 65707580 ProGlyMetPheProAlaLeuLeuValAspLysAspGlyTyrValThr 859095 LysArgAsnGlyGlyValProGlnGluGlyAsnLeuLysGluHisLeu 100105110 GluThrPheArgLysHisLeuThrThrGlnIleProAspGluSerPhe 115120125 SerGlyIleGlyIleIleAspPheGluSerTrpArgProIlePheArg 130135140 GlnAsnTrpAlaSerLeuGluProTyrLysThrLeuSerIleLysLeu 145150155160 GluArgGluLysHisProPheTrpSerGluAlaAlaValLysLysGlu 165170175 AlaLysArgArgPheGluLysSerGlyArgIlePheMetGluGluThr 180185190 LeuLysMetAlaLysLysLeuArgProLysAlaLysTrpGlyTyrTyr 195200205 GlyTyrProHisCysPheAsnGlnThrProGlyGlnGlnSerValHis 210215220 CysAsnArgGlnThrMetMetGluAsnAspGlyMetSerTrpLeuPhe 225230235240 ThrLeuGluAspValHisAlaProSerValTyrLeuArgLeuGluIle 245250255 LysGluAspAspArgProSerPheValLysGlyArgValSerGluAla 260265270 LeuArgLeuAlaAlaLysSerSerSerLysGlnArgIleLeuProTyr 275280285 TyrTrpPheIleTyrGlnAspLysLysAspGluPheLeuThrGluLys 290295300 AspThrGlnAsnThrIleAsnMetIleAlaAsnLeuGlySerAsnGly 305310315320 PheIleIleTrpGlySerSerAspAspValAsnThrGluArgLysCys 325330335 LysAspLeuGlnGlnTyrValLysGluValLeuGlyProAlaIleLys 340345350 LysPheThrLeuHis 355 SEQIDNO.3 atcccacccgcacgtgactcgcttatgtttgtctttgcgactgcggtaatcgctagtttt 60 ttcggtagcgca 72 SEQIDNO.4 atgaagacactacgcggctcttccccacagcaattcgacgtatactggaatgtgccaact 60 ttcatgtgtcacaagcacggtatgaaatttgaagagctgaaagatttcggtatacaccag 120 aacgcaatggatatgtttcgcggcgaagaaattgcgattctttatgaccctggcatgttt 180 cccgcccttctagtagataaagatggatacgtcactaaacggaacggtggggtgccgcaa 240 gaggggaacctcaaggaacatttagaaacctttagaaagcatctgacgacacaaattccg 300 gacgagagctttagcgggataggaatcatagactttgagagttggagaccgattttcagg 360 cagaactgggcgtcactcgagccctataaaactttgtccataaagttggagagggaaaaa 420 cacccattttggtcggaggcagctgtgaagaaggaggccaaacgtcgattcgagaaatcc 480 gggcgaatatttatggaggaaaccctcaaaatggccaaaaaactaagaccgaaagcaaag 540 tggggctattatgggtatccccactgtttcaatcaaacccctggacagcagtcggttcac 600 tgcaatcggcaaacgatgatggaaaatgacggtatgagttggctgtttacactcgaagac 660 gttcatgctcccagcgtttacctacgattggaaatcaaggaggatgaccggccttcattc 720 gtgaaaggccgggtttccgaggccttaaggttagccgctaaatcgtcttcaaaacaacgt 780 atcctaccttactactggttcatttatcaggataagaaggatgagttcttaacggaaaag 840 gatacacaaaacactataaatatgatcgctaatctgggatctaatggtttcataatttgg 900 ggatctagtgacgatgtcaacacggaacgcaaatgcaaggatttacagcaatacgtaaag 960 gaagtcttgggcccagcgattaagaagttcacccttcatcaccaccatcatcatcattga 1020 SEQIDNO.5: MetLysThrLeuArgGlySerSerProGlnGlnPheAspValTyrTrp 151015 AsnValProThrPheMetCysHisLysHisGlyMetLysPheGluGlu 202530 LeuLysAspPheGlyIleHisGlnAsnAlaMetAspMetPheArgGly 354045 GluGluIleAlaIleLeuTyrAspProGlyMetPheProAlaLeuLeu 505560 ValAspLysAspGlyTyrValThrLysArgAsnGlyGlyValProGln 65707580 GluGlyAsnLeuLysGluHisLeuGluThrPheArgLysHisLeuThr 859095 ThrGlnIleProAspGluSerPheSerGlyIleGlyIleIleAspPhe 100105110 GluSerTrpArgProIlePheArgGlnAsnTrpAlaSerLeuGluPro 115120125 TyrLysThrLeuSerIleLysLeuGluArgGluLysHisProPheTrp 130135140 SerGluAlaAlaValLysLysGluAlaLysArgArgPheGluLysSer 145150155160 GlyArgIlePheMetGluGluThrLeuLysMetAlaLysLysLeuArg 165170175 ProLysAlaLysTrpGlyTyrTyrGlyTyrProHisCysPheAsnGln 180185190 ThrProGlyGlnGlnSerValHisCysAsnArgGlnThrMetMetGlu 195200205 AsnAspGlyMetSerTrpLeuPheThrLeuGluAspValHisAlaPro 210215220 SerValTyrLeuArgLeuGluIleLysGluAspAspArgProSerPhe 225230235240 ValLysGlyArgValSerGluAlaLeuArgLeuAlaAlaLysSerSer 245250255 SerLysGlnArgIleLeuProTyrTyrTrpPheIleTyrGlnAspLys 260265270 LysAspGluPheLeuThrGluLysAspThrGlnAsnThrIleAsnMet 275280285 IleAlaAsnLeuGlySerAsnGlyPheIleIleTrpGlySerSerAsp 290295300 AspValAsnThrGluArgLysCysLysAspLeuGlnGlnTyrValLys 305310315320 GluValLeuGlyProAlaIleLysLysPheThrLeuHisHisHisHis 325330335 HisHisHis SEQIDNO.6: CCGGAATTCATGAAGACACTACGCGGCTC SEQIDNO.7: ATTTGCGGCCGCTCAATGATGATGATGGTGGTGATGAAGGGTGAACTTCTT