COMPOUNDS FOR USE IN PROGRESSIVE MULTIPLE SCLEROSIS
20240148745 ยท 2024-05-09
Assignee
- FONDAZIONE CENTRO SAN RAFFAELE (Milano (MI), IT)
- INSTITUT DU CERVEAU ET DE LA MOELLE ?PINI?RE (Paris, FR)
- Assistance Publique Hopitaux De Paris (Paris, FR)
- Centre National De La Recherche Scientifique (Paris, FR)
- INSTITUT NATIONAL DE LA SANT? ET DE LA RECHERCHE M?DICALE (Paris, FR)
- Sorbonne Universite (Paris, FR)
- WESTF?LISCHE WILHELMS-UNIVERSIT?T M?NSTER (M?nster, DE)
- The Regents Of The University Of California (Oakland, unknown)
- HEINRICH HEINE UNIVERSITY D?SSELDORF (D?sseldorf, DE)
- UNIVERSIT?TSMEDIZIN DER JOHANNES GUTENBERG-UNIVERSIT?T MAINZ (Mainz, DE)
- THE ROYAL INSTITUTION FOR THE ADVANCEMENT OF LEARNING / MCGILL UNIVERSITY (Montreal, Qu?bec, CA)
- ISTITUTO SUPERIORE DI SANIT? (Rome, IT)
- Consiglio Nazionale Delle Ricerche (Rome, IT)
- IRBM S.P.A. (Pomezia, IT)
Inventors
- Gianvito MARTINO (Milan, IT)
- Paola Panina (Milan, IT)
- Brahim NAIT-OUMESMAR (Paris, FR)
- Anne BARON-VAN EVERCOOREN (Paris, FR)
- Tanja KUHLMANN (M?nster, DE)
- Sergio BARANZINI (Oakland, CA, US)
- Norbert GOEBELS (D?sseldorf, DE)
- Frauke ZIPP (Mainz, DE)
- Nicholas HANUSCHECK (Mainz, DE)
- Jack ANTEL (Montreal, Qu?bec, CA)
- Cristina AGRESTI (Rome, IT)
- Maria Pia ABBRACCHIO (Milano (MI), IT)
- Ivano EBERINI (Cinisello Balsamo (MI), IT)
- Chiara PARRAVICINI (Milano (MI), IT)
- Stefania OLLA (Rome, IT)
- Alberto Bresciani (Pomezia, IT)
Cpc classification
A61K31/4439
HUMAN NECESSITIES
A61K31/495
HUMAN NECESSITIES
A61K31/517
HUMAN NECESSITIES
A61K31/57
HUMAN NECESSITIES
A61K31/502
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K31/4985
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
A61K31/405
HUMAN NECESSITIES
A61K31/4995
HUMAN NECESSITIES
A61K31/4545
HUMAN NECESSITIES
A61K31/427
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/192
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61K31/5025
HUMAN NECESSITIES
A61K31/196
HUMAN NECESSITIES
A61K31/496
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
A61K31/138
HUMAN NECESSITIES
A61K31/166
HUMAN NECESSITIES
A61K31/46
HUMAN NECESSITIES
A61K31/58
HUMAN NECESSITIES
A61K31/55
HUMAN NECESSITIES
International classification
A61K31/5377
HUMAN NECESSITIES
A61K31/4995
HUMAN NECESSITIES
A61K31/55
HUMAN NECESSITIES
A61K31/496
HUMAN NECESSITIES
A61K31/4985
HUMAN NECESSITIES
A61K31/5025
HUMAN NECESSITIES
A61K31/405
HUMAN NECESSITIES
A61K31/4439
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
Abstract
The present invention provides compounds able to induce neuroprotection of damaged neurons and boost the remyelination potential of oligodendrocytes. The compounds have been identified through methods of pharmacological screening of a small molecule library consisting of known pharmacologically active compounds and approved drugs. The screening method is also included in the invention.
Claims
1. A method for the treatment and/or prevention and/or to ameliorate symptoms of neurodegenerative diseases caused by immune-mediated demvelination, comprising administering to a subject in need thereof a compound able to increase oligodendrocyte precursor cell (OPC) differentiation to oligodendrocyte and/or to increase remyelination and/or to preserve neuronal viability and morphology, the compound being selected from: a) a NK1 receptor inhibitor and/or a Sigmal receptor modulator comprising: Casopitant, Aprepitant, Fosaprepitant, Rolapitant, Lanepitant and Orvepitant; and/or b) an H3R antagonist comprising: Bavisant, Pitolisant, GSK189254, PF-03654746, A-331440, JNJ-39220675 and MK-0249; and/or c) a CGRP antagonist comprising: Olcegepant, Telcagepant, BI 44370 TA, MK-3207, Rimegepant, SB-268262 and Ubrogepant; and/or d) Lemborexant, PD-0325901, Vanoxerine, Indeglitazar, PAC-14028, NS-018, Rupatadine, Efatutazone Hydrochloride, Alprenolol, Danirixin, SU14813, Ezatiostat Hydrochloride, Acumapimod, Tamibarotene, Drinabant, PF-03654746, Ponesimod, Dovitinib, LY-2090314, Taladegib, Progesterone, Roxadustat, Saracatinib, Telatinib, Gandotinib, Equol, BMS-833923, Merestinib, RG7314, Adenine, Hyoscyamine, Solcitinib, Neramexane, Varlitinib, Imidafenacin, Fevipiprant, Itacitinib, Decernotinib, GSK-2636771, SSR180711, Tarenflurbil, Fluocinolone Acetonide, SB-705498, AZD1981, Raxatrigine, Octanoic Acid, Itopride, Nalfurafine hydrochloride, Istradefylline, GS-4997, AZD9056, Vatalanib; and combinations thereof.
2. The method of claim 1, wherein the compound is Casopitant and/or Bavisant and/or Telcagepant and/or Olcegepant and/or Telatinib and/or Indeglitazar and/or Merestinib and combinations thereof.
3. The method of claim 1, wherein the compound is according to claim 1 selected from Casopitant, Aprepitant, Fosaprepitant, Rolapitant, Lanepitant, Orvepitant and combinations thereof.
4. The method of claim 1, wherein the compound is selected from Bavisant, Pitolisant, GSK189254, PF-03654746, A-331440, JNJ-39220675, MK-0249 and combinations thereof.
5. The method of claim 1, wherein the compound is selected from Olcegepant, Telcagepant, BI 44370 TA, MK-3207, Rimegepant, SB-268262, Ubrogepant and combinations thereof.
6. The method of claim 1, wherein the neurodegenerative diseases caused by immune-mediated demyelination are selected from Multiple Sclerosis, Progressive Multiple sclerosis, Optic-spinal multiple sclerosis, Amyotrophic Lateral Sclerosis, Chronic relapsing inflammatory optic neuritis (CRION), Neuromyelitis optica, or Chronic inflammatory demyelinating polyneuropathy.
7. (canceled)
8. The method of claim 1, wherein the compound is administered as a pharmaceutical composition wherein the compound is at concentration of about between 100 nM and 100 ?M.
9. The method of claim 1, wherein the neurodegenerative disease caused by immune-mediated demyelination is Multiple Sclerosis, Progressive Multiple sclerosis, Optic-spinal multiple sclerosis, Amyotrophic Lateral Sclerosis, Chronic relapsing inflammatory optic neuritis (CRION), Neuromyelitis optica, or Chronic inflammatory demyelinating polyneuropathy.
10. A method for identifying a compound able to increase oligodendrocyte precursor cell (OPC) differentiation and/or to produce an expanded population of oligodendrocytes, wherein said method comprises: a toxicity assay on neonatal mouse oligodendrocyte progenitor cells wherein test compounds are screened for their ability to reduce [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)]; and/or a toxicity assays on rat oligodendrocyte progenitor double fluorescence CG4 line; and/or a differentiation assay on rat oligodendrocyte progenitor CG4 line.
11. A method for identifying a compound able to preserve neuronal viability and morphology in cell culture, wherein said method comprises: a toxicity assay on primary mouse cortical neurons wherein test compounds are screened in a Cell Counting Kit-8 (CCK-8) assay using WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt); and/or a neuroprotective assay on primary mouse cortical and striatal neurons wherein compounds are screened for their ability to preserve neuronal viability and morphology (neurite length and network integrity/branching) against NMDA-induced excitotoxicity; and/or a toxicity assay on iPSC-derived glutamatergic neurons wherein test compounds are screened in a Cell Counting Kit-8 (CCK-8) assay using WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt); and/or a neuroprotective assay on iPSC-derived glutamatergic neurons wherein compounds are screened for their ability to preserve neuronal viability against ROS (tBuOOH)-induced toxicity.
12. A method for identifying a compound able to increase neuronal differentiation and/or to produce an expanded population of neurons in cell culture, wherein said method comprises a differentiation assay on human fetal NPCs towards TUJ1+ neuronal precursors wherein: test compounds at 1 ?M concentration are co-incubated with hufNPCs for 7 days; 0.02% vol/vol DMSO and basal medium are used as negative controls; heparin is used as a positive control; at the end of incubation cells are fixed and analyzed via immunocytochemistry.
13. (canceled)
14. (canceled)
15. (canceled)
16. The method of claim 1, wherein the compound administered is bavisant, pitolisant or a combination thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094] Materials and Methods
[0095] Abbreviations: BDNF: Brain-derived neurotrophic factor; CNP: 23-cyclic nucleotide phosphodiesterase; hiPSC: human induced pluripotent stem cell; OPC: oligodendrocyte precursor; OL: oligodendrocyte; MAP2: microtubule-associated protein 2; MBP: myelin basic protein; NAC: N-acetylcysteine; NMDA: N-methyl-D-aspartate; NMDAR: NMDA receptor; NPC: neuroprecursor; PBS: phosphate-buffered saline.
[0096] In Silico Platform to Prioritize Sets of Therapeutic Compounds that Passed a Safety Assessment in Man.
[0097] The in silico approach was based on the generation of biologically meaningful predictions of relationship integrating multiple high-throughput data sources. The approach computes features describing the network topology connecting two nodes.
[0098] These features are used as input for a machine learning method that predicts the probability that an edge/connection exists. Evaluating the informativeness of each feature, the relevance of included domains can be compared providing insight into the influential mechanisms behind the process of interest for a given gene (http://het.io/hnep/). The predicted connectivity of one element of the network with others is weighted and ranked depending on the robustness of the connectivity. Het.io has been updated and expanded into SPOKE, as Scalable Precision medicine Open Knowledge Engine. For each gene/compound the number of established connections contributes to the calculation of the weighted score (DWPC score) (
[0099] SPOKE has been further trained on medical records from the University of Southern California (UCSF) patient population (>300000 subjects) that spans 137 disorders. A self-organizing map (SOM) machine-learning algorithm is used to predict disease based on the training dataset of the UCSF population.
[0100] Effect of Compounds on the Metabolism of Neonatal Mouse Oligodendrocyte Progenitor Cells.
[0101] Purified oligodendrocyte progenitor cells (OPC) obtained from neonatal mouse primary mixed glial cultures.sup.25 were plated at the density of 6*10.sup.4 cells/cm.sup.2 into poly-L-lysine-coated 96 well plates. One day after plating, the cells were incubated with or without drugs (10, 1 and 0.1 ?M) in DMSO (0.001% vehicle) for 48 hours. Compounds were screened for their ability to reduce [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)] using an automated microplate reader (Bio-rad, Hercules, CA, USA), as previously described..sup.25 MTT (0.25 mg/ml, Sigma-Aldrich, St Louis, MO) was added to the culture medium during the final 4 hours of incubation. Edaravone (10 ?M, Sigma-Aldrich) and platelet derived growth factor (PDGF, 20 ng/ml, Peprotech, Rocky Hill, NJ, USA) were used as positive controls due to their demonstrated activity on OPC proliferation and differentiation..sup.26 Only the compounds that showed an inhibitory effect on OPC metabolism at 10 ?M were tested at lower concentrations.
[0102] Differentiation of Rodent Oligodendrocyte Progenitor CG4 Line.
[0103] Primary validation on CG4 line toxicity and differentiation. An innovative OPC line was developed for fast and reliable high content screening (HCS) of small compounds inducing oligodendrocyte differentiation. The line was genetically engineered by lentiviral transduction of rat CG4 cells (PubMed=1613821; DOI=10.1002/jnr.490310125; Louis J. C., Magal E., Muir D., Manthorpe M., Varon S.; CG-4, a new bipotential glial cell line from rat brain, is capable of differentiating in vitro into either mature oligodendrocytes or type-2 astrocytes. J. Neurosci. Res. 31:193-204(1992) to express mCherry fluorescent reporter (Evercooren, Anne & Avellana-Adalid, V. & Vitry, Sandrine & Nait-Oumesmar, Brahim & Lachapelle, Francois. (1997). Expansion of Oligodendrocyte Progenitors for Myelin Repair. 10.1007/978-1-4615-5949-8_21) in mature oligodendrocytes only, and EGFP at all stage of the oligodendroglial lineage: both the generation of mature oligodendrocytes (wmNl-mCherry) and the morphological changes associated with differentiation (CMV-EGFP) can be therefore monitored in a single assay. mCherry expression occurred only in O4+/GalC+ differentiated oligodendrocytes and GFP was ubiquitously expressed at all developmental stages. The line so obtained was validated using compounds with well-established effects on oligodendrocyte differentiation (cAMP and T3). Cell-based assay was standardized on the HCS platform (ArrayScanXTI, Brain and Spine Institute (Paris), validating the pro-differentiation effects of clemastine.sup.27 and 9cis-retinoic acid..sup.28 For HCS validation of 274 compounds identified through in silico screen, double-fluo CG4 line cells were plated in 96 well-plates, 6500 cells/cm.sup.2 and left for 24 h in proliferation. The other day, compounds were added (1 ?M) for next 5 days of differentiation, with ? medium changed after 3 days. 9-cis Retinoic Acid (9cis-RA; 1 M) served as a positive control, negative controls were basal (N1) medium and vehicle (basal+0.1% DMSO). Each compound was tested in triplicate and were imaged with ArrayScanXTI system (35 fields/well) after 5 days of differentiation. Compounds increased differentiation was evaluated by count of mCherry+ signal compared to basal and 9cis-RA controls, together with evaluation of number of cells (toxicity or proliferation).
[0104] Secondary validation on primary rat OPC differentiation. Re-validation of the best performing compounds promoting OPC differentiation (fold change >1.5) was performed on primary rat OPC cultures in 96 well-plate run in triplicates by triple immunolabeling for CNPase, MBP and SOX10 as a readout. Compounds at 1 M were added for 4 days of differentiation and then cell cultures were imaged with ArrayScanXTI platform, number of MBP+OLs were quantified by semi-automated software. Basal medium served as a negative control, 9 cis-RA (5 M) was a positive control.
[0105] Differentiation of Human iPS-Derived Neuroprecursors into Oligodendrocytes.
[0106] NPC bearing a doxycycline inducible polycistronic construct containing SOX10, OLIG2 and NKX6.2.sup.29 in a human safe harbor (passages 10 to 25) were singularized on day ?3 by treatment with Accutase and plated on Matrigel-coated 12-well plates at a density of 100.000 cells per well in N2B27-medium containing equal parts of neurobasal (Invitrogen) and DMEM-F12 medium (Invitrogen) with 1:100 B27 supplement lacking vitamin A (Invitrogen), 1:200 N2 supplement (Invitrogen), 1% penicillin/streptomycin/glutamine (PSG), 3 ?M CHIR99021 (Axon Medchem), 150 ?M ascorbic acid and 0.5 ?M SAG. The next day medium was changed to N2B27-medium containing 1 ?g/ml doxycycline. On DO medium was changed to glial-induction medium (GIM) consisting of DMEM-F12 with 1:100 B27 supplement lacking vitamin A, 1:200 N2 supplement, 1% PSG, 1 ?M SAG, 10 ng/mL NT3 (Peprotech), 10 ng/mL IGF-I (Peprotech), 200 ?M AA (Sigma), 1:1000 Trace Elements B (Corning). For full medium conditions 10 ng/ml T3 was added. On Day 2 medium was changed to glial-differentiation medium (GDM) comprising DMEM-F12 with 1:100 B27 supplement lacking vitamin A, 1:200 N2 supplement, 1% PSG, 100 ?M dbCAMP (Sigma), 100 ?M AA, 1:1000. For full medium conditions 60 ng/mL T3, Trace Elements B 10 ng/mL, IGF-I, 10 ng/mL and NT3 were added to the culture. GDM was changed every other day. On day 7 cells were detached by treatment with Accutase and re-plated on laminin coated 48-well plates at densities of 10.000-12.000 cells per well. After 24 h cells were treated in minimal medium with either vehicle alone [0.01% (vol/vol) DMSO] as a negative control, 60 ng/mL T3 as a positive control, or with a drug candidate dissolved in DMSO. Medium was changed every other day. On D16 doxycycline was removed from the medium. Cells were fixed on D21 and analyzed via immunocytochemistry.
[0107] Immunocytochemistry. Cells were initially fixed with 4% PFA treatment for 20 min, RT. Following three washes with PBS cells were incubated with blocking solution containing 5% normal goat serum (NGS) and 5% FCS (fetal calf serum) in PBS for 30 min at RT to prevent unspecific binding of the antibodies. To detect intracellular antigens cells were permeabilized by adding 0.5% Triton X-100 to the Blocking-solution. Cells treated with Triton X-100 were washed three times with PBS each time for 5 min at RT. Primary antibodies (rat anti-MBP,1:50, Abcam, AB7349) were applied overnight, 4? C., in blocking solution. The next day cells were washed 3 times with PBS at RT, and afterwards incubated with secondary antibodies (AF488 Alexa Fluor anti-rat (goat), 1:500, Jackson/Dianova, #112-545-167) diluted in PBS for 1 h at RT. Secondary antibodies were subsequently removed by washing 3 times with PBS. Afterwards PBS containing a Dapi staining for nuclei was added for 5 minutes and afterwards washed off with PBS. Cells were kept at 4? C. until imaging.
[0108] Imaging and evaluation. From each condition (triplicates) 20-30 pictures were taken randomly chosen by the Dapi-signal. Cell numbers were determined by using an ImageJ Macro to count the nuclei whereas MBP positive cells were subsequently counted manually in black and white images.
[0109] Human Fetal Neural Precursors (hufNPCs) Derived OPCs.
[0110] Fetal NPC.sup.30 were expanded in Epithelial Growth Factor (EGF)+Fibroblast Growth Factor (FGF). At confluence, they were seeded in flasks and grown for 21 days in oligodendrocyte specification medium. At this stage cells were frozen and tested by immunohistochemistry (IHC): 70-80% were Platelet derived Growth Factor Receptor a (PDGFRa)+, 75% Oligodendrocyte Transcription Factor 2 (Olig2)+, 85% (sex determining region Y)-box 2 (Sox10)+ and 79% NK2 Homeobox 2.2 (Nkx2.2)+. Upon demand, frozen stocks were thawed for 2 days in the same medium before being switched for 7 days in 4 well plates to the oligodendrocyte differentiation medium containing either DMSO, Triiodothyronine (T3) or the compound (1 ?M) in 0.1% DMSO. Cells were then fixed and immunolabeled for Hoechst, Galactocerebrosidase (GalC) and anti-adenomatous polyposis coli clone CC1 (CC1).
[0111] The compounds selection was based on CG4/OPC/hiOL differentiation results (the most active and potentially new). Data were evaluated blindly and expressed as % of GalC+OLs forming sheets vs CC1+ cells with compounds/DMSO at 7 days of differentiation.
[0112] Differentiation of Rodent Primary Neurons.
[0113] Primary cultures of murine cortical neurons were obtained from C57BL/6N female mice at gestation stage E16.5-E17.5. The cortices were washed 3 times with HBSS without phenol red (Hanks' Balanced Salt solution, Sigma) containing 5 mM HEPES (Sigma) and subsequently enzymatically dissociated for 30 minutes at 37? C., with one solution containing: trypsin 1.25 mg/ml (Sigma, dissolved in HBSS-phenol red, Euroclone), DNAsi 30 ?g/ml (Sigma, dissolved in Neurobasal medium, Gibco), CaCl2) 5 mM (Sigma) in HBSS-phenol red. Afterwards, the enzyme activity was stopped using complete Neurobasal medium (Neurobasal medium, L-Glutamine (Invitrogen) 1%, penicillin-streptomycin 1%, B27 supplement (Invitrogen) 2%; FetalClone III Serum (FCIII) 10%, HyClone).
[0114] Cortical neurons were seeded at a density of 30,000 cells/well in 96-well multi-well plate (Falcon) and 200,000 cells/coverglass in 24-well multi-well plate, coated with 100 g/ml Poly-D-Lysine (Sigma) and 3.5 ?g/ml laminin (Sigma) in PBS 1?. After 4 hours from the seeding the complete medium was replaced with serum-free complete Neurobasal medium. Cultures were maintained in a humidified CO2 incubator (5% CO2, 37? C.) and half of the medium was changed every four days. The toxicity/neuroprotective assays were performed between 13-14 days in vitro (DIV). Toxicity assay. To evaluate toxicity of the molecules on murine cortical neurons, the 274 compounds have been tested in triplicates at 7-9 DIV in 96 multi-well plate at two pharmacological concentrations (1 ?M and 10 ?M), with secondary cytotoxicity assay performed on more mature cultures at 14 DIV. The cortical neurons were exposed to compounds for 24 hours and viability was assessed with Cell Counting Kit-8 assay (CCK-8, Sigma) compared to DMSO-treated cells.
[0115] Neuroprotective Assay.
[0116] To assess neuroprotective activity of 160 selected non-toxic compounds on primary murine cortical neurons, obtained as described in the previous paragraph, (13 DIV), cultures were pre-treated with 1 ?M compounds for either 3 or 24 hours, followed by 24 hours chronic stimulation with NMDA (8 ?M) to induce neuronal damage. Each test plate included: a negative control (untreated), vehicle-treated control (0.02% vol/vol DMSO), a positive neurotoxic controlstaurosporine 0.1 ?M, a stressorNMDA 8 ?M, a positive neuroprotective controlNAC 300 ?M, and a combination of stressor +neuroprotective molecule (NMDA+NAC). Cell viability was measured with Cell Counting Kit-8 assay compared to NMDA-treated control.
[0117] Morphological Integrity Evaluation.
[0118] Apart of viability/metabolic readout in NMDA-mediated neurotoxicity assay, a neuronal structural integrity was evaluated by MAP2 staining. Mouse cortical neurons (14 DIV) cultured in MW96 plates were fixed with 4% paraformaldehyde (PFA). Fixed cells were incubated with blocking solution (PBS 1?, donkey serum 5%, Triton 0.1%) for 1-hour, primary antibody (rabbit ?-MAP2, 1:250, Millipore) was applied in the same solution overnight at +4? C. The next day cells were washed 3 times with PBS 1?+Triton 0.1% at RT, and afterwards incubated with secondary antibody (Alexa Fluor 555 anti-rabbit (donkey), 1:1000, Molecular Probes, ab150074) diluted in PBS 1?+Triton 0.1% for 1 h at RT. Nuclei were stained with 4-6-diamidino-2-phenylindole (DAPI, Roche). Microscopy was performed using ArrayScan?XTI (ThermoFisher) imaging platform. 15 images per well were acquired and analyzed by CellProfiler. Total neurite length and the total number of non-trunk branches were analyzed. Total neurite length and the total number of branching were evaluated from 15 images/well, each compound or control was tested in triplicates. The total neurite length and total number of branches were converted to a standardized Z-score using formula: X.sub.ij=((Xij??)/?), where xij is the raw measurement of the compound located in well (i, j), and ? and ? are, respectively, the mean and the standard deviation of all measurements of the plate..sup.31
[0119] Morphological integrity evaluation. Mouse cortical and striatal neurons (14 DIV) cultured in MW96 plates were exposed to 1 uM to 60 uM concentrations of NMDA and relationship between the NMDA dose and fiber length was evaluated. To assess neuroprotective activity of 114 selected non-toxic compounds on primary murine cortical and striatal neurons (14 DIV), cultures were pre-treated with 1 ?M compounds for 24 hours, followed by 24 hours chronic stimulation with NMDA (20 ?M) to induce neuronal damage. Each of the compound was tested in quadruplicate. The fiber length was evaluated by MAP2 staining (please see the method described earlier).
[0120] Hipsc Generation.
[0121] Skin biopsies from 6 twin pairs (MS patients and healthy controls) discordant for disease have been collected. Skin biopsies were first divided in pieces and then cultured in a sterile serum rich medium until fibroblasts spread from the tissue and grown exponentially. Human fibroblasts were maintained in DMEM containing 10% FBS, 2 mM L-glutamine, 1?10.sup.?4 M nonessential amino acids, 1 mM sodium pyruvate and 0.5% penicillin-streptomycin. The explants were screened for presence of mycoplasma using a standard PCR kit. Fibroblasts were expanded and cryopreserved at 1-2 million cells per vial in FBS and 10% DMSO or seeded immediately for reprogramming. For iPSCs generation, fibroblasts within fourth passages were used to avoid replicative senescence.
[0122] For hiPSC generation, fibroblasts were infected with the CytoTune?-iPS 2.0 Sendai Reprogramming Kit (Life Technologies). After 1 week, the transduced fibroblasts were plated on a feeder layer of mitotically inactivated (mitomycin C (Sigma Aldrich) MEFs (2.5?10.sup.4 cells/cm.sup.2) in a DMEM supplemented with 20% KSR, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 0.02 mM 0-mercaptoethanol, 1% penicillin-streptomycin, and 10 ng/ml FGF2. Medium was changed every day and colonies started to appear 3-4 weeks later. After approximately one month, colonies with the correct morphology were picked and transferred to a Matrigel coated (feeders free) culture in mTeSR? (StemCell Technologies) medium. Colonies that reached at least passage 5 were assessed: for the absence of Sendai virus via qRT-PCR, their effective pluripotency (expression of pluripotency markers OCT4, NANOG, SOX2 evaluated by immunocytochemistry and qRT-PCR), and for their ability to differentiate into the three main germ layers via embryoid bodies formation (differentiation to mesoderm (dME), endoderm (dEN), and neuroectoderm (dEC) potential).
[0123] hiPSC Differentiation into Neural Progenitors (NPCs) and Neurons.
[0124] This protocol was modified from Yuchen Qi et al..sup.32 First, neural progenitors (NPCs) were generated from hiPSCs by dual-SMAD inhibition. Shortly, at day 0 iPSC colonies (confluent at 70-80%) were washed with PBS Dulbecco's w/o Calcium w/o Magnesium (Euroclone) and hiPSCs' maintenance medium (mTeSR?, StemCell Technologies) was replaced with neural induction medium composed by DMEM/F12 plus N2 medium (1?), B27 without RA supplement (0.5?) (Life Technology), added with SB431542 (10 ?M) and LDN (500 nM). This medium was kept until day 4 (induction). At day 4, cells were splitted (1:3) with the same induction medium using Accutase?/Accumax? (StemCell Technologies) dissociated solution. Entire medium was replaced daily up to days 14-16 until rosette formation was observed (patterning). At days 14-16, cells were detached by Accutase?/Accumax? and re-plated on polyornitine/laminin/fibronectin coated MW96 or MW24 plates for terminal differentiation in Neurobasal medium supplemented with B27 (0.5?), BDNF (20 ng/ml), dbcAMP (500 ?M), ascorbic acid (200 ?M), PD0325901 (1 ?M), SU5402 (5 ?M), CHIR (3 ?M), human recombinant insulin (5 ?g/ml), supplemented with RI (Rock inhibitor) (1:3000) to reduce dissociation induced apoptosis. The half of differentiation medium was changed every 3-4 days, supplemented with 1 ?g/ml laminin and DAPT (1-2 ?M) until terminal maturation of neuronal population (MAP2+ cells). Cultures were characterized by immunocytochemistry and qRT-PCR and neuroprotective experiments were performed on days 30-40 of differentiation.
[0125] ROS-Mediated and Neuroprotective Assay on Human iPSC-Derived Neurons (hNeu).
[0126] Neuroprotective experiments were performed using iPSC-derived glutamatergic neurons from 3 healthy controls cultured for 30-40 DIV. Cells were pre-treated for 24 h with 1 M of compounds, vehicle (DMSO) or 5 nM Mito-Q (mitoquinone) served as a positive control. On the next day cells were incubated for 2 h with 100 M of tert-butyl peroxide (tBuOOH, Sigma), then the medium was replaced and the viability readout by CCK8 viability assay kit (Dojindo) was performed on the following day. The cell viability was expressed as normalized Z score and compared to tBuOOH-treated cells with nonparametric Kruskal-Wallis test with Dunn's multiple comparisons correction.
[0127] Human Embryonic and Fetal Neural Precursors (hufNPCs) Derived Neurons.
[0128] Neural progenitors were derived from a single human fetus, and a non-immortalized human neural progenitor cell (hNPC) line was obtained and maintained in chemically defined serum-free growth medium (containing FGF-2 and EGF) as described in detail below.
[0129] Primary, growth factor-expanded hNPCs were obtained as a heterogeneous culture of spherical cell aggregates, derived from the diencephalic and telencephalic regions of a single human (Caucasian male fetus at 10-12 weeks gestational age (#BI-0194-008), obtained from a pregnancy interruption). Cells were cultured in stationary conditions both in T flasks as well as in cell factories in non-GMP conditions. Human tissue was provided by Banca Italiana del Cordone Ombelicale Fondazione IRCCS CA GRANDA Ospedale Maggiore Policlinico in Milan.
[0130] First, fresh human fetal brain tissues were mechanically dissociated, followed by enzymatic dissociation with Trypsin (LONZA (BE17-161E) 1:5) in growth medium for 5-10 min at 37? C., 5% O2 e 5% CO2, then washed with 10% Australian FBS in fresh medium and centrifuged 15 min at 200 g. Cells were plated in T25 flask in Neural stem cell growth medium (NeuroCult-XF Basal Medium (cat. #05760)+ NeuroCult-XF Proliferation supplement (cat. #05763) (for Human Neural Stem Cells) STEMCELL TECHNOLOGIES+human recombinant carrier-free EGF (cat. #1325 9510 00) and bFGF (cat. #1370 9505 00) (Provitro) at final concentration of 20 ng/ml) at 37? C., 5% O2 e 5% CO2. After 15-25 days, enzymatic (Accumax?, StarFish cat. #GMP-102470) dissociation of neurospheres or subconfluent adherent cells was performed and cells were re-plated at density (25000 cells/cm2) in NGM. Every 15 days the cells were passaged, expanded and cryopreserved. This cell line represents a stable and renewable source of uncommitted hNPCs that can be safely expanded, differentiating spontaneously versus glial and neuronal progeny when exposed to growth factorfree medium. Cell viability evaluation, mycoplasma presence (PCR), karyotype analysis and immunocytochemistry (b-tubulin, GFAP, O4) were used for characterization. Pro-differentiating properties of 160 compounds were evaluated by co-incubating freshly seeded in 96 well plate hufNPCs with 1 ?M compounds for 7 days (each compound was tested in triplicate). 0.02% vol/vol DMSO and basal medium served as negative controls, heparin.sup.22 served as a positive control. After one week, cells were fixed and analyzed via immunocytochemistry. Immunocytochemistry was performed as described above: cells were immunolabeled for TUJ1 (mouse ?-TUBB3, 1:1000, BIOLEGEND, 801202) and GFAP markers (rabbit ?-GFAP, 1:500, DAKO, Z0334). Nuclei were stained with 4-6-diamidino-2-phenylindole (DAPI, Roche). Microscopy was performed using ArrayScan?XTI (ThermoFisher) imaging platform. 15 images per well were acquired and analyzed by CellProfiler. Number of TUJ1+/DAPI cells was counted and compared to DMSO.
[0131] Myelinating Cell Cultures from Primary Murine Spinal Cord.
[0132] Single cell suspensions are prepared from spinal cord of mouse embryos (E13) (adapted from Thomson, 2008) and 1.5?10.sup.5 cells/well were plated into 96 well plates. Over time, these cultures mature and form axons, which later myelinate. Using spinal cord tissue facilitates the quantification of mature MBP+ oligodendrocytes and newly formed myelin by in-house high-content imaging system (Operetta High Content Imaging System, Perkin Elmer) with a 20? lens. From each well, 25 fields in a 5?5 matrix were scanned. Thirty-two Front Runners compounds were tested in replicates of five at 1 ?M/DMSO, while T3, benzotropine and clemastine were used as positive controls, DMSO as negative/solvent control. Two experimental paradigms were applied: Early treatment: exposure to experimental agent from DIV7 to DIV14; Late treatment: exposure to experimental agent from DIV14-DIV21. On DIV21, cultures were fixed and stained (myelin: MBP, axons: NF200; nuclei: Hoechst). Imaging data were analysed using CellProfiler and in-house generated analysis pipeline.
[0133] Screening for Neurotoxic or Regenerative Effect of Compounds on H9-Derived Human Neural Stem Cells.
[0134] H9-derived human neural stem cells (H9 hNSCs, Gibco) were cultured according to the manufacturer's instructions. Briefly, H9 hNSCs were expanded and subsequently differentiated in neurobasal medium, 2% B27, 1% Glutamax, and 1% penicillin/streptomycin, supplemented with 10 ng/ml BDNF (Peprotech), and 2 ng/ml recombinant human GDNF (Peprotech). After 7 days, 500 ?M of db-cAMP (N6,2-O-dibutyryladenosine 3,5-cyclic monophosphate, Sigma) was added.
[0135] The metabolic activity/viability of selected compounds (32 Front Runners+24 compounds from the Short list) was evaluated by CellTiter-Glo? Luminescent Cell Viability Assay. The primary screen of Front Runner List (32 compounds)+24 compounds from Short List) on H9-derived human neurons was performed at 10 ?M concentration. The validation of hits from primary screen on H9-derived human neurons was performed at 10 ?M concentration.
[0136] Target Genes mRNA Expression Profile
[0137] The cDNA obtained from the Neuro2 A cell line, mouse cortical neurons and human iPSC-derived neurons were used for target validation by qRT-PCR. cDNA samples were stored at ?20? C. until the analyses were performed. In details, the master mix (one per molecular target) was prepared at a final volume of 25 ?l which contained 5?cDNA synthesis buffer (Promega), 0.2 mM of dNTPs, 1.5 mM MgCl2, 1 ?M of forward and reverse primers, 0.5 ?l of GoTaq DNA polymerase (Promega) and 20-40 ng of cDNA. The PCR thermal cycling was performed in Eppendorf Mastercycler thermal cycler following the protocol: denaturation at 95? C. for 2 minutes, followed by 35 cycles at 95? C. for 30 seconds, annealing for 30 seconds at 57? C. for mSIGMAR1; at 59? C. for hTACR1 pair1 and hSIGMAR1; at 60? C. for hTACR1 pair2. The extension was 30 seconds or 1 minute at 72? C., and the final extension was at 72? C. for 10 minutes. To determine the band size, the amplification products were run on 2% agarose gel and stained with Bioatlas Clear DNA stain. Following primer sequences were used:
TABLE-US-00002 TACR1Humanprimerspair1 Forward (SEQID.No.1) GCCTGTTCTACTGCAAGTTCCAC Reverse (SEQID.No.2) CACAGATGACCACTTTGGTGGC TACR1Humanprimerspair2 Forward (SEQID.No.3) AACCCCATCATCTACTGCTGC Reverse (SEQID.No.4) ATTTCCAGCCCCTCATAGTCG TACR1Mouse Forward (SEQID.No.5) GTTCATCCAGCAGGTCTACCTG Reverse (SEQID.No.6) TCACCAGCACTGATGAAAGGGC SIGMAR1Human Forward (SEQID.No.7) GTCCGAGTATGTGCTGCTCTTC Reverse (SEQID.No.8) GAAGACCTCACTTTTGGTGGTGC SIGMAR1Mouse Forward (SEQID.No.9) GGACCATGAGCTTGCCTTCT Reverse (SEQID.No.10) CCCAGTATCGTCCCGAATGG HRH3Human Forward (SEQID.No.11) TCTTCCTGCTCAACCTCGCCAT Reverse (SEQID.No.12) ACTACCAGCCACAGCTTGCAGA HRH3Mouse Forward (SEQID.No.13) CGAGCCCTGTGAGCCTG Reverse (SEQID.No.14) GCAGAAGGCACCCACGAG
[0138] Results
[0139] Based on the clinical and biological evidence available for PMS, authors tested if directly or indirectly favoring neuroprotection could prevent disease progression. Promoting resistance to axonal degeneration and increasing neuronal survival in demyelinating conditions can extend the period in which axons can be remyelinated. On the other side, promotion of oligodendrocyte proliferation and differentiation is a valuable alternative because indirectly favors neuroprotection.
[0140] To accomplish these goals, molecules of interest were prioritized in silico, and then analyzed in appropriate phenotypic assays.
[0141] The methodological approach consists of starting with a large portfolio of repurposed or abandoned molecules (1500) that have been screened in silico. Selected molecules (511) have been transferred to large and mid-scale screening (hit identification). Thirty-nine selected molecules passed stepwise functional assays in oligodendrocytes and neurons, which provided validated data supporting a neuroprotective and/or remyelinating therapeutic effect.
[0142] 1. In Silico Platform to Prioritize Sets of Therapeutic Compounds that Passed a Safety Assessment in Man.
[0143] To bioinformatically approach Progressive MS, a selection of keyworks have been used as input for SPOKE, such as myelin formation, oligodendrocyte differentiation, myelin, etc. An enriched list of 511 compounds with a DWPC<0.0005 has been generated starting from the entire SPOKE network that include 1,941,858 nodes of 12 types.
[0144] The list of compounds was analyzed to remove redundant items because of structure chemical similarity and to run predictive in silico pharmacological strategies to assess whether those compounds could pass the blood brain barrier (BBB).
[0145] 2. Oligodendroglia-Based Assays
[0146] 2.1 Toxicity Assays on Neonatal Mouse Oligodendrocyte Progenitor Cells.
[0147] Toxicity of the full list of drugs (274) at 10 ?M have been evaluated on neonatal mouse oligodendrocyte progenitor cells via metabolic activity by MTT. First, drugs able to reduce OPC viability were selected, identifying 90 compounds with a cytotoxic effect defined by the Efficacy Ratio ER (absorbance of drug/absorbance of vehicle; PMID: 28387380) (ER?0.4) which have not been further investigatedand 44 drugs inhibiting OPC metabolism at lower level (0.5<ER<0.8)which were analyzed in the next experimental setting. As a result, 90 compounds were cytotoxic, 44 compounds with low toxicity were retested at 1 and 0.1 ?M, 140 compounds (ER>0.8) were non-toxic and were re-tested. Results are shown in
[0148] 2.2 Toxicity Assays on Rat Oligodendrocyte Progenitor CG4 Line.
[0149] Compounds (272) were tested at 1 ?M, using a double fluorescence CG4 cell line (rat OPC line), 9 cis-retinoic acid (1 ?M) served as a positive control. Toxicity was estimated, based on the compounds' effect on cell density: 32/272 (11.7%) compounds promoted OPC proliferation (fold change >1.5), 126/272 (46%) resulted in no toxicity (1<fold change <1.5), 75/272 (27.5%) were moderately toxic (0.5<fold change <1.0), while 39/272 (14.3%) exhibited high toxicity (fold change <0.5). Results are shown in
[0150] 2.3 Differentiation Assays on Rat Oligodendrocyte Progenitor CG4 Line.
[0151]
[0152] 2.4 Differentiation of Rat Primary OPC.
[0153] Re-validation of the 49 compounds selected from the short list (160 compounds) using rat primary OPC cultures (compounds tested in triplicates in 3 independent experiments. The secondary validation screen of these compounds performed on rat primary OPC cultures selected 17 best lead compounds with a pro-differentiation activity (MBP+/SOX10+OLs plus compounds/MBP+SOX10+ plus basal medium fold increase) induced a strong differentiation into MBP+OLs (fold increase >1.6). Results are shown in
[0154] 2.5 Differentiation of Human iPS-Derived Neuroprecursors into Oligodendrocytes.
[0155] The effect on oligodendroglial differentiation of 32 compounds (Front runners) was tested. Induced pluripotent stem cells in which the transcription factors SOX10, OLIG2, NKX6.2 were inserted in a doxycycline inducible manner into a human safe harbor were differentiated into neural stem cells. Differentiation into oligodendrocytes was induced by addition of doxycycline. Cells were cultured either in a minimal medium (MM) (negative control) or in MM with the different compounds at a concentration of 1 ?M. Addition of T3 to the minimal medium served as a positive control. The following compounds were able to promote significantly the differentiation into MBP+ oligodendrocytes: Drinabant, Roxadustat, Gsk189254, Casopitant, Saracatinib, Bavisant, PF-03654746, Telatinib, PD-0325901, Danirixin, Ponesimod, Indeglitazar, Ezatiostat hydrochloride, Olcegepant, NS-018, Progesterone and Merestinib. Results are shown in
[0156] 2.6 Human Fetal Neural Precursors (hufNPCs)-Derived OPCs Differentiation.
[0157] 16 compounds were evaluated on human fetal neural precursors (hufNPCs) differentiation and identified 4 compounds that significantly promoted fNPCS differentiation (fold change>1.5, p<0.05). These compounds were Olcegepant, Merestinib, Indeglitazar, Efatutazone hydrochloride. In addition, four compounds namely Bavisant, Telatinib, PD0325901 and Drinabant promoted fNPCS differentiation with moderate significance (fold change>1.3, 0.05<p<0.07). Results are shown in
[0158] 3. Neuronal-Based Assays
[0159] Schematic representation of neuronal-based assay screening strategy is shown in
[0160] 3.1 Characterization of Rodent Primary Neurons
[0161] Primary cultures of murine cortical neurons were established from E16.5-E17.5 embryos and characterized by immunofluorescence at DIV 7 and DIV 14 for expression of neural (MAP2), pre-synaptic (vGLUT1 and NMDAR1) markers (
[0162] 3.2 Evaluation of Compound Cytotoxicity on Primary Murine Cortical Neurons.
[0163] Neural toxicity of 274 compounds have been evaluated: 145/274 (53%) at 1 ?M (
[0164] 3.3 Evaluation of Compounds Neuroprotective Potential.
[0165] The potential neuroprotective activity of 160 selected non-toxic compounds was evaluated on murine cortical neurons (14 DIV) with either 3 h (
[0166] The identified 17 hit compounds were: Tamibarotene, Progesterone, SSR180711, Adenine, GSK189254, Neramexane, Raxatrigine, 0C000459, AMG-319, Hyoscyamine, SB-705498, AZD1981, Ezatiostat hydrochloride Nalfurafine hydrochloride, Pamapimod, Fluocinolone acetonide, L-Serine. The additional potentially NMDA-neuroprotective compound that had a trend versus significance was Tarenflurbil (p=0.09).
[0167] In assay with 24 h pre-treatment, we have identified 32 compounds with a potential neuroprotective capacity against NMDA-induced excitotoxicity with Z>0.5: Istradefylline, Vatalanib, Trimebutine, Alprenolol, Ellagic Acid, SSR180711, Tamibarotene, Adenine, Ezatiostat hydrochloride, Bavisant, Equol, Etazolate (all aforementioned are shown in green in
[0168] 3.4 Morphological Integrity Evaluation.
[0169] The morphological integrity of mouse cortical neurons upon chronic 24 h NMDA (8 ?M) exposure with compounds pre-treatment (3 h) in preventive regimen was evaluated. Control (basal), DMSO, N-acetylcysteine (NAC) served as positive controls, while staurosporine and NMDA were negative controls.
[0170] 38 compounds scored Z>0.5 in neurite length evaluation and 29 compounds scored with Z>0.5 in branching evaluation. 26 compounds that preserved both neurite length and the network integrity (branching) were: Bifeprunox, SSR180711, Mitiglinide, AZD-7624, Olcegepant, RG7314, Neramexane, Raxatrigine, Adenine, Hyoscyamine, Etazolate (Shown in
[0171] 42 compounds were screened to evaluate the morphological integrity of cortical and striatal neurons upon chronic (24 h) NMDA exposure at concentration of 20 ?M with compounds pre-treatment (24 h) in preventive regimen (
[0172] 3.5 Differentiation of Human Neural Stem Cell and Human iPSC Derived NPCs. The scheme for the generation of glutamatergic neurons from iPSC is shown in
[0173] Evaluation of cytotoxicity of 160 selected compounds on iPSC-derived neurons (DIV45). Cytotoxicity of selected 160 compounds was evaluated on iPSC-derived neurons (45 DIV) from a healthy control line: 12/160 compounds exhibited moderate cytotoxic effect (?65-80% viability compared to DMSO), namely BMS-833923, PD-0325901, Casopitant, Zibotentan, Istradefylline, OC000459, K-877 Pemafibrate, Reminertant, Derenofylline, Basimglurant, Neramexane. Results are shown in
[0174] 3.6 ROS-Mediated Neuroprotective Assay on hNeu.
[0175] 32 Front runners and 7 compounds from short list were tested on iPSC-derived neurons from three control lines in ROS-mediated assay to evaluate a neuroprotective potential of selected compounds. Three independent experiments were performed for CTR4 and CTR8,
[0176] As a summary for all three control lines, 5 compounds have been identified with a potential neuroprotective effect from tBuOOH-mediated insult, such as NS-018, p<0.0001; Casopitant, p<0.0001; Saracatinib, p=0.0007; Ezatiostat HCl, p=0.002; Olcegepant, p=0.012.
[0177] 3.7 Human Embryonic and Fetal Neural Precursors (hufNPCs) Derived Neurons.
[0178] 160 selected non-toxic compounds pro-differentiating properties were evaluated on human embryonic and fetal neural precursors (hufNPCs). Assay was performed twice and run in triplicates in 96-well plates, the compound performance was compared to DMSO. Hit-compound Tamibarotene (Retinoic acid receptor alpha/beta agonist) was identified with significantly promoted neuronal differentiation compared to DMSO and heparin..sup.22 In addition, other seven compounds with a potential neural pro-differentiating properties were identified, among which were LY-2090314 (Glycogen synthase kinase 3 beta (GSK3) inhibitors).sup.34, Doramapimod, Acumapimod, Losmapimod (all three compounds are P38 mitogen-activated protein kinase inhibitors).sup.35, Marimastat (Metalloprotease inhibitors), Rupatadine (Histamine H1 receptor antagonists) and Quizartinib (Fms-like tyrosine kinase 3 inhibitors). Results are shown in
[0179] 3.8 Myelinating Cell Cultures from Primary Murine Spinal Cord.
[0180] Thirty-two Front Runners compounds were tested in replicates of five at 1 ?M/DMSO, while T3, benztropine and clemastine were used as positive controls, DMSO as negative/solvent control. Two experimental paradigms were applied: Early treatment: exposure to experimental agent from DIV7 to DIV14; Late treatment: exposure to experimental agent from DIV14-DIV21. In Early treatment paradigm in myelin area evaluation were identified Vanoxerine, NS-018, Tamibarotene, Progesterone, Ponesimod, Casopitant, PF-0365476, Drinabant, Saracarinib. In quantification of myelinated axons were identified Vanoxerine, NS-018, Casopitant. In Late treatment paradigm in myelin area evaluation were identified Vanoxerine, Roxadustat, Tamibarotene, Drinabant, Progesterone, Saracatinib. In quantification of myelinated axons were identified Vanoxerine, Drinabant, Roxadustat.
[0181] 3.9 Screening for Neurotoxic or Regenerative Effect of Compounds on H9-Derived Human Neural Stem Cells.
[0182] 32 Front Runners were tested at 10 ?M on H9-derived human neuronal cultures and viability was evaluated by CellTiter-Glo? Luminescent Cell Viability Assay. Cumulative Z-scores of three independent screenings for neurotoxic or regenerative effect identified 7 potential hits, namely Casopitant, SU14813, Alprenolol, Indeglitazar, PD-0325901, Lemborexant and Ezatiostat Hydrochloride.
[0183] The tested compounds were: I-0416473-001 (MERESTINIB), I-0416445-001 (CASOPITANT), I-0416442-001 (PF-03654746), I-0416429-001 (DRINABANT), I-0416311-001 (SU14813), I-0416303-001 (ACUMAPIMOD), I-0416296-001 (DANIRIXIN), I-0416295-001 (ALPRENOLOL), I-0416285-001 (NS-018), I-0416283-001 (PAC-14028), I-0416277-001 (INDEGLITAZAR), I-0416268-001 (PD-0325901), I-0416266-001 (BAVISANT), I-0416265-001 (GSK189254), I-0416261-001 (LEMBOREXANT), I-0416182-002 (EZATIOSTAT HYDROCHLORIDE), I-0416164-001 (BMS-833923), I-0416152-001 (PONESIMOD), I-0416123-001 (GANDOTINIB), I-0416111-001 (TELATINIB), I-0416106-001 (ROXADUSTAT), I-0416081-001 (TALADEGIB), I-0218270-002 (SARACATINIB), I-0194818-003 (DOVITINIB), I-0194758-002 (EQUOL), I-0194657-003 (TAMIBAROTENE), I-0194462-002 (RUPATADINE), I-0043558-002 (VANOXERINE), I-0013215-002 (PROGESTERONE).
[0184] 3.10 Target Genes mRNA Expression Profile
[0185] RT-PCR assessed mRNA levels to determine the expression of predicted target genes for Casopitant TACR1 and SIGMAR1 and Bavisant target gene HRH3. SIGMAR1 was identified to be expressed in hiPSC-derived NPCs, hiPSC-derived mature neurons, mouse cortical neurons, and Neu2 A. Instead, TACR1 was expressed at a low level in hiPSC-derived neurons (
REFERENCES
[0186] 1. Olesen, J., Gustavsson, A., Svensson, M., Wittchen, H. U. & Jonsson, B. The economic cost of brain disorders in Europe. Eur. J. Neurol. 19, 155-162 (2012). [0187] 2. Zaratin, P., Battaglia, M. A. & Abbracchio, M. P. Nonprofit foundations spur translational research. Trends Pharmacol. Sci. 35, 552-555 (2014). [0188] 3. Adelman, G., Rane, S. G. & Villa, K. F. The cost burden of multiple sclerosis in the United States: A systematic review of the literature. Journal of Medical Economics 16, 639-647 (2013). [0189] 4. Hartung, D. M., Bourdette, D. N., Ahmed, S. M. & Whitham, R. H. The cost of multiple sclerosis drugs in the US and the pharmaceutical industry. Neurology 84, 2185-2192 (2015). [0190] 5. Patrikios, P. et al. Remyelination is extensive in a subset of multiple sclerosis patients. Brain 129, 3165-3172 (2006). [0191] 6. Skulina, C. et al. Multiple sclerosis: Brain-infiltrating CD8+ T cells persist as clonal expansions in the cerebrospinal fluid and blood. Proc. Natl. Acad. Sci. U.S.A. 101, 2428-2433 (2004). [0192] 7. Larochelle, C. et al. Melanoma cell adhesion molecule-positive CD8 T lymphocytes mediate central nervous system inflammation. Ann. Neurol. 78, 39-53 (2015). [0193] 8. Nave, K.-A. Myelination and the trophic support of long axons. Nat. Rev. Neurosci. 11, 275-283 (2010). [0194] 9. Siffrin, V., Vogt, J., Radbruch, H., Nitsch, R. & Zipp, F. Multiple sclerosis-candidate mechanisms underlying CNS atrophy. Trends in Neurosciences 33, 202-210 (2010). [0195] 10. G, G. Multiple Sclerosis Cerebrospinal Fluid Biomarkers. Dis. Markers 22, (2006). [0196] 11. Fischer, M. T. et al. Disease-specific molecular events in cortical multiple sclerosis lesions. Brain 136, 1799-1815 (2013). [0197] 12. Paling, D. et al. Sodium accumulation is associated with disability and a progressive course in multiple sclerosis. Brain 136, 2305-2317 (2013). [0198] 13. Witte, M. E., Mahad, D. J., Lassmann, H. & van Horssen, J. Mitochondrial dysfunction contributes to neurodegeneration in multiple sclerosis. Trends Mol. Med. 20, 179-187 (2014). [0199] 14. Dutta, R. et al. Mitochondrial dysfunction as a cause of axonal degeneration in multiple sclerosis patients. Ann. Neurol. 59, 478-489 (2006). [0200] 15. PRINEAS, J. W., KWON, E. E., CHO, E.-S. & SHARER, L. R. Continual Breakdown and Regeneration of Myelin in Progressive Multiple Sclerosis Plaques. Ann. N. Y. Acad. Sci. 436, 11-32 (1984). [0201] 16. Kuhlmann, T. et al. Differentiation block of oligodendroglial progenitor cells as a cause for remyelination failure in chronic multiple sclerosis. Brain 131, 1749-1758 (2008). [0202] 17. Davalos, D. et al. Fibrinogen-induced perivascular microglial clustering is required for the development of axonal damage in neuroinflammation. Nat. Commun. 3, (2012). [0203] 18. Piaton, G. et al. Class 3 semaphorins influence oligodendrocyte precursor recruitment and remyelination in adult central nervous system. Brain 134, 1156-1167 (2011). [0204] 19. Matute, C., Sanchez-G?mez, M. V., Martinez-Mill?n, L. & Miledi, R. Glutamate receptor-mediated toxicity in optic nerve oligodendrocytes. Proc. Natl. Acad. Sci. U.S.A. 94, 8830-8835 (1997). [0205] 20. Lee, Y. et al. Oligodendroglia metabolically support axons and contribute to neurodegeneration. Nature 487, 443-448 (2012). [0206] 21. Kremer, D., K?ry, P. & Dutta, R. Promoting remyelination in multiple sclerosis: Current drugs and future prospects. Mult. Scler. J. 21, 541-549 (2015). [0207] 22. Colombres, M. et al. Heparin activates Wnt signaling for neuronal morphogenesis. J. Cell. Physiol. 216, 805-815 (2008). [0208] 23. Hall, S. M. The Effect of Injections of Lysophosphatidyl Choline into White Matter of the Adult Mouse Spinal Cord. J. Cell Sci. 10, 535-546 (1972). [0209] 24. Scolding, N. J., Rayner, P. J. & Compston, D. A. S. Identification of A2B5-positive putative oligodendrocyte progenitor cells and A2B5-positive astrocytes in adult human white matter. Neuroscience 89, 1-4 (1999). [0210] 25. Agresti, C. Reversible inhibitory effects of interferon-? and tumour necrosis factor-? on oligodendroglial lineage cell proliferation and differentiation in vitro. Eur. J. Neurosci. 8, 1106-1116 (1996). [0211] 26. Eleuteri, C. et al. A staged screening of registered drugs highlights remyelinating drug candidates for clinical trials. Sci. Rep. 7, 1-15 (2017). [0212] 27. Mei, F. et al. Micropillar arrays as a high-throughput screening platform for therapeutics in multiple sclerosis. Nat. Med. 20, 954-960 (2014). [0213] 28. Huang, J. K. et al. Retinoid X receptor gamma signaling accelerates CNS remyelination. Nat. Neurosci. 14, 45-55 (2011). [0214] 29. Ehrlich, M. et al. Rapid and efficient generation of oligodendrocytes from human induced pluripotent stem cells using transcription factors. Proc. Natl. Acad. Sci. U.S.A. 114, E2243-E2252 (2017). [0215] 30. Buchet, D., Garcia, C., Deboux, C., Nait-Oumesmar, B. & Baron-Van Evercooren, A. Human neural progenitors from different foetal forebrain regions remyelinate the adult mouse spinal cord. Brain 134, 1168-1183 (2011). [0216] 31. Caraus, I., Alsuwailem, A. A., Nadon, R. & Makarenkov, V. Detecting and overcoming systematic bias in highthroughput screening technologies: A comprehensive review of practical issues and methodological solutions. Brief Bioinform. 16, 974-986 (2015). [0217] 32. Qi, Y. et al. Combined small-molecule inhibition accelerates the derivation of functional cortical neurons from human pluripotent stem cells. Nat. Biotechnol. 35, 154-163 (2017). [0218] 33. Deshmukh, V. A. et al. A regenerative approach to the treatment of multiple sclerosis. Nature 502, 327-332 (2013). [0219] 34. Telias, M. & Ben-Yosef, D. Title: Neural differentiation is increased by GSK-3? inhibition and decreased by tankyrase inhibition in human neural precursor cells Running head: Wnt signaling in human neural precursors. doi:10.1101/509638 [0220] 35. Aouadi, M. et al. p38 Mitogen-Activated Protein Kinase Activity Commits Embryonic Stem Cells to Either Neurogenesis or Cardiomyogenesis. Stem Cells 24, 1399-1406 (2006). [0221] 36. Pamies et al, 2017, doi: 10.14573/altex.1609122 [0222] 37. Ferreira T, Blackman A, Oyrer J, Jayabal A, Chung A, Watt A, Sj?str?m J, van Meyel D. (2014), Neuronal morphometry directly from bitmap images, Nature Methods 11(10): 982-984