Method for the incorporation of formaldehyde into biomass

Abstract

The present disclosure relates to a method for the incorporation of formaldehyde into biomass comprising the following enzymatically catalyzed steps: (1) condensation of pyruvate with formaldehyde into 4-hydroxy-2-oxobutanoic acid (HOB); (2) amination of the thus produced 4-hydroxy-2-oxobutanoic acid (HOB) to produce homoserine; (3) conversion of thus produced homoserine to threonine; (4) conversion of the thus produced threonine into glycine and acetaldehyde or acetyl-CoA; (5) condensation of the thus produced glycine with formaldehyde to produce serine; and (6) conversion of the thus produced serine to produce pyruvate, wherein said pyruvate can then be used as a substrate in step (1). The disclosure also relates to enzymes for catalyzing the corresponding enzymatic reactions and recombinant microorganisms which express the enzymes for catalyzing the corresponding enzymatic reactions.

Claims

1. A method for incorporation of formaldehyde into carbon compounds the can be assimilated into metabolism, said method comprising the following sequence of enzymatically catalyzed steps, wherein the method is carried out in vitro or in vivo: (1) condensation of pyruvate with a first formaldehyde into 4-hydroxy-2-oxobutanoic acid (HOB); (2) amination of the thus produced 4-hydroxy-2-oxobutanoic acid (HOB) to produce homoserine; (3) conversion of the thus produced homoserine to threonine; (4) conversion of the thus produced threonine into glycine and acetaldehyde or acetyl-CoA; (5) condensation of the thus produced glycine with a second formaldehyde to produce serine; and (6) conversion of the thus produced serine to produce pyruvate, wherein said pyruvate can then be used as a substrate in step (1); wherein the method comprises at least one of (a) in step (1) the condensation of pyruvate with formaldehyde into 4-hydroxy-2-oxobutanoic acid (HOB) is achieved using an aldolase classified in EC 4.1.2.; (b) in step (2) the amination of the 4-hydroxy-2-oxobutanoic acid (HOB) to produce homoserine is achieved by using an aminotransferase enzyme classified in EC 2.6.1. or by an amino acid dehydrogenase (EC 1.4.1._); (c) in step (3) the conversion of homoserine to threonine is achieved by (i) phosphorylation of the homoserine to produce o-phosphohomoserine achieved by using a homoserine kinase (EC 2.7.1.39); and (ii) dephosphorylation of the thus produced o-phosphohomoserine to produce threonine achieved by using a threonine synthase (EC 4.2.3.1); (d) in step (4) the conversion of the threonine into glycine and acetaldehyde is achieved by using a threonine aldolase (selected from the group consisting of EC 4.1.2.5, EC 4.1.2.6, EC 4.1.2.48 and EC 4.1.2.49) and/or the conversion of the threonine into glycine and acetyl-CoA is achieved by a combination of a threonine dehydrogenase (EC 1.1.1.103) and a 2-amino-3-ketobutyrate CoA ligase (EC 2.3.1.29); (e) in step (5) the condensation of the glycine with formaldehyde to produce serine is achieved by using a threonine aldolase selected from the group consisting of EC 4.1.2.5, EC 4.1.2.6, EC 4.1.2A8 and EC 4.1.2.49; and (f) in step (6) the conversion of the thus produced serine to produce pyruvate is achieved by using a serine deaminase (EC 4.3.1.17) or a threonine deaminase (EC4.3.1.19); or any combination of (a) to (f).

2. The method of claim 1, wherein the formaldehyde used for the condensation in step (1) and/or (5) is provided by the oxidation of methanol.

3. The method of claim 1, wherein the formaldehyde in step (1) and/or (5) is provided by (a) converting methanol enzymatically into formaldehyde using a methanol dehydrogenase (EC 1.1.1.244) or a methanol dehydrogenase (cytochrome c) (EC 1.1.2.7); and/or (b) converting methanol enzymatically into formaldehyde using an alcohol oxidase (EC 1.1.3.13).

Description

(1) In another embodiment the microorganism shows any possible combination of gene deletions/inactivations as described above.

(2) FIG. 1 shows a schematic version of a representative example of the enzymatic steps involved in the method according to the present invention for incorporating formaldehyde. (1) Condensation of pyruvate with formaldehyde into 4-hydroxy-2-oxobutanoic acid (HOB) via an aldolase; (2) amination of the thus produced 4-hydroxy-2-oxobutanoic acid (HOB) to produce homoserine; (3) phosphorylation of thus produced homoserine to produce o-phosphohomoserine; (4) dephosphorylation of the thus produced o-phosphohomoserine to produce threonine; (5) conversion of the thus produced threonine into glycine and acetaldehyde; (6) condensation of the thus produced glycine with formaldehyde to produce serine; and (7) conversion of the thus produced serine to produce pyruvate. Reactions based on promiscuous enzyme activities are shown in color.

(3) FIG. 2 shows in vivo serine aldolase (SAL) activity catalyzed by LtaE: (a) LtaE catalyzes aldol condensation between glycine and different aldehyde. Threonine aldol (LTA) is its primary function, while seine aldolase is a promiscuous activity (Contestabile et al., Eur. J. Biochem. 268 (2001), 65084525). (b), (c) two selection schemes for the in vivo activity of the SAL reaction. Carbon sources are shown in purple (glucose not shown) while the formaldehyde moiety is shown is green. (b) ?frmRAB ?serA ?glyA strain in which methanol assimilation is required for the biosynthesis of swine. (c) ?frmRAB ?serA ?gcvTHP strain, in which methanol assimilation is required for the biosynthesis of serine and the cellular C.sub.1 moieties. (d), (e) Growth with different concentrations of methanol confirm the activity of the SAL reaction. In all cases, 10 mM glucose and 10 mM glycine were added to the medium. Methanol dehydrogenase (mdi) and ltaE were expressed from a plasmid. Each growth curve represents the average of three replicates, which differ from each other by les than 5%. (f), (g) Labeling pattern of proteinogenic glycine (GLY), serine (SER), threonine (THR), methionine (MET) and histidine (HIS) upon feeding with .sup.13C-methanol as well as unlabeled glucose and glycine.

(4) FIG. 3 shows that Mn.sup.2+ supplementation improves LtaE dependent growth. While Mn.sup.2+ is a cofactor of LtaE, M medium contains only 0.08 ?M Mn.sup.2+. Addition of 50 ?M MnCl.sub.2 increases the growth rate and yield of the LtaE-dependent strains. Error bars represent standard deviations, n=3.

(5) FIG. 4 Figure shows that LtaE can operate as threonine aldolase and serine aldolase simultaneously. (a) Selection scheme for serine and glycine production from threonine and homoserine. (b) The two selection strains, deleted in the LtaE-independent threonine cleavage system (?kbl-tdh), can grow with methanol as serine precursor. Glycine is either provided externally (10 mM, black lines) or produced internally, either from externally added threonine (10 mM, red lines) or from the internal pool of threonine (green lines). The latter growth confirms that LtaE can catalyze the LTA and SAL reactions simultaneously. In all cases, 10 mM glucose and 500 mM methanol were added. Each growth curve represents the average of three replicates, which differ from each other by less than 5%. (c) Labeling pattern of proteinogenic glycine and serine upon feeding with glucose labeled at different carbon as well as labeled or unlabeled methanol. This labeling confirms that all cellular serine is produced from glycine and methanol even when glycine is produced internally from threonine biosynthesis and degradation.

(6) FIG. 6 shows in vivo activity of enzymes condensing pyruvate and formaldehyde into HOB and converting HOB into homoserine, respectively. (a) A selection scheme for the in vivo activity of the reactions of condensing pyruvate and formaldehyde into HOB and converting HOB into homoserine. Carbon sources are shown in purple while the formaldehyde moiety is shown is green. (b) Several E. coli enzymes are known to catalyze an aldolase reaction with pyruvate as acceptor and might be able to accept formaldehyde as a donor. The sequence similarity of these enzyme is indicated by the schematic tree to the left. (c) Four tested aldolases, once overexpressed together with methanol dehydrogenase, support growth of the selection strain. Glucose was added at 10 mM, methanol at 500 mM, diaminopimelate at 0.25 mM, and isoleucine at 1 mM. Each growth curve represents the average of three replicates, which differ rom each other by less than 5%. (d) Labeling pattern of proteinogenic methionine (MET), threonine (THR), lysine (LYS), and aspartate (ASP) upon feeding with unlabeled glucose, diaminopimelate and isoleucine as well as .sup.13C-methanol. The results confirm that all cellular threonine and methionine are derived from the enzymatic activity condensing pyruvate with formaldehyde and from the aminase reaction.

(7) FIG. 6 shows a multiple sequence alignment of candidate enzymes condensing pyruvate and formaldehyde into HOB. Protein sequence of RhmA/YfaU (P76469; SEQ ID NO:1), GarL (P23522; SEQ ID NO:4), YagE (P75682; SEQ ID NO:2), YjhH (P39359; SEQ ID NO:3), Eda (P0A955; SEQ ID NO: 45), DgoA (Q68F16; SEQ ID NO: 46) and MhpE (P51020; SEQ ID NO: 47) were obtained from UniProt. Sequence alignment was produced by MAFFT (Katoh and Standley, Mol. Biol. Evol. 30 (2013), 772-780. ESPpript 3.0 (Rober and Gouet, 42 (2014), W320-W324) was used for displaying the aligned sequences with the 3D structure of GarL, 1dxe (Izard and Blackwell, EMBO J. 19 (2000), 3849-3856). Protein ?-helixes and ?-sheets are indicated above, sequence consensus >70% are show in cons.

(8) FIG. 7 shows protein structure based alignments of candidate enzymes condensing pyruvate and formaldehyde into HOB. Available protein structures, 1dxf (Izard and Blackwell, EMBO J. 19 (2000), 3849-3856) for GarL, 2vwt (Res et al., Biochemistry-US 47 (2006), 9955-9965) for RhmA, 4ptn (Manicka et al., Proteins 71 (2008), 2102-2108) for YagE, 2v82 (Walters et al., Bioorganic & Medicinal Chemistry 16 (2008), 710-720) for DgoA and 1eua (Allard et al., Proc. Natl Acad. Sci. USA 98 (2001), 3679-3684) for Eda were obtained from RCSB PDB. Structures was aligned by TM-align (Zhang et al., Nucleic Acids Res. 33, 2302-2309 (2005). within PyMOL. Results of the alignments, RMSD and TM-score, are shown in the table. The figures were rendered using PyMOL.

(9) FIG. 8 shows effects of genomic overexpression of the enzyme of the homoserine cycle. ThrB (HSK), ThrC (TS), AlaC* (AlaC A142P Y275D) or AspC were overexpressed by exchanging their native promoters with synthetic promoters within the selection strain ?frmRAB ?asd. Each growth curve represents the average of three replicates, which differ from each other by less than 5%.

(10) In this specification, a number of documents including patent applications are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

(11) The invention will now be described by reference to the following examples which are merely illustrative and are not to be construed as a limitation of the scope of the present invention.

EXAMPLES

(12) To confirm the in vivo feasibility of the homoserine cycle, several E. coli gene deletion strains were constructed whose growth is coupled to the activity of different pathway segments. Using this approach it could be demonstrated that all required promiscuous enzymes are active enough to enable growth of the auxotrophic strains.

(13) Methods

(14) Strains and genomic manipulation. Strains used in this study are listed in Table 1.

(15) TABLE-US-00001 TABLE 1 LIST OF E. COLI STRAINS REFERENCE OR STRAIN GENOTYPE SOURCE MG1655 K-12 F.sup.? ?.sup.? ILVG.sup.? RFB-50 RPH-1 LAB COLLECTION SIJ488 MG1655 TN7::PARA-EXO-BETA-GAM; PRHA- 1 F.sup.? ENDA1 GLNV44 THI-1 RECA1 RELA1 GYRA96 DH5A DEOR NUPG PURB20 ?80DLACZ?M15 LAB COLLECTION ?(LACZYA-ARGF)U169, HSDR17(R.sub.K.sup.? M.sub.K.sup.+), ?.sup.? SIJ488 ?FRMRAB ?SERA ?GLYA THIS STUDY SIJ488 ?FRMRAB ?SERA ?GCVTHP THIS STUDY SIJ488 ?FRMRAB ?SERA ?GLYA ?KBL-TDH THIS STUDY SIJ488 ?FRMRAB ?SERA ?GCVTHP ?KBL-TDH THIS STUDY SIJ488 ?FRMRAB ?ASD THIS STUDY PTHRBC_D SIJ488 ?P.sub.THRLABC::CAP-P.sub.PGI-20-THRBC THIS STUDY PALAC_D SIJ488 ?P.sub.ALAC::CAP-P.sub.PGI-20-ALAC* THIS STUDY PASPC_D SIJ488 ?P.sub.ASPC::CAP-P.sub.PGI-20-ASPC THIS STUDY SIJ488 ?FRMRAB ?ASD ?P.sub.THRLABC::P.sub.PGI-20-THRBC THIS STUDY SIJ488 ?FRMRAB ?ASD ?P.sub.ALAC::P.sub.PGI-20-ALAC* THIS STUDY SIJ488 ?FRMRAB ?ASD ?P.sub.ASPC::P.sub.PGI-20-ASPC THIS STUDY SIJ488 ?FRMRAB ?ASD ?P.sub.THRLABC::P.sub.PGI-20-THRBC THIS STUDY ?P.sub.ALAC::P.sub.PGI-20-ALAC* SIJ488 ?FRMRAB ?ASD ?P.sub.THRLABC::P.sub.PGI-20-THRBC THIS STUDY ?P.sub.ASPC::P.sub.PGI-20-ASPC .sup.1Jensen et al. (Sci. Rep. 5 (2015), 17874)

(16) An E. coli MG1655 derived strain SIJ488 (Jensen et al., Scientific Reports 5 (2015), 17874) was used as the parental strain for genomic modifications. Iterative rounds of A-Red recombineering (Jensen et al., loc. cit.) or P1 phage transduction (Thomason et al., Curr. Protoc. Mol. Biol. Chapter 1, Unit 1 17 (2007)) were used for gene deletions. For the recombineering, selectable resistance cassettes were generated via PCRprimers 50 bp homologous arms as in Baba et al. (Mol. Syst. Biol. 2 (2006), 2008-2008)using the FRT-PGK-gb2-neo-FRT (Km) cassette (Gene Bridges, Germany) for kanamycin resistance (Km) and the pKD3 plasmid (GenBank: AY048742; Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97 (2000), 6640-6645) as template for chloramphenicol resistance cassettes (CAP). The procedures of the deletion, verification and antibiotic cassette removal are detailed in Wenk et al. (Methods Enzymol. 608 (2018), 329-367).

(17) A similar strategy was applied to exchange the genomic promoter of target genes. A constitutive strong promoter pgi-20 (Brastsch St al., Biotechniques 45 (2008), 335-337) and a ribosome binding site C (AAGTTAAGAGGCAAGA (SEQ ID NO: 44); Zelcbuch et al., Nucleic Acids Res. 41 (2013), e98.) were constructed downstream of the CAP cassette using primers listed shown in Table 2.

(18) TABLE-US-00002 TABLE2 LISTOFOLIGOPRIMERSUSEDINTHISSTUDY PRIMER SEQUENCE(5.fwdarw.3) RHMA_F ATGCATCATCACCATCACCACAACGCATTATTAAGCAATCCC(SEQIDNO:6) RHMA_R GCGCTAGCTCAATAACTACCTTTTATGC(SEQIDNO:7) YAGE_F ATGCATCATCACCATCACCACACCGCAGTCCGCGTTGTTC(SEQIDNO:8) YAGE_R GCTAGCATTACCAAAGCTTGAGCTGTTG(SEQIDNO:9) YJHH_F ATGCATCATCACCATCACCACAAAAAAATTCAGCGGCATTATTCC(SEQIDNO:10) YJHH_R GCTAGCATTAGACTGGTAAAATGCCCT(SEQIDNO:11) YJHH_C TAATAAAGGGGTTGACGGGCTG(SEQIDNO:12) YJHH_D CAGCCCGTCAACCCCTTTATTA(SEQIDNO:13) YJHH_A GTAACCATTGTTGACGGGCGAG(SEQIDNO:14) YJHH_B CTCGCCCGTCAACAATGGTTAC(SEQIDNO:15) DGOA_F ATGCATCATCACCATCACCACACAGTGGCAAACTAAACTCC(SEQIDNO:16) DGOA_R GCTAGCATCATTGCACTGCCTCTCG(SEQIDNO:17) DGOA_B TCCCGCTGAACTCCCCACAATG(SEQIDNO:18) DGOA_C CATTGTGGGGAGTTCAGCGGGA(SEQIDNO:19) EDA_A GAATGCATCATCACCATCACCACAAAAACTGGAAAACAAGTGCAGAATCAATCCTGACCAC (SEQIDNO:20) EDA_B GAACGGACCCGCAATCGCTTGCAGGGCTTTCAC(SEQIDNO:21) EDA_C GTGAAAGCCCTGCAAGCGATTGCGGGTCCGTTC(SEQIDNO:22) EDA_D CGCTAGCTCTAGATTACAGCTTAGCGCCTTCTACAGCTTCACG(SEQIDNO:23) MHPE_F ATGCATCATCACCATCACCACAAACGGTAAAAAACTTTATATCTCGGACG(SEQID NO:24) MHPE_R GCTAGCATTATTTGTTGTTGCGCAGATC(SEQIDNO:25) LTAE_F ATGCATCATCACCATCACCACATTGATTTACGCAGTGATACCGTTACCCGACC(SEQID NO:26) LTAE_B GCTGCGTAGTCTTGCAGAGCATTAAC(SEQIDNO:27) LTAE_C GTTAATGCTCTGCAAGACTACGCAGC(SEQIDNO:28) LTAE_R CTCTTACGTGCCCGATCAACGCTAGCTTAACGCGCCAGGAATGCACGCCAG(SEQID NO:29) GARL_F GTTAAGAGGCAAGAATGCATAATAACGATGTTTTCCCGAA(SEQIDNO:30) GARL_R CCGCGCTAGCTCTAGATTATTTTTTAAAGGTATCAGCCAGT(SEQIDNO:31) ALAC_F ATGCATCATCACCATCACCACGCTGACACTCGCCCTGAA(SEQIDNO:32) ALAC_C GCGCGGTGATTCCAGGGGCGCAGGTA(SEQIDNO:33) ALAC_B TACCTGCGCCCCTGGAATCACCGCGC(SEQIDNO:34) ALAC_E GCTATCACGATGACGGCACCTTTACG(SEQIDNO:35) ALAC_D CGTAAAGGTGCCGTCATCGTGATAGC(SEQIDNO:36) ALAC_R GCTAGCTTATTCCGCGTTTTCGTGAA(SEQIDNO:37) PALAC_R AGTAAACCGTCGGCACGGAACATC(SEQIDNO:38) PALAC_F CTCTATGATAGGTAACCTGAAGGCTGATGACCAGCAGGCCGTTTTTGAGGAATTAACCCTCACT AAAGGGCG(SEQIDNO:39) PTHRBC_R AACCCGACGCTCATATTGGCACTGGAAGCCGGGGCATAAACTTTAACCATTCTTGCCTCTTAAC TTTAAAG(SEQIDNO:40) PTHRBC_F CAATGTTGCACCGTTTGCTGCATGATATTGAAAAAAATATCACCAAATAAAATTAACCCTCACT AAAGGGCG(SEQIDNO:41) PASPC_F GGTCCTGTTTTTTTTATACCTTCCAGAGCAATCTCACGTCTTGCAAAAACAATTAACCCTCACT AAAGGGCG(SEQIDNO:42) PASPC_R GCCAGGCCCAGAATCGGGTCGGCAGGAGCGGCGGTAATGTTCTCAAACATTCTTGCCTCTTAAC TTTAAAG(SEQIDNO:43)

(19) The synthetic promoter was first introduced to the SIJ488 strain by the recombineering method; P1 transduction was then used to transfer the synthetic promoter into the selection strains. thrB (encoding homoserine kinase, HSK) and thrC (encoding threonine synthase, TS) are on the same operon with thrL and thrA. Since thrL encodes a regulatory peptide and thrA is redundant in the ?asd selection strains, thrLA was deleted during the promoter exchange of thrBC. The point mutations A142P Y2750 (Bouzon et al., ACS Synthetic Biology 6 (2017), 1520-1533) were introduced along with the promoter exchange of alaC (In this case, the recombineering cassette has the mutated gene downstream the CAP cassette and synthetic promoter). Promoter exchanges were confirmed by sequencing the promoter regions.

(20) Plasmids construction. All cloning procedures were carried out in E. coli DH5? strain. E. coli native genes ltaE, rhmA, garL, yagE, yjhH, eda, dgoA and mhpE, were cloned from E. coli MG1655 genome with the primers shown in Table 2, above.

(21) NAD-dependent methanol dehydrogenase (CgAdhA) was taken from Corynebacterium glutamicum R after codon optimization (He et al., ACS Synthetic Biology 7 (2018), 1601-1611). Genes were inserted into a pNivC vector downstream of a ribosome binding site C (AAGTTAAGAGGCAAGA (SEQ ID NO: 44); Zelcbuch et al., Nucleic Acids Res. 41 (2013), e98.). The genes were assembled into one operon using BioBrick enzymes: BcuI, SalI, NheI and XhoI (FastDigest, Thermo Scientific; Zelcbuch et al., Nucleic Acids Res. 41 (2013), e98.). Using EcoRI and PstI, the synthetic operon was then inserted into an overexpression pZASS vector (Wenk et al., Methods Enzymol. 808 (2018), 329-387) under a constitutive strong promoter pgi-20 (Braatsch et al., Biotechniques 45 (2008), 335-337). The final plasmids are listed in the Table 3.

(22) TABLE-US-00003 TABLE 3 SUPPLEMENTARY TABLE S4 THE LIST OF OVEREXPRESSION PLASMIDS PLASMID GENES PZASS P15A ORI; STREP.sup.R; P.sub.PGI-20 PZASS-MDH PZASS::CGADHA PZASS-LTAE-MDH PZASS::LTAE, CGADHA PZASS-LTAE PZASS::LTAE PZASS-MDH-RHMA PZASS::CGADHA, RHMA PZASS-RHMA PZASS::RHMA PZASS-MDH-GARL PZASS::CGADHA, GARL PZASS-GARL PZASS::GARL PZASS-MDH-YAGE PZASS::CGADHA, YAGE PZASS-YAGE PZASS::YAGE PZASS-MDH-YJHH PZASS::CGADHA, YJHH PZASS-YJHH PZASS::YJHH PZASS-MDH-EDA PZASS::CGADHA, EDA PZASS-EDA PZASS::EDA PZASS-MDH-DGOA PZASS::CGADHA, DGOA PZASS-DGOA PZASS::DGOA PZASS-MDH-MHPE PZASS::CGADHA, MHPE PZASS-MHPE PZASS::MHPE

(23) Growth media. LB medium (0.5% yeast extract, 1% tryptone, 1% NaCl) was used for strain engineering and recombinant plasmids cloning. Antibiotics were used at the following concentrations: kanamycin, 50 ?g/mL; ampicillin, 100 ?g/mL; streptomycin, 100 ?g/mL; chloramphenicol, 30 ?g/mL Growth experiments were performed in M9 minimal media (47.8 mM Na.sub.2HPO.sub.4, 22 mM KH.sub.2PO.sub.4, 8.6 mM NaCl, 18.7 mM NH.sub.4Cl, 2 mM MgSO.sub.4 and 100 ?M CaCl.sub.2), supplemented with trace elements (134 ?M EDTA, 31 ?M FeCl.sub.3, 6.2 ?M ZnCl.sub.2, 0.76 ?M CuCl.sub.2, 0.42 ?M CoCl.sub.2, 1.62 ?M H.sub.3BO.sub.3, 0.081 ?M MnCl.sub.2). Additional 50 ?M MnCl.sub.2 was added for all experiments since it improves in vivo activity of LtaE (FIG. 3). Carbon sources were added according to the strain and the specific experiment 10 mM glucose, 10 mM glycine, 10 mM serine, 10 mM threonine, 2 mM homoserine, and 1 mM isoleucine. 0.25 mM diaminopimelate (DAP) was supplemented in all media used to cultivate the ?asd strain (Cardineau and Curtiss, J. Biol. Chem. 282 (1987), 3344-3353).

(24) Growth experiments. Strains were precultured in 4 ml M9 medium with proper carbon sources and streptomycin. The precultures were harvested and washed three times in M9 medium, then inoculated in M9 media with suitable carbon sources, with a starting OD.sub.600 of 0.02. 150 ?L of culture were added to each well of 96-well microplates (Nunclon Delta Surface, Thermo Scientific). Further 50 ?L mineral oil (Sigma-Aldrich) was added to each well to avoid evaporation (while enabling gas diffusion). The 96-well microplates were incubated at 37? C. in microplate reader (BioTek EPOCH 2). The shaking program cycle (controlled by Gen5 v3) had 4 shaking phases, lasting 60 seconds each: linear shaking followed by orbital shaking, both at an amplitude of 3 mm, then linear shaking followed by orbital shaking both at an amplitude of 2 mm. The absorbance (OD.sub.600) in each well was monitored and recorded after every three shaking cycles (?16.5 min). Raw data from the plate reader were calibrated to normal cuvette measured OD.sub.600 values according to OD.sub.cuvette=OD.sub.plate/0.23. Growth parameters were calculated using MATLAB (MathWarks) based on three technical triplicatesthe average values were used to generate the growth curves. Checked in MATLAB, in all cases variability between triplicate measurements were less than 5%.

(25) Stable isotopic labelling. .sup.13C-Methanol, glucose-1-.sup.13C, glucose-2-.sup.13C, glucose-3-.sup.13C were purchased from Sigma-Aldrich. Cells were harvested at the late exponential phase. The equivalent volume of 1 mL of culture at OD.sub.600 of 1 was harvested and washed by centrifugation. Protein biomass was hydrolyzed with 6 M HCl, at 95? C. for 24 h (You et al., Journal of Visualized Experiments 59 (2012)). The samples were completely dried under a stream of air at WC. Hydrolyzed amino acids were analyzed with UPLC-ESI-MS as previously described (Giavalisco et al., Plant J. 68 (2011), 364-376). Chromatography was performed with a Waters Acquity UPLC system (Waters), using an HSS T3 C.sub.18 reversed phase column (100 mm?2.1 mm, 1.8 ?m; Waters). 0.1% formic acid in H.sub.2O (A) and 0.1% formic acid in acetonitrile (B) were the mobile phases. The flow rate was 0.4 mL/min and the gradient was: 0 to 1 min99% A; 1 to 5 minlinear gradient from 99% A to 82%; 5 to 6 minlinear gradient from 82% A to 1% A; 6 to 8 minkept at 1% A; 8-8.5 minnear gradient to 99% A 8.5-11 minre-equilibrate. Mass spectra were acquired using an Exactive mass spectrometer (Thermo Scientific) in positive ionization mode, with a scan range of 50.0 to 300.0 m/z. The spectra were recorded during the first 5 min of the LC gradients. Data analysis was performed using Xcalibur (Thermo Scientific). The identification amino acids was based on retention times and m/z, which were determined by analyzing amino acid standards (Sigma-Aldrich) under the same conditions.

(26) Molecular phylogenetic analysis. The protein sequences of the aldolases used to catalyze the HAL reaction were obtained from UniProt RhmA/YfaU P76469, GarL P23522, YagE P75682 and YjhH P39359, Eda P0A955, DgoA 06BF16 and MhpE P51020. MAFFT v7 (Katoh and Standley, Mol. Biol. Evol. 30 (2013), 772-780) was used for multiple sequence alignment with default parameters. The aligned sequences were used by MEGA X (Kumar et al., Mol. Biol. Evol. 35 (2018), 1547-1549) with Maximum Likelihood method to construct a phylogenetic tree. The bootstrap consensus tree was generated with the setting No. of bootstrap replications to 1000.

Example 1

(27) Concept of the Newly Developed Homoserine Cycle

(28) With the aim to provide a metabolic route which is superior to the known native serine cycle, a metabolic pathway was designed which is also referred herein as the homoserine cycle. A representative example of the homoserine cycle is shown in FIG. 1.

(29) In the homoserine cycle, glycine is directly condensed with formaldehyde to generate serine. This reaction (Item (6) in FIG. 1) (herein also referred to as the serine aldolase (SAL) reaction) was previously found to be promiscuously catalyzed (in vivo) by a threonine aldolase (LtaE) (Contestabile et al., Eur. J. Biochem. 268 (2001), 6508-6525). The SAL reaction bypasses the very long, multi-cofactor-dependent, and ATP-inefficient route for formaldehyde assimilation to 5,10-methylene-tetrahydrofolate (CH.sub.2-THF) (Crowther et al., J. Bacteriol. 190 (2008), 5057-5062). As within the previously proposed modified serine cycles (Yu and Lao, Nature Communications 9 (2018), 3992; Bar-Even, Biochemistry 55 (2016), 3851-383), serine is then deaminated to pyruvate by serine deaminase (item (7) in FIG. 1), bypassing a longer route vim glycerate, which further involves the highly toxic intermediate hydroxypyruvate (Kim and Copley, Proc. Natl. Acad. Sci. USA 109 (2012), E2856-2864). Pyruvate is then condensed with formaldehyde to generate the non-natural metabolite 4-hydroxy-2-oxobutanoate (HOB) (Bouzon et al., ACS Synthetic Biology 6 (2017), 1520-1533), which is subsequently aminated to homoserine. The first of these reactions(item (1) in FIG. 1)was found to be promiscuously catalyzed by E. coli 2-keto-deoxy-L-rhamnonate aldolase (RhmA) (Hernandez et al., ACS Catal. 7 (2017), 1707-1711). The latter reactionHOB amination (item (2) in FIG. 1)is supported by numerous aminotransferases (Hernandez et al., ACS Catal. 7 (2017), 1707-1711; Walther et al., Metab. Eng. 45 (2018), 237-245; Zhong et al., ACS Synthetic Biology 8 (2019), 587-595) as well as amino acid dehydrogenases such as (engineered) glutamate dehydrogenase (Chen et al., Biotechnol. J. 10 (2015), 284-289). This route effectively replaces a carboxylation reaction (by phosphonopyruvate carboxylase) with a formaldehyde assimilation reaction that provides an alternative way to generate a C.sub.4 intermediate. Homoserine is then converted into threonine, e.g. by the action of homoserine kinase (ThrB, item (3) in FIG. 1) and threonine synthase (ThrC, item (4) in FIG. 1). Finally, threonine is cleaved to produce glycine and acetaldehyde. This can, e.g., be achieved by making use of a threonine aldolase (item (5) in FIG. 1, for example by the same threonine aldolase (LtaE) that catalyzes the SAL reaction (item (6) in FIG. 1) to regenerate glycine and produce acetaldehyde. The produced acetaldehyde can, e.g., be further oxidized to acetyl-CoA and assimilated to central metabolism.

(30) Demonstration of the In Vivo Activity of Enzymes Catalyzing the Condensation of Glycine and Formaldehyde into Serine

(31) As described above, several of the reactions of the newly proposed homoserine cycle correspond to the primary activities of their catalyzing enzymes and, thus, ae expected to be normally catalyzed in vivo by the respective enzymes and it is also expected that these reactions do not constrain pathway flux. However, three of the reactions of the newly designed homoserine cycle (i.e. items (1), (2) and (6) in FIG. 1), correspond to promiscuous activities that had so far only been characterized In vitro. Hence, for each of these promiscuous activities, it was tested whether they can also support the corresponding conversions in vivo. For this purpose, dedicated gene deletion strains were created, the growth of which is dependent on the activity of these reactions.

(32) First, the ability of LtaE to catalyze the SAL reaction (item (6) in FIG. 1; FIG. 2a) in vivo was tested. Towards this aim two strains auxotrophic for glycine and serine were constructed. In both strains the gene encoding for 3-phosphoglycerate dehydrogenase (?serA) was deleted. In one strain the gene encoding serine hydroxymethyltransferase was also deleted (?glyA) while in the other strain the genes for the glycine cleavage system was deleted (?gcvTHP). The growth of these strains required the addition of both glycine and serine, as the cellular interconversion of these compounds is blocked (FIGS. 2b and c).

(33) It was reasoned that if the SAL reaction indeed supports physiologically relevant flux, both strains should be able to grow when methanol dehydrogenase (MDH) and LtaE are overexpressed and serine is replaced with methanol in the medium. In the ?serA ?glyA strain, the SAL reaction would be responsible for the production of serine (FIG. 2b), which accounts for ?3% of the carbon in biomass (Neidhardt et al., in: Physiology of the Bacterial Cell: A Molecular Approach 134-143 (1990)). In the ?serA ?gcvTHP strain, the SAL reaction would be responsible for the production of both serine and the cellular C.sub.1 moieties (FIG. 2c), together accounting for ?6% of the carbon in biomass (Neidhardt et al., loc. cit.). To avoid formaldehyde oxidation to formate, which might deplete its intracellular pool and constrain its assimilation, the genes encoding for the glutathione-dependent formaldehyde oxidation system were also deleted (?frmRAB) (He et al., ACS Synthetic Biology 7 (2018), 1601-1611).

(34) Upon overexpression of MDH and LtaE growth of both selection strains was observed with glucose as the main carbon source and glycine and methanol as precursors of sine (FIG. 2d,e). This indicates that the SAL reaction can operate in vivo at a physiologically significant rate. Expression of only MDH or only LtaE failed to sustain growth, indicating that the native expression of genomic ltaE is too low to support the SAL reaction. The observed growth rate and yield were dependent on the concentration of methanol, where the ?serA ?glyA ?frmRAB strain supported higher rates and yields than the ?serA ?gcvTHP ?frmRAB strain on low methanol concentrations. This corresponds to the prediction that the latter strain depends on the SAL reaction to provide a higher fraction of the cellular carbons. Methanol concentrations in the range of 200-1000 mM seem to be optimal, supporting growth rates similar to that of the positive control (in which serine is added to the medium). In all experiments, 50 ?M MnCl.sub.2 were added, as Mn.sup.2+ Is a known cofactor of LtaE (Fesko, Appl. Microbiol. Biotechnol. 100 (2016), 2579-2590). Without the additional supplementation of MnCl.sub.2, we the reactions still occur, but lower growth rates and yields were observed (see FIG. 3).

(35) To confirm the activity of the SAL reaction, .sup.13C-labeling experiments were conducted. Both strains were cultivated with .sup.13C-methanol as well as unlabeled glucose and glycine. In the ?serA ?glyA ?frmRAB strain serine was found to be entirely singly labeled as expected, while the other amino acids were unlabeled (FIG. 2f). As threonine and methionine are derived from oxaloacetate, and hence carry a carbon that originates from CO.sub.2 (i.e., anaplerotic reactions), their lack of labeling indicates that formaldehyde oxidation to CO.sub.2 is negligible, as expected by the deletion of frmRAB. In the ?serA ?gcvTHP ?frmRAB strain serine, methionine, and histidine were found to be entirely singly labeled (FIG. 2g). Unlike threonine, both methionine and histidine harbor a carbon derived from THF carrying a C.sub.1 unitmethyl-THF in the case of methionine and formyl-THF in the case of histidine (Yishai et al., ACS Synthetic Biology 6(9) (2017), 1722-1731). The labeling of these amino acids thus indicates that all cellular C.sub.1 moieties are derived from methanol. Overall, the labeling results confirm that the SAL reaction provides the sole source of serine in both strains and the sole source of C.sub.1 moieties in the ?serA ?gcvTHP ?frmRAB strain.

(36) Next, it was tested whether it is possible to omit glycine from the medium, such that it will be produced endogenously via LtaE-dependent threonine cleavage (FIG. 4a). Towards this aim, in both selection strains, the genes encoding for threonine dehydrogenase and 2-amino-3-ketobutyrate CoA-ligase (?kbl-tdh) were deleted, thus blocking the LtaE-independent route of threonine degradation (FIG. 4a) (Yishai et al., ACS Synthetic Biology 6(9) (2017), 1722-1731). It was found that replacing glycine with threonine did not alter the growth of either selection strain (FIG. 4b, note that growth was still strictly dependent on methanol). To enable this growth, the overexpressed LtaE catalyzes two subsequent reactions, first cleaving threonine to glycine and acetaldehyde and then reacting glycine with formaldehyde to produce serine. Hence, LtaE can be regarded as a glycyltransferasetransferring a glycine moiety from one small aldehyde (acetaldehyde) to another (formaldehyde).

(37) Next, it was assessed whether it was also possible to omit threonine from the medium and rely on native threonine biosynthesis to provide this amino acid as a precursor for glycine and serine (FIG. 4a). Indeed, despite showing reduced growth rates, both selection strains were able to grow with only glucose (as main carbon source) and methanol without the addition of glycine or threonine (green lines in FIG. 4b). This indicates that half of the homoserine cycle is active: homoserine (generated natively from aspartate) is metabolized to threonine via homoserine kinase (HSK) and threonine synthase (TS), and LtaE then cleaves threonine to glycine (and acetaldehyde) and condenses glycine with formaldehyde to produce swine (FIG. 4a).

(38) To confirm that, also in the absence of externally provided glycine or threonine, all cellular serine is produced from glycine condensation with formaldehyde, .sup.13C-labeling experiments were conducted. The strains were cultured in the presence of labeled or unlabeled methanol as well as glucose labeled at different carbons (glucose-1-.sup.13C, glucose-2-.sup.13C, and glucose-3-.sup.13C). While the labeling pattern of glycine changed according to the labeled carbon of glucose, cultivation with .sup.13C-methanol always resulted in exactly one more labeled carbon in serine than in glycine (FIG. 4c). This unequivocally confirms the methanol-dependent production of serine from glycine when the latter compound is produced internally from homoserine metabolism.

(39) Overall, the obtained results confirm the capability of LtaE to convert threonine to serine in vivo by releasing acetaldehyde and assimilating formaldehyde. The findings further confirm the physiologically significant activity of half of the homoserine cycle, where homoserine metabolism to glycine and swine provided all the biomass requirement of these amino acids as well as cellular C.sub.1 moieties, together consisting 10% of the carbon in biomass (Neidhardt et al., in: Physiology of the Bacterial Call: A Molecular Approach 134-143 (1990)).

(40) Demonstration of the In Vivo Activity of Enzymes Catalyzing the Condensation of Glycine and Pyruvate to Form HOB and of the Conversion of HOB into Homoserine

(41) After demonstrating methanol-dependent conversion of homoserine to serine, the aim was to demonstrate methanol-dependent conversion of pyruvate to homoserine. To select for the in vivo conversion of pyruvate to homoserine and threonine via HOB production and amination, a homoserine auxotroph strain was constructed: a deletion of the gene coding for aspartate-semialdehyde dehydrogenase (asd) resulted in a strain capable of growing only when homoserine and diaminopimelate (DAP) (Cardineau and Curtiss, J. Biol. Chem. 262 (1987), 3344-3353) were added to the medium. In this strain, homoserine is metabolized to methionine, threonine, and isoleucine, while DAP is metabolized to lysine and peptidoglycans. (It is noted that despite being formally reversible, homoserine dehydrogenase was not able to oxidize homoserine to aspartate-semialdehyde, the precursor of DAP, and hence the addition of the letter intermediate to the medium was required).

(42) It was reasoned that, in the presence of methanol and methanol dehydrogenase, the combined activities of an enzyme catalyzing the formation of HOB by condensing pyruvate with formaldehyde and of an enzyme catalyzing the conversion of HOB into homoserine should enable the ?asd ?frmRAB strain to grow without the addition of homoserine to the medium (FIG. 5a). So far only RhmA was previously shown to catalyze the condensation of pyruvate with formaldehyde to produce HOB (Hernandez et al., ACS Catal. 7 (2017), 1707-1711). In order to find other enzymes which can catalyze this reaction, similar aldolases were tested for this activity. Hence, a search was conducted for all E. coli enzymes (strain MG1655, using EcoCyc; Keseler et al., Nucleic Acids Res. 33 (2005), D334-337) that are known to catalyze an aldolase reaction with pyruvate as an acceptor (and which might be able to use formaldehyde as a donor). Besides RhmA itself, six candidate aldolases were found: GarL, YagE, YjhH, Eda, DgoA, and MhpE (FIG. 5b). RhmA and GarL belong to the structural family of HpcH while mhpE belongs to DmpG family. Both of these families are Type II pyruvate aldolases which use a divalent metal cation for donor binding and enolization (Fang et al., Angew. Chem. Int. Ed. Engl. 58 (2019), 11841-11845). YagE and YjhH belong to the structural family of DHDPS while Ede and DgoA belong to KDPG family. These families are Type I pyruvate aldolases, using a lysine residue to form a Schiff base with the donor substrate (Fang et al., loc cit.).

(43) It was found that overexpression of mdh together with rhmA, garL, yagE, or yjhH enabled growth of the ?asd ?frmRAB strain when homoserine was replaced with methanol (FIG. 5c). These four aldolase enzymes supported roughly the same growth rates. No growth was observed without methanol, or when methanol dehydrogenase or the aldolase enzymes were overexpressed alone. The relative sequence similarity between RhmA, GarL, YagE, and YjhH (FIG. 5b and FIG. 6 might explain why these enzymes, and not the others, were able to support the HAL reaction. Indeed, the structure of RhmA and GarL is almost identical (FIG. 7).

(44) As the reaction converting HOB into homoserine is known to be supported by the native aspartate aminotransferase (AspC), a highly expressed protein (Li et al., Cell 157 (2014), 624635), and might be further catalyzed by other highly expressed, promiscuous aminotransferases, it was hypothesized that no dedicated enzyme overexpression would be required to enable this key reaction and this was indeed the case. In particular, growth was possible without dedicated overexpression of an aminotransferase enzyme. Genomic overexpression of aspC or of a mutated version of alanine aminotransferase (alaC*, the protein product of which was previously shown to catalyze the reaction in which homoserine is formed from HOB; Bouzon at al., ACS Synthetic Biology 6 (2017), 1520-1533) did not alter growth substantially (FIG. 8). Similarly, genomic overexpression of thrBC did not consistently assist growth (FIG. 8). This indicates that the reaction leading from HOB to homoserine, the homoserine kinase (HSK) reaction and the threonine synthase (TS) reaction do not constrain the flux from pyruvate to threonine.

(45) To confirm that homoserine, and its downstream products threonine and methionine are produced from pyruvate and methanol via the reactions in which HOB is formed by the condensation of pyruvate with formaldehyde and the subsequent conversion of HOB into homoserine, .sup.13C-labeling experiments we performed. Upon cultivation with unlabeled glucose and .sup.13C-methanol, threonine and methionine were found to be completely once labeled, where lysine and aspartate (serving as control) were fully unlabeled. This confirms that homoserine and threonine are completely derived from pyruvate and methanol.