Protective immunity enhanced <i>Salmonella </i>vaccine (PIESV) against <i>Brucella </i>spp
11975061 ยท 2024-05-07
Assignee
Inventors
Cpc classification
International classification
Abstract
Bacterial pathogens have evolved means to succeed as pathogens by infecting without recognition by receptors triggering innate immunity, by suppressing induction of immunity and by inducing immune responses to antigens that confer no protectives immunity. Embodiments described herein circumvent these abilities in Salmonella so as to provide a vector system that induces maximal protective immune responses. Another major problem in using live attenuated bacterial vaccine vectors is the accumulation of attenuating mutations that confer a virulence and safety but which decrease the ability of the vaccine to invade cells in the MALT to colonize and persist in internal effector lymphoid tissues. The embodiments disclosed herein solve this problem in multiple ways by using regulated delayed in vivo shut off of virulence genes, regulated delayed synthesis of recombinant protective antigens and regulated delayed lysis in vivo to confer biological containment with no persistence of vaccine cells and no survival if excreted.
Claims
1. An attenuated microorganism that comprises an expression construct engineered to synthesize two or more Brucella proteins, the expression construct comprising two or more polynucleotide sequences each encoding at least one of the two or more Brucella proteins, wherein upon administration to an animal host, the microorganism expresses and delivers the two or more Brucella proteins to the animal host, wherein the attenuated microorganism is a Enterobacteriaceae family bacterium that comprises a. one or more mutations conferring regulated delayed attenuation within the animal host selected from ?P.sub.murA::TT araC P.sub.araBAD murA gene, ?asdA::TT araC P.sub.araBAD c2, ?waaL, ?paqL:TT rhaRS P.sub.rhaBAD waaL; and b. a genetic modification to enable regulated delayed synthesis of the one or more Brucella proteins encoded by the expression construct in the attenuated microorganism within the animal host, the genetic modification comprising a ?relA::araC P.sub.araBADlacI TT deletion-insertion mutation in the attenuated microorganism and a LacI regulatable promoter in the expression construct to drive expression of the two or more polynucleotide sequences; wherein the expression construct comprises a plasmid that comprises an asdA gene and/or a murA gene whose expression is driven by a presence of arabinose; and wherein the two or more Brucella proteins are selected from Omp22, Omp25, Omp31, Tf, Bp26, BtuB, FIgK, BLS, L7/L12 and Cu/Zn SOD, or codon-optimized versions thereof.
2. The attenuated microorganism claim 1 wherein the bacterium of the family Enterobacteriaceae is a Salmonella enterica bacterium.
3. The attenuated microorganism of claim 1 wherein the two or more selected polynucleotides are codon optimized to enable high-level synthesis in the microorganism, wherein the codon-optimized polynucleotides comprise reduced GC content relative to wild-type sequences in Brucella.
4. The attenuated microorganism of claim 1 wherein the expression construct further comprises an encoded secretory signal sequence associated with each of the two or more polynucleotide sequences such that a secretory signal molecule encoded by the secretory signal sequence is fused with the two or more Brucella proteins to facilitate secretion of the two or more Brucella proteins from the microorganism via a Type 2 secretion system.
5. The attenuated microorganism of claim 1 wherein the expression construct further comprises a secretory signal sequence associated with each of the two or more polynucleotide sequences such that a secretory signal molecule encoded by the secretory signal sequence is fused with the two or more Brucella proteins to facilitate secretion of the two or more Brucella proteins from the microorganism via a Type 3 secretion system.
6. The attenuated microorganism of claim 1, wherein the microorganism comprises a sifA mutation to enable the microorganism to escape the endosome after entry into a cell within the animal host such that synthesized proteins can be delivered by lysis in the cytosol of the cell to enhance induction of CD8-dependent cellular immunities.
7. A vaccine composition comprising the microorganism of claim 1 and a pharmaceutically acceptable carrier.
8. A method of eliciting an immune response against Brucella, the method comprising administrating a vaccine composition of claim 7 to an animal host.
9. The attenuated microorganism of claim 1, wherein the one or more mutations conferring regulated delayed attenuation within the animal host comprises ?waaL and/or ?pagL::TT rhaRS PrhaBAD waaL.
10. The attenuated microorganism of claim 1, wherein the two or more Brucella proteins are selected from Omp22, Omp25, Omp31, Tf, Bp26, BtuB, FIgK, and L7/L12.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
DETAILED DESCRIPTION
(57) Bacterial pathogens have evolved means to succeed as pathogens by infecting without recognition by receptors triggering innate immunity, by suppressing induction of immunity and by inducing immune responses to antigens that confer no protective immunity. Embodiments described herein circumvent these abilities in Salmonella so as to provide a vector system that induces maximal protective immune responses. Another major problem in using live attenuated bacterial vaccine vectors is the accumulation of attenuating mutations that confer avirulence and safety but which decrease the ability of the vaccine to contend with natural host defenses and to invade cells in the MALT to colonize and persist in internal effector lymphoid tissues, which collectively decrease the ability of the vaccine to induce protective immune responses. The embodiments disclosed herein solve this problem in multiple ways by using regulated delayed in vivo shut off of virulence genes, regulated delayed synthesis of recombinant protective antigens and regulated delayed lysis in vivo to confer biological containment with no persistence of vaccine cells and no survival if excreted. This enables the improved vaccine, at the time of vaccination, to exhibit the same or better abilities of the wild-type virulent parent to colonize internal lymphoid tissues to maximize induction of protective immune responses.
(58) These innovative technologies plus other genetic modifications enhance early induction of innate immunity and also favor induction of specific humoral or cellular immune responses. In specific embodiments, these approaches are used in conjunction with the selection of known and putative protective antigens to construct Protective Immunity Enhanced Salmonella Vaccine (PIESV) strains to synthesize and deliver multiple Brucella melitensis antigens to generate a vaccine to prevent infection and abortion caused by B. melitensis and B. abortus. The techniques provided herein may be adapted to generate vaccines against Brucella species.
Definitions
(59) The attenuated as used herein refers to the process of rendering certain pathogen virulence attributes needed to cause diseases less able to cause such disease symptoms.
(60) The term codon optimized or codon optimization as used herein refers to enhancing the ability of the antigen encoding sequence to be expressed in the Salmonella vaccine strain by selecting codons that are used for highly expressed genes in Salmonella. Such codon optimization also includes changing the GC content of the antigen encoding sequence to be similar to that used for Salmonella (i.e., ?52% GC). In addition, the codon optimization can also be used to enhance the stability of the mRNA encoded by the antigen encoding sequence so as to be less likely to be degraded by RNases.
(61) The term delayed attenuation as used herein refers to a means of gene regulation such that the attenuation attribute is not expressed during growth of the vaccine strain or during it administration to an animal host but is not expressed after the vaccine enters the animal host and is manifest as a consequence of vaccine cell division in vivo with gradual dilution of the virulence gene product by at least half at each cell division in vivo.
(62) The term high level synthesis refers to a means of synthesizing a protein antigen at a level that exceeds that level of synthesis that would be synthesized by a chromosomal gene encoding that antigen and can be achieved by encoding the antigen gene on a multi-copy plasmid and/or by placing the antigen encoding sequence under the control of a promoter known to cause gene product synthesis at an elevated level greater than would be caused by using the native promoter for that antigen encoding gene.
(63) The term balanced-lethal plasmid-host is the design of the plasmid-host composition such that survival of the host is dependent on the maintenance of the plasmid such that loss of the plasmid results in death of the host. (See Nakayama et al. 1988 Nat Biotech or Galan et al. 1990 Gene, whose teachings are incorporated by reference).
(64) The term secretory signal as used herein means a sequence that enables a protein fused to it to be secreted out of the bacterial cell cytoplasm.
Overview
(65) The embodiments described herein address the priority to develop vaccines and vaccine delivery systems to prevent Brucella caused diseases of domestic farm animals and wildlife zoonotic reservoirs that are a concern to public health.
(66) Although Brucella infection in U.S. livestock is now rare, the increasing prevalence in bison, elk, deer and feral swine leads to infection of domestic farm animals. In addition, last year hunters of wild boar in Florida contracted B. suis that may be present in half the feral swine population. Brucella species also represent a biothreat and humans, who are self-centered, often forget that the most potent bioweapons attack the food supply.
(67) Subunit vaccines seldom induce long-term protective immunity to prevent infection and the live attenuated B. abortus S19 and RB51 and B. melitensis Rev1 vaccines do not induce sterilizing immunity such that persistence of strains continue to cause abortion in subsequent pregnancies. The new innovative vaccine vector system provided herein is efficacious in inducing protective immunity against Brucella infection and induced abortion. Although designed for livestock, the vaccine construct embodiments may be administered to wildlife species and will have the potential to confer protective immunity to humans. This is important since no available vaccines are safe to use in humans. An added benefit to embodiments is the provision of an inexpensive vaccine that can be manufactured as a thermostable lyophilized product that can be reconstituted at the time and place of easy mucosal administration. This is particularly important in the developing world where Brucella infections are much more prevalent than in the U.S. and with devastating adverse health and economic consequences.
(68) Currently, three live attenuated Brucella strains have been used as vaccines for brucellosis prevention, B. abortus S19 and RB51 for cattle and B. melitensis Rev1 for small ruminants (8). Although the smooth strains S19 from B. abortus and Rev1 from B. melitensis are able to induce effective levels of protection in cattle, goats and sheep, respectively, these vaccines sometimes cause abortion in pregnant cows (9, 10), are pathogenic to humans and the rough B. abortus strain RB51 confers resistance to rifampicin, which is the first-line antibiotic for human brucellosis treatment (11). Therefore, the development of safe and effective vaccines that completely prevent Brucella infection and abortion and protect different animal host species are necessary for eradication of brucellosis in endemic countries.
(69) As stated above, most successful pathogens have evolved means to circumvent host immune defense systems and traditional means of attenuation following the pioneering work of Pasteur to render them suitable as vaccines while enhancing safety have decreased their immunogenicity. These problems have traditionally been compensated for by increasing vaccine dose and number of vaccinations to achieve adequate levels of protective immunity to infection. In contrast, embodiments disclosed herein address and largely eliminate these problems in the continuing development and improvement of Salmonella strains to use as vaccines and recombinant vaccine vectors as described herein. Since extracellular capsular materials are immunosuppressive and also promote long-term persistence of Salmonella, we eliminated means by which our Salmonella vaccine strains synthesize these polymers (13-15). Since about 50 percent of all serum antibodies in Salmonella-immunized animals are to the OmpA protein and since immune responses to the OmpA protein confer no protection against Salmonella infection, we have deleted the ompA gene to eliminate the synthesis of this subterfuge antigen (see Preliminary Results). In so doing, immune responses to other OMPs are increased with enhanced induction of protective immunity.
(70) Our current Salmonella vectors are now designed to effectively colonize internal lymphoid tissues after mucosal administration almost as efficiently as the wild-type virulent Salmonella parent strain (16). We achieve this in several ways. Our vaccines synthesize LPS O-antigen during in vitro growth but cease to synthesize LPS in vivo. Thus, vaccine cells become increasingly sensitive to complement-mediated cytotoxicity and phagocytosis after 8 to 10 cell divisions in the absence of the sugar-required for LPS synthesis (17). It should be noted that cell division in vivo varies from 10 to 30 hours. Another means of regulated delayed attenuation (16) results in lysis of vaccine cells by inability to synthesize the essential peptidoglycan precursors diaminopimelic acid (DAP) and muramic acid whose syntheses are dependent on supply of arabinose during in vitro growth (18). In vivo, arabinose is absent and vaccine cells lyse after 8 to 12 cell divisions. This releases peptidoglycan components and DNA to enhance recruitment of innate immunity in infected host cells via activation of Nod1, Nod2 and TLR9 receptors. Protective antigen delivery by regulated delayed lysis has given superior immune responses compared to delivery without programmed lysis in five different studies (19).
(71) Since synthesis of protective antigens in Salmonella vectored vaccines is a metabolic load that decreases colonizing ability, we eliminated this problem by developing regulated delayed synthesis of recombinant antigens by plasmid-encoded codon-optimized sequences (20). This has increased the induced levels of protective immunity to multiple pathogens (21).
(72) As additional means to further enhance induction of protective immunity, we observed that secretion of protective antigens using Type 2 secretion systems (T2SSs) very much enhanced induced protective immunity (22) and later learned that this was most likely due to overproduction of protective antigen-containing outer membrane vesicles (23,49). We recently further improved means for type 2 secretion (24). We have also used the type 3 secretion system (T3SS) to deliver protective antigens to the cytosol of host cells to enhance induction of CD8-dependent immunities (25). Often both T2SS and T3SS are used in conjunction with regulated delayed lysis to maximize induction of protective immunity (17).
(73) The type of immune response induced can also be altered by inclusion of appropriate deletion mutations. The AsopB mutation decreases intestinal inflammation (26), eliminates a means of immunosuppression and importantly increases induction of mucosal immune responses (27). The ?sifA mutation also eliminates a means of immunosuppression (25) and enables Salmonella to escape the Salmonella-containing vesicle (SCV) so that vaccine strains with the regulated delayed lysis attribute lyse in the cytosol. Synthesized protective antigens are then delivered to the proteasome for presentation by Class I to elicit CD8-dependent immune responses(25).
(74) Plasmid
(75) An attenuated microorganism as described herein that is capable of the regulated expression of at least one nucleic acid sequence encoding a Brucella antigen may also comprise, in part, a plasmid vector. The plasmid vector comprises a nucleic acid sequence encoding at least one Brucella antigen operably linked to a promoter. The promoter is regulated by the chromosomally encoded repressor, such that the expression of the nucleic acid sequence encoding an antigen is repressed during in vitro growth of the microorganism, but the microorganism is capable of high-level synthesis of the antigen in an animal or human host.
(76) As used herein, plasmid vector refers to an autonomously replicating nucleic acid unit. The present invention can be practiced with any known type of vector, including viral, cosmid, phasmid, and plasmid vectors. The most preferred type of vector is a plasmid vector.
(77) As is well known in the art, plasmids and other vectors may possess a wide array of promoters, multiple cloning sequences, transcription terminators, etc., and vectors may be selected so as to control the level of expression of the nucleic acid sequence encoding an antigen by controlling the relative copy number of the vector. In some instances in which the vector might encode a surface localized adhesin as the antigen, or an antigen capable of stimulating T-cell immunity, it may be preferable to use a vector with a low copy number such as at least two, three, four, five, six, seven, eight, nine, or ten copies per bacterial cell. A non-limiting example of a low copy number vector may be a vector comprising the pSC101 ori.
(78) In other cases, an intermediate copy number vector might be optimal for inducing desired immune responses. For instance, an intermediate copy number vector may have at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 copies per bacterial cell. A non-limiting example of an intermediate copy number vector may be a vector comprising the p15A ori.
(79) In still other cases, a high copy number vector might be optimal for the induction of maximal antibody responses or mucosal immune responses. A high copy number vector may have at least 31, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 copies per bacterial cell. In some embodiments, a high copy number vector may have at least 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 copies per bacterial cell. Non-limiting examples of high copy number vectors may include a vector comprising the pBR ori or the pUC ori.
(80) Additionally, vector copy number may be increased by selecting for mutations that increase plasmid copy number. These mutations may occur in the bacterial chromosome but are more likely to occur in the plasmid vector.
(81) Preferably, vectors used herein do not comprise antibiotic resistance markers to select for maintenance of the vector.
(82) A vector may comprise one or more than one nucleic acid sequence encoding a Brucella antigen, whether regulated or not, as detailed above.
(83) Attenuation of the Recombinant Bacterium
(84) In each of the above embodiments, the microorganism capable of regulated expression of Brucella antigens also is attenuated. Attenuated refers to the state of the microorganism (e.g., bacterium) wherein the microorganism has been weakened from its wild-type fitness by some form of recombinant or physical manipulation. This may include altering the genotype of the microorganism to reduce its ability to cause disease. However, the bacterium's ability to colonize the gut (in the case of Salmonella) and induce immune responses is, preferably, not substantially compromised. For instance, in one embodiment, regulated attenuation allows the recombinant microorganism to express one or more nucleic acids encoding products important for the microorganism to withstand stresses encountered in the host after immunization. This allows efficient invasion and colonization of lymphoid tissues before the recombinant microorganism is regulated to display the attenuated phenotype.
(85) In one embodiment, a microorganism may be attenuated by regulating LPS O-antigen synthesis. In another embodiment, a recombinant microorganism may be attenuated as described below. In which case, both regulated attenuation and regulated expression of a Brucella antigen encoding sequence may be dependent upon an arabinose regulatable system. Consequently, the concentration of arabinose needed for optimal expression of the regulated enteric antigen encoding sequence may not be the same as the concentration for optimal expression of attenuation. In an exemplary embodiment, the concentration of arabinose for the optimization of both regulated attenuation and regulated expression of sequences encoding antigen will be substantially the same.
(86) Accordingly, the promoter and/or the nucleic acid sequence encoding an attenuation protein may be modified to optimize the system. Methods of modification are detailed above. Briefly, for example, the SD ribosome binding sequence may be altered, and/or the start codon may be altered from ATG to GTG for the nucleic acid sequences encoding the virulence protein, so that the production levels of the virulence protein are optimal for both the regulated attenuation phenotype and the regulated expression when growing strains with a given concentration of arabinose. In addition, these attenuating nucleic acid sequences may be regulated by other systems using well-established protocols known to one of skill in the art. For example, they may be regulated using promoters dependent on addition of maltose, rhamnose, or xylose rather than arabinose.
(87) Other methods of attenuation are known in the art. For instance, attenuation may be accomplished by altering (e.g., deleting) native nucleic acid sequences found in the wild-type bacterium. For instance, if the microorganism is Salmonella, non-limiting examples of nucleic acid sequences which may be used for attenuation include: a pab nucleic acid sequence, a pur nucleic acid sequence, an aro nucleic acid sequence, asd, a dap nucleic acid sequence, nadA, pncB, galE, pmi, fur, rpsL, ompR, htrA, hemA, cdt, cya, crp, dam, phoP, phoQ, rfc, poxA, galU, mviA, sodC, recA, ssrA, sirA, inv, hilA, rpoE, flgM, tonB, slyA, and any combination thereof. Exemplary attenuating mutations may be aroA, aroC, aroD, cdt, cya, crp, phoP, phoQ, ompR, galE, and htrA.
(88) In certain embodiments, the above nucleic acid sequences may be placed under the control of a sugar regulated promoter wherein the sugar is present during in vitro growth of the recombinant bacterium, but substantially absent within an animal or human host. The cessation in transcription of the nucleic acid sequences listed above would then result in attenuation and the inability of the recombinant microorganism to induce disease symptoms.
(89) The microorganism may also be modified to create a balanced-lethal host-vector system, although other types of systems may also be used (e.g., creating complementation heterozygotes). For the balanced-lethal host-vector system, the microorganism may be modified by manipulating its ability to synthesize various essential constituents needed for synthesis of the rigid peptidoglycan layer of its cell wall. In one example, the constituent is diaminopimelic acid (DAP). Various enzymes are involved in the eventual synthesis of DAP. In one example, the microorganism is modified by using a ?asdA mutation to eliminate the bacterium's ability to produce ?-aspartate semialdehyde dehydrogenase, an enzyme essential for the synthesis of DAP. One of skill in the art can also use the teachings of U.S. Pat. No. 6,872,547 for other types of mutations of nucleic acid sequences that result in the abolition of the synthesis of DAP. These nucleic acid sequences may include, but are not limited to, dapA, dapB, dapC, dapD, dapE, dapF, and asd. Other modifications that may be employed include modifications to a bacterium's ability to synthesize D-alanine or to synthesize D-glutamic acid (e.g., ?murI mutations), which are both unique constituents of the peptidoglycan layer of the bacterial cell wall.
(90) Yet another balanced-lethal host-vector system comprises modifying the microorganism such that the synthesis of an essential constituent of the rigid layer of the bacterial cell wall is dependent on a nutrient (e.g., arabinose) that can be supplied during the growth of the microorganism. For example, a microorganism maycomprise the ?P.sub.murA::TT araC P.sub.araBAD murA deletion-insertion mutation. This type of mutation makes synthesis of muramic acid (another unique essential constituent of the peptidoglycan layer of the bacterial cell wall) dependent on the presence of arabinose that can be supplied during growth of the microorganism in vitro.
(91) When arabinose is absent, however, as it is in an animal or human host, the essential constituent of the peptidoglycan layer of the cell wall is not synthesized. This mutation represents an arabinose dependent lethal mutation. In the absence of arabinose, synthesis of muramic acid ceases and lysis of the microorganism occurs because the peptidoglycan layer of the cell wall is not synthesized. It is not possible to generate ?murA mutations because they are lethal. The necessary nutrient, a phosphorylated muramic acid, cannot be exogenously supplied because enteric bacteria cannot take the nutrient up from the media. Recombinant bacteria with a ?P.sub.murA::TT araC P.sub.araBAD murA deletion-insertion mutation grown in the presence of arabinose exhibit effective colonization of effector lymphoid tissues after oral vaccination prior to undergoing lysis due to the inability to synthesize muramic acid.
(92) Similarly, various embodiments may comprise the araC P.sub.araBAD c2 cassette inserted into the asd nucleic acid sequence that encodes aspartate semialdehyde dehydrogenase. Since the araC nucleic acid sequence is transcribed in a direction that could lead to interference in the expression of adjacent nucleic acid sequences and adversely affect vaccine strain performance, a transcription termination (TT) sequence is generally inserted 3 to the araC nucleic acid sequence. The chromosomal asd nucleic acid sequence is typically inactivated to enable use of plasmid vectors encoding the wild-type asd nucleic acid sequence in the balanced-lethal host-vector system. This allows stable maintenance of plasmids in vivo in the absence of any drug resistance attributes that are not permissible in live bacterial vaccines. In some of these embodiments, the wild-type asd nucleic acid sequence may be encoded by the vector described above.
(93) In one embodiment, ?asdA27::TT araC P.sub.araBAD c2 has an improved SD sequence and a codon optimized c2 nucleic acid sequence. The C2 repressor synthesized in the presence of arabinose is used to repress nucleic acid sequence expression from P22 P.sub.R and P.sub.L promoters. In another embodiment, ?asdA27::TT araC P.sub.araBAD c2 has the 1104 base-pair asd nucleic acid sequence deleted (1 to 1104, but not including the TAG stop codon) and the 1989 base-pair fragment containing T4 ipIII TT araC P.sub.araBAD c2 inserted. The c2 nucleic acid sequence in ?asdA27::TT araC P.sub.araBAD c2 has a SD sequence that was optimized to TAAGGAGGT. It also has an improved P.sub.araBAD promoter such that the ?10 sequence is improved from TACTGT to TATAAT. Furthermore, it has a codon optimized c2 nucleic acid sequence, in which the second codon was modified from AAT to AAA.
(94) In further embodiments, the microorganism may be attenuated by regulating the murA nucleic acid sequence encoding the first enzyme in muramic acid synthesis and the asd nucleic acid sequence essential for DAP synthesis. These embodiments may comprise the chromosomal deletion-insertion mutations ?asdA27::TT araC P.sub.araBAD c2 and ?P.sub.murA25::TT araC P.sub.araBAD murA. This host-vector grows in LB broth with 0.1% L-arabinose, but is unable to grow in or on media devoid of arabinose since it undergoes cell wall-less death by lysis. In some embodiments of the invention, the recombinant microorganism may comprise araBAD mutations to preclude breakdown of internalized arabinose such that asd and murA nucleic acid sequence expression continues for a cell division or two after oral immunization into an environment that is devoid of external arabinose. (For example a strain with a ?P.sub.murA::TT araC P.sub.sraBAD murA deletion-insertion mutation undergoes about two cell divisions and then commences to lyse in media made of mouse or chicken feed or chicken breast meat, unless they are supplemented with arabinose). Either GTG or TTG start codons for the murA and asd nucleic acid sequences are important to decrease translation efficiency on multi-copy plasmids. For instance plasmid vector pG8R114 contains the murA nucleic acid sequence (with altered start codon sequences to decrease translation efficiency) under the control of an araC P.sub.araBAD promoter. Also, the second nucleic acid sequence under the direction of this promoter is the asd nucleic acid sequence (with altered start codon sequences to decrease translation efficiency). The P22 P.sub.R promoter is in the anti-sense direction of both the asd nucleic acid sequence and the murA nucleic acid sequence. The P22 P.sub.R is repressed by the C2 repressor made during growth of the strain in media with arabinose (due to the ?asdA27::TT araC P.sub.araBAD c2 deletion-insertion). However, C2 concentration decreases due to cell division in vivo to cause P.sub.R directed synthesis of anti-sense mRNA to further block translation of asd and murA mRNA. The araC P.sub.araBAD sequence is also not from E. coli B/r as originally described but represents a sequence derived from E. coli K-12 strain ?289 with tighter control and less leakiness in the absence of arabinose. In the preferred embodiment, transcription terminators (TT) flank all of the domains for controlled lysis, replication, and expression so that expression in one domain does not affect the activities of another domain. As a safety feature, the plasmid asd nucleic acid sequence does not replace the chromosomal asd mutation since they have a deleted sequence in common, consequently, the E. coli murA nucleic acid sequence was used in the plasmid instead of using the Salmonella murA nucleic acid sequence. The recombinant microorganism of this embodiment is avirulent at oral doses in excess of 10.sup.9 CFU to BALB/c mice. In addition to being fully attenuated, this construction exhibits complete biological containment with no in vivo recombinant bacteria survivors detectable after 21 days and no recombinant bacteria survivors during or after excretion. This property enhances vaccine safety and minimizes potential for immunization of those not intended to be immunized or in humans not elected to be immunized.
(95) Regulatable Promoter
(96) The native promoter of a nucleic acid encoding an attenuation protein is replaced with a regulatable promoter operably linked to the nucleic acid sequence encoding an attenuation protein. The term operably linked, is defined above.
(97) The regulatable promoter used herein generally allows transcription of the nucleic acid sequence encoding the attenuation protein while in a permissive environment (i.e. in vitro growth), but cease transcription of the nucleic acid sequence encoding an attenuation protein while in a non-permissive environment (i.e. during growth of the microorganism in an animal or human host). For instance, the promoter may be responsive to a physical or chemical difference between the permissive and non-permissive environment. Suitable examples of such regulatable promoters are known in the art and detailed above.
(98) In some embodiments, the promoter may be responsive to the level of arabinose in the environment, as described above. In other embodiments, the promoter may be responsive to the level of maltose, rhamnose, or xylose in the environment, as described above. The promoters detailed herein are known in the art, and methods of operably linking them to a nucleic acid sequence encoding an attenuation protein are known in the art.
(99) B. melitensis Antigens
(100) Various B. melitensis antigens and sequences may be implemented in the vaccine system and microorganism disclosed herein. Examples of B. melitensis antigens that may be included but are not limited to Omp22 (28), Omp25 (29), Omp31 (30, 31), BtuB (28), Tf (31, 32), Bp26 (32, 33), FIgK (28), BLS (34, 35), L7/L12 (36) and Cu/ZN SOD (37) antigens. The sequences of these antigens are known and provided in the cited literature. In preparation for vector construction we do a complete bioinformatic analysis of all structural properties of each protein, analyze the structure of the transcribed mRNA and then modify DNA codons to enhance stability of mRNA and efficiency of translation in Salmonella. We sometimes do protein engineering to delete sequences that interfere with stability or synthesis by the PIESV vector strain that impair growth and that are not likely important for immunogenicity.
(101) For non-secreted B. melitensis antigens without native signal sequences, the commercially synthesized DNA sequences are inserted into pG8R111 (pBR on) and pYA4589 (p15A on). For those proteins with a native signal sequence, the codon-optimized sequence lacking the native SS is inserted into the pG8R114 (pBR on) and pG8R113 (p15A on) vectors with the improved bla SS (38) to maximize antigen synthesis levels and secretion to enhance production of immunogenic outer membrane vesicles. We also insert sequences without their native signal peptides into the T3SS vector pG8R110 (p15A on).
(102) Secretory Signals
(103) As taught herein, secretory signal sequences may be included in the plasmid vectors to direct delivery of the expressed sequence out of the cell. These include secretory signal sequences for the type 2 and type 3 secretory systems. The improved bla SS used in pG8R114 and other plasmid vectors is described in Jiang et al. (38) and the sequence for the T3SS with fusion to the N-terminal 80 amino acids of the SopE protein as used in pG8R110 is given in Juarez et al. (39).
(104) Biological Containment
(105) Under certain embodiments, a live attenuated microorganism may possess the potential to survive and multiply if excreted from a host. This leads to the possibility that individuals not electing to be immunized may be exposed to the attenuated microorganism. Consequently, in certain embodiments, an attenuated microorganism of the invention may comprise one or more mutations that decrease, if not preclude, the ability of Salmonella vaccines to persist in the GI tract of animals.
(106) In some embodiments, the attenuated microorganism may comprise a method of regulated delayed lysis in vivo that prevents bacterial persistence in vivo and survival if excreted. These mutations include: ?(wza-wcaM)-8 that prevents synthesis of colanic acid and other polysaccharide capsules that protect lysing cells from display of complete lysis and thus enhances the level of biological containment afforded by using the regulated delayed lysis in vivo attribute. ?asdA27::TT araC P.sub.araBAD c2 insertion-deletion mutation to impose a requirement for the peptidoglycan constituent DAP and ?P.sub.murA25::TT araC P.sub.araBAD murA insertion-deletion mutation as a conditional-lethal mutation blocking synthesis of the peptidoglycan constituent muramic acid. The latter two mutations are typically complemented by a regulated delayed lysis plasmid vector such as pG8R110, pG8R111 and pG8R114 (
(107) Vaccine Compositions and Administration
(108) An attenuated microorganism of the invention has been modified to enhance its ability to synthesize and deliver antigens that would induce protective immunity to infections caused by other pathogens, in this case from Brucella. As such this recombinant attenuated microorganism may be particularly suited for use as a vaccine. Infection of a host with a Salmonella strain typically leads to colonization of the gut-associated lymphoid tissue (GALT) or Peyer's patches, which leads to the induction of a generalized mucosal immune response to the attenuated microorganism. Further penetration of the bacterium into the mesenteric lymph nodes, liver and spleen augments the induction of systemic and cellular immune responses directed against the bacterium. Thus, the use of recombinant Salmonella for oral immunization stimulates all three branches of the immune system, which is particularly important for immunizing against infectious disease agents that colonize on and/or invade through mucosal surfaces.
(109) An attenuated microorganism of the invention may be administered to a host as a vaccine composition. As used herein, a vaccine composition is a composition designed to elicit an immune response to the attenuated microorganism, including any antigens that may be expressed by the bacterium. In an exemplary embodiment, the immune response is protective. As used herein, protective means that the immune response contributes to the lessening of any symptoms associated with infection of a host with the pathogen the antigen was derived from or designed to elicit a response against. For example, a protective antigen from a pathogen, such as Brucella spp, may induce an immune response that helps to ameliorate symptoms associated with Brucella infection or reduce the morbidity and mortality associated with infection with the pathogen. The use of the term protective in this invention does not necessarily require that the host is completely protected from the effects of the pathogen.
(110) Immune responses to antigens are well studied and widely reported. A survey of immunology is given by Paul, W E, Stites D et. al. and Ogra P L. et. al. (11-13). Mucosal immunity is also described by Ogra P Let. al. (14).
(111) Vaccine compositions of the present invention may be administered to any host capable of mounting an immune response. Such hosts may include all vertebrates, for example, mammals. In a specific embodiment, the mammal is a ruminant such as cow, horse, pig, goat, or sheep. The vaccine can be administered as a prophylactic or for treatment purposes.
(112) In exemplary embodiments, the attenuated microorganism is alive when administered to a host in a vaccine composition. Suitable vaccine composition formulations and methods of administration are detailed below.
(113) Vaccine Composition
(114) The Salmonella vaccines discussed herein are typically lyophilized after production and may be reconstituted in a pharmaceutically acceptable carrier prior to administration. Such a carrier may be any solvent or solid material for encapsulation that is non-toxic to the inoculated host and compatible with the attenuated microorganism. A carrier may give form or consistency, or act as a diluent. Suitable pharmaceutical carriers may include liquid carriers, such as normal saline and other non-toxic salts at or near physiological concentrations, and solid carriers not used for humans, such as talc or sucrose, or animal feed. Carriers may also include stabilizing agents, wetting and emulsifying agents, salts for varying osmolarity, encapsulating agents, buffers, and skin penetration enhancers. Carriers and excipients as well as formulations for parenteral and nonparenteral drug delivery are set forth in Remington's Pharmaceutical Sciences 19th Ed. Mack Publishing (1995). When used for administering via the respiratory tract, the vaccine is preferably presented in the form of an aerosol.
(115) The dosages of a vaccine or vaccine composition disclosed herein can and will vary depending on the attenuated microorganism, the regulated antigen, and the intended host, as will be appreciated by one of skill in the art. Generally speaking, the dosage need only be sufficient to elicit a protective immune response in a majority of hosts. Routine experimentation may readily establish the required dosage. Typical initial dosages of vaccine for oral administration could be about 1?10.sup.7 to 1?10.sup.10 CFU depending upon the age of the host to be immunized. Administering multiple dosages may also be used as needed to provide the desired level of protective immunity.
(116) Methods of Administration
(117) In order to stimulate a preferred response of the GALT, NALT or BALT cells, administration of the vaccine composition directly into the gut, nasopharynx, or bronchus is preferred, such as by oral administration, intranasal administration, gastric intubation or in the form of aerosols, although other methods of administering the attenuated microorganism, such as intravenous, intramuscular, subcutaneous injection or intramammary, intrapenial, intrarectal, vaginal administration, or other parenteral routes, are possible.
(118) In some embodiments, these compositions are formulated for administration by injection (e.g., intraperitoneally, intravenously, subcutaneously, intramuscularly, etc.). Accordingly, these compositions are preferably combined with pharmaceutically acceptable vehicles such as saline, Ringer's solution, dextrose solution, and the like.
(119) In an exemplary embodiment, attenuated microorganisms may be administered orally. Oral administration of a composition comprising an attenuated microorganism allows for greater ease in disseminating vaccine compositions for infectious agents to a large number of people in need thereof, for example, in Third World countries or during times of biological warfare. In addition, oral administration allows for attachment of the bacterium to, and invasion of, the gut-associated lymphoid tissues (GALT or Peyer's patches) and/or effective colonization of the mesenteric lymph nodes, liver, and spleen. This route of administration thus enhances the induction of mucosal immune responses as well as systemic and cellular immune responses.
(120) In another embodiment, attenuated microorganisms12341 may be administered by coarse spray. The vaccines are administered by this whole-body spray route in an amount that is effective in eliciting an immune response, i.e. antibody and/or cellular immunity. Whole-body spray administration is surprisingly effective for vaccines comprising a live avirulent derivative of an enteropathogenic bacteria such as attenuated Salmonella. The effective doses, which elicit an immune response, are roughly comparable to doses that are effective by the oral route of administration, such as administration in the drinking water.
(121) Kits
(122) The invention also encompasses kits comprising any one of the compositions above in a suitable aliquot for vaccinating a host in need thereof. In one embodiment, the kit further comprises instructions for use. In other embodiments, the composition is lyophilized such that addition of a hydrating agent (e.g., buffered saline) reconstitutes the composition to generate a vaccine composition ready to administer, preferably orally.
(123) Methods of Use
(124) A further aspect of the invention encompasses methods of using an attenuated microorganism of the invention. For instance, in one embodiment the invention provides a method for modulating a host's immune system. The method comprises administering to the host an effective amount of a composition comprising an attenuated microorganism of the invention. One of skill in the art will appreciate that an effective amount of a composition is an amount that will generate the desired immune response (e.g., mucosal, humoral or cellular). Methods of monitoring a host's immune response are well-known to physicians, veterinarians, and other skilled practitioners. For instance, assays such as ELISA, and ELISPOT may be used. Effectiveness may be determined by monitoring the amount of the antigen of interest remaining in the host, or by measuring a decrease in disease incidence caused by a given pathogen in a host. For certain pathogens, cultures or swabs taken as biological samples from a host may be used to monitor the existence or amount of pathogen in the individual.
(125) In another embodiment, the invention provides a method for eliciting an immune response against a Brucella antigen in a host. The method comprises administering to the host an effective amount of a composition comprising an attenuated microorganism of the invention.
(126) In still another embodiment, an attenuated microorganism of the invention may be used in a method for eliciting an immune response against Brucella in a host in need thereof. The method comprises administrating to the host an effective amount of a composition comprising an attenuated microorganism as described herein. In a further embodiment, an attenuated microorganism described herein may be used in a method for ameliorating one or more symptoms of Brucella infection in a host in need thereof. The method comprises administering an effective amount of a composition comprising an attenuated microorganism as described herein.
(127) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention. Those of skill in the art should, however, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention, therefore all matter set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.
EXAMPLES
Example 1
(128) Bacterial strains. The starting parental PIESV vector strain is the S. Typhimurium ?12495 with the ?P.sub.murA25::TT araC P.sub.araBAD murA ?asdA27::TT araC P.sub.araBAD c2 ?waaL46 ?pagL64::TT rhaRS P.sub.rhaBAD waaL ?(wza-wcaM)-8 ?relA197::araC P.sub.araBAD lacI TT ?recF126 ?sifA26 genotype or its parent ?12341 that has the pmi-2416 mutation. Derivatives of ?12495 were generated with the ?araBAD65::TT (=?12509) and with ?araBAD65::TT and ?rhaBADSR515 (=?12527) to preclude metabolism of arabinose and rhamnose (to reduce acid production during growth and improve arabinose and rhamnose regulation of sugar-regulated genes). Another important benefit from inclusion of the ?araBAD65::TT and ?rhaBADSR515 mutations is that the inability to metabolize (breakdown) the arabinose and rhamnose taken up by vaccine cells during growth prior to introducing into an immunized animal host is the delayed cessation of peptidoglycan and LPS synthesis and assembly. This results in another few cell divisions prior to onset of lysis and this in turn increases the immunogenicity of the vaccine construct. In addition, other derivatives have been constructed with ?ompA11 to eliminate induction of an irrelevant immune response; with ?sopB1925 to enhance induction of mucosal antibody immunity; and with SifA.sup.+ restored (to enhance CD4 rather than CD8 responses). For ultimate use of vaccine constructs to immunize ruminant species that are much more sensitive to LPS lipid A endotoxin than are chickens and mice, the ?pagP81::P.sub.lpp lpxE deletion-insertion mutation is added to cause synthesis of mono-phosphoryl lipid A that is the adjuvant non-toxic form of lipid A to recruit TLR4 innate immunity in a non-inflammatory manner (27). All strains have both arabinose- and rhamnose-regulated gene expression. Since non-phosphorylated arabinose and rhamnose are unavailable in vivo, all these strains cease to synthesize MurA, Asd and WaaL enzymes in vivo that are diluted by at least half at every in vivo cell division. However, as noted above, the inclusion of the ?araBAD65::TT and ?rhaBADSR515 mutations enables retention of arabinose and rhamnose within vaccine cells to delay the cessation in expression of arabinose- and rhamnose-regulated genes to prolong the vaccine in vivo persistence for a few added cell divisions. Collectively these programmed events lead to ultimate absence of LPS O-antigen to cause complement sensitivity and enhanced ability to be phagocytized while also losing the ability to synthesize the peptidoglycan layer of the cell wall to result in PIESV cell lysis after some 8 to 12 cell divisions in vivo. ?relA197::araC P.sub.araBAD lacI TT confers regulated delayed synthesis of protective antigens encoded by the lysis plasmids described below due to the arabinose-induced synthesis of the LacI repressor that is gradually diluted by cell division to enable synthesis of antigens encoded on the plasmid vector under Ptrc promoter control (39). ?relA (40) and ?(wza-wcaM)-8 (15) enhance complete lysis of the PIESVs (17) and this lysis in situ releases peptidoglycan constituents to activate Nod1 and Nod2 and DNA to activate TLR9 to significantly enhance immunogenicity. ?sifA26 allows the RASVs to escape the SCV (41) so that some cells lyse in the cytosol to deliver protective antigens to the proteasome for class I presentation to lead to CD8-dependent immune responses. ?recF126 decreases inter- and intra-plasmidic recombination to enhance stability of plasmid vectors (42). ?sopB1925 decreases immunosuppression and inflammation but increases mucosal immune responses (43). The dependence on two different sugars to enable expression of full virulence constitutes an important additional safety feature. The ?12341 progenitor of ?12495 has been used to successfully immunize chickens in addition to mice and is the improved PIESV vector strain in a vaccine against Clostridium perfringens that causes necrotic enteritis in poultry (38). S. Typhimurium strains with very similar genotype and phenotype to ?12495 and its derivatives are also being used as vector strains in development of vaccines against Campylobacter jejuni, Escherichia coli (APEC) and Eimeria in poultry.
(129) Plasmid vectors. All plasmids confer the regulated delayed lysis in vivo phenotype (17, 25, 39, 41, 44) and employ the balanced-lethal vector-host concept for stable plasmid maintenance (45) to ensure that live PIESVs are sensitive to all antibiotics and thus unable to disseminate antibiotic resistance when PIESVs are used in non-enclosed environments. The regulated lysis vectors depicted in
(130) However, use of the pG8R114 (
(131) Accordingly, the underlying strategy of the vaccine system described herein achieves certain desired attributes [after eliminating the means by which Salmonella suppresses and subverts induction of immunity or uses subterfuge strategies to divert immune response to non-protective antigens]: 1) regulated delayed attenuation (e.g. regulated shut off of LPS O-antigen, 2) regulated delayed synthesis of protective antigens encoded by codon-optimized sequences; and 3) regulated delayed lysis in vivo. Regulated delayed synthesis of protective antigens is achieved by regulating the synthesis of protective antigens by use of LacI regulatable promoters such as P.sub.trc, P.sub.tac, P.sub.lac, P.sub.lpp lacO, P.sub.ompA lacO, etc. (the lacO sequence that is recognized by LacI, which binds to it is present on P.sub.trc, etc.) that are present on the plasmids depicted in
(132) Certification of current PIESV vector systems delivering protective antigens for use and testing under Level 1 containment. Based off the complete safety of the recombinant PIESV strains administered to newborn, pregnant, malnourished and immunodeficient mice and safety when 10.sup.10 CFU were administered to humans, the NIH and UF IBC have approved use of all new PIESV constructs with the regulated delayed lysis attribute to be evaluated under level I containment and under conditions representative of commercial production for farm animals and in human outpatients in vaccine trials.
(133) Results validating use of PIESV vector systems to induce protective immunities. A comparative study of PIESV vectors was conducted that did or did not have the regulated delayed lysis in vivo attribute and with and without the ability to escape the SCV due to the ?sifA26 mutation. In these studies, we delivered the SO7 antigen of Eimeria tenella and demonstrated protective immunity to challenge with E. tenella sporozoites including normal weight gain and absence of disease symptoms.
(134) A study has been conducted comparing the delivery of the C. perfringens PlcC and GST-NetB operon fusion protective antigens in the regulated lysis strain reported on by Jiang et al. (36) versus the three-sugar dependent regulated lysis stain ?12341 (closely related to the strains to be used in constructing PIESV strains to deliver B. melitensis antigens). As demonstrated by the data in
Example 2
(135) Selection of B. melitensis antigens and construction of recombinant plasmid constructs encoding their synthesis and delivery. Table 1 lists the B. melitensis antigens initially selected to be delivered by the PIESV vector strains. These were selected based on previous results implicating these proteins as likely protective antigens as well as our own bioinformatic searches for homologs of protein antigens in other pathogens shown to induce potentially protective immune responses. The amino acid sequences of each of these proteins was analyzed bioinformatically to ascertain structural attributes including defining whether the proteins were or were not secreted via presence of signal secretion sequences. We then analyzed the nucleotide sequences and codon optimized these to enable efficient transcription and translation of the Brucella antigens absent their Brucella signal peptide (if any) in Salmonella. We also modified some codons to enhance stability of mRNA synthesized. We then specified placement of specific restriction enzyme cleavage sites at the end of sequences that also specified a C-terminal His-tag sequence prior to having the sequences commercially synthesized. In two cases, we also designed sequences to specify fusions for three Brucella antigens. These commercially synthesized codon-optimized sequences were then inserted into the pG8R111, pG8R114 and pG8R110 (
(136) TABLE-US-00001 TABLE 1 List of antigens from B. melitensis that will be used in the PIESV against B. melitensis. Percent Identity bp/aa compared Signal (after GC content to Gene/ peptide/ deletion of before/after Brucella Antigen Gene aa cut signal codon abortus name ID Function site sequence) optimization homologs Reference Omp22 omp22/ Porin Between 567/189 58.2/52.7 99% (28) 29593520 family aa 24 protein. and 25 Omp25 omp25/ Membrane Between 573/191 57.8/52.7 99% (29) 29594100 protein. aa 23 and 24 Omp31 omp31/ Outer Between 666/222 56.2/48.sup. 65% (30, 31) 29595531 Membrane aa 19 Protein and 20 Trigger factor tf/ Cytosolic No/N/A 1458/486 56.2/51.1 99% (31, 32) 29593902 chaperone protein. Bp26 bp26/ Periplasmic, Between 669/223 55.6/52.8 100% (32, 33) 29593322 protein. aa 28 and 29 BtuB btuB/ TonB- Between 1794/598 56.3/Not yet 99% (28) 29593454 dependent aa 23 optimized receptor and 24 FlgK flgK/ Flagellar NO 1455/485 58.1/Not yet 99% (28) 29595162 hook- optimized associated protein FlgK BLS KJ401344.1 lumazine NO 477bp/158aa.sup. 57/49 100% (34, 35) synthase L7/L12 L27819.1 ribosomal NO 468bp/124aa.sup. 55.3/49.sup. 100% (36) protein Cu/Zn AGZ13506.1 superoxide NO .sup.522/172aa 53/49 100% (37) dismutase
(137) TABLE-US-00002 CodonOptimizedgeneswithRestrictiondigestonsites,andHistags XmaI=CCCGGG-aminoacids=PG
(138) Plasmids:
(139) Plasmid: pG8R260 Genus/Species: Brucella melitensis
(140) Host: E. coli ?6212(pYA232) Replicon: pBR ori
(141) Size: 1811 bp Gene cloned: fIgK Brucella melitensis
(142) Marker(s): pYA232 with Tc resistance needs DAP because plasmid does not complement host's ?asd mutation.
(143) Tests:
(144) Description: fIgK sequence was optimized according to be expressed in S. Typhimurium. His-tag was added at the C-terminal end of each fragment before the stop codon. Then by using the XhoI site at the N-terminal and the XmaI site at the C-terminal ends, the fragment was introduced into pG8R111.
(145) Host genotype: ?6212=?80d lacZ?M15 deoR ?(lacZYA-argF)U169 supE44 ?.sup.? gyrA96 recA1 relA1 endA1 ?asd ?zhf-2::Tn10 hsdR17 (R.sup.? M.sup.+)
(146) Host phenotype: ?6212=Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s
(147) Plasmid Derivation:
(148) FigK (SEQ ID NOS: 18, 19 and 20)
(149) TABLE-US-00003 ATGT--TCACTTAGTTCTGCTCTTCTGACGGCCAAAAGTTCACTTGCGGCAACGTCCAAGCAGACGTCCGTGGTT ATGGAATCTCTGTCTTCTGCGCTGCTGACCGCGAAATCTTCTCTGGCGGCGACCTCTAAACAGACCTCTGTTGTT MESLSSALLTAKSSLAATSKQTSVV TCCCGCAATATTTCAGGGGCGAAAGATGCGGATTATTCCCGGCGCACGGCCTCCCTTGTATCGGGCCCCTATGGC TCTCGTAACATCTCTGGTGCGAAAGACGCGGACTACTCTCGTCGTACCGCGTCTCTGGTTTCTGGTCCGTACGGT SRNISGAKDADYSRRTASLVSGPYG TCCCTTTATGTGGGGATCAGCCGGTCGGCGGATGAAGCGATGTTCAATCGCTATATCCAGTCGAACAGCGCCGCT TCTCTGTACGTTGGTATCTCTCGTTCTGCGGAAGAAGCGATGTTCAACCGTTACATCCAGTCTAACTCTGCGGCG SLYVGISRSADEAMFNRYIQSNSAA TCCGCATCGTCCACTCTCGCAGACGGTCTGGACCGCCTTTCCGCGCTTTATTCGGCGGATAATTATTCCGGCTCC TCTGCGTCTTCTACCCTGGCGGACGGTCTGGACCGTCTGTCTGCGCTGTACTCTGCGGACAACTACTCTGGTTCT SASSTLADGLDRLSALYSADNYSGS CCTTCCGGCCTTATCGGCGATCTGCGCGACGCACTCCAGACCTATGTCGCTTCGCCTTCCAACAGCGCGCTTGGC CCGTCTGGTCTGATCGGTGACCTGCGTGACGCGCTGCAGACCTACGTTGCGTCTCCGTCTAACTCTGCGCTGGGT PSGLIGDLRDALQTYVASPSNSALG GATAGCGTGGTCTCGGTTGCGCAGTCGCTTGCCAATGCGTTGAATGACTGTACGCGGCAGGTGCAGTCGCTGCGC GACTCTGTTGTTTCTGTTGCGCAGTCTCTGGCGAACGCGCTGAACGACTGCACCCGTCAGGTTCAGTCTCTGCGT DSVVSVAQSLANALNDCTRQVQSLR AACGATGCCGACCGGGAAATTGCGGATTCCGTCGCCAATATCAACGATCTTCTGGCAAAATTCGAGAAGGCCAAT AACGACGCGGACCGTGAAATCGCGGACTCTGTTGCGAACATCAACGACCTGCTGGCGAAATTCGAAAAAGTTAAC NDADREIADSVANINDLLAKFEKVN CAGAACGTGGTTGGTGGCACCCGCATGGGGCGGGACGTGTCGGATTATCTCGATCAGCGCGATGCATTGCTGAAA CAGAACGTTGTTGGTGGTACCCGTATGGGTCGTGACGTTTCTGACTACCTGGACCAGCGTGACGCGCTGCTGAAA QNVVGGTRMGRDVSDYLDQRDALLK CAGCTTTCAGGCGAGATCGGCATCACAACCATGATGCGCGGTGACAACGACATGGTTATTTTCGCCGAAAACGGC CAGCTGTCTGGTGAAATCGGTATCACCACCATGATGCGTGGTGACAACGACATGGTTATCTTCGCGGAAAACGGT QLSGEIGITTMMRGDNDMVIFAENG GTCACCCTGTTTGAGACGACGGCACGCAAGGTCACTTTCGAGCAATCCGCCGTTCTGACGCCGGGCGTGGCGGGC GTTACCCTGTTCGAAACCACCGCGCGTAAAGTTACCTTCGAACAGTCTGCGGTTCTGACTCCTGGCGTTGCGGGT VTLFETTARKVTFEQSAVLTPGVAG AAGGCGGTGACGGTCGATGGCGTGCCGCTCAGCCATGATACGTTCGACCAGCCTTTTGGTACGGGCCGCTTGAGC AAAGCGGTTACCGTTGACGGTGTTCCGCTGTCTCACGACACCTTCGACCAGCCGTTCGGTACCGGTCGTCTGTCT KAVTVDGVPLSHDTFDQPFGTGRLS GGGCTTTTGCAATTGCGCGACCAGATCGCACCGCAATACCAGATGCAGCTTGATGAAATCGCACGCGGGCTGGTG GGTCTGCTGCAGCTGCGTGACCAGATCGCGCCGCAGTACCAGATGCAGCTGGACGAAATCGCGCGTGGTCTGGTT GLLQLRDQIAPQYQMQLDEIARGLV ACGGTGTTTGCCGAAAGCGACCAGACGGGTTCTAGCCCGGACCAGACCGGGCTTTTCAGCTGGAGCGGCTCGCCC ACCGTTTTCGCGGAATCTGACCAGACCGGTTCTTCTCCGGACCAGACCGGTCTGTTCTCTTGGTCTGGTTCTCCG TVFAESDQTGSSPDQTGLFSWSGSP GCCATACCGGGTGCAGGCCTTTCTGCCGGTATCGCCGGAACGATCGAGGTGTCCGTGCCGTTCATTGCTTCTGAA GCGATTCCTGGCGCGGGTCTGTCTGCGGGTATCGCGGGTACCATCGAAGTTTCTGTTCCGTTCATCGCGTCTGAA AIPGAGLSAGIAGTIEVSVPFIASE GGCGGCAGCGCGCTTCTTCTGCGCGACGGCGGGGCCAATGGCGCGAATTATAAGTATAATGTGCAAGGCGCTGCC GGTGGTTVTGCGCTGCTGCTGCGTGACGGTGGTGCGAACGGTGCGAACTACAAATACAACGTTCAGGGTGCGGCG GGSALLLRDGGANGANYKYNVQGAA GGGTTTAGTGATCGCCTGCGCGCGCTGAACGAAGCCTTTTCCGAACCCATGGTTTTTGATGCAGCGGCGGGGATT GGTTTCTCTGACCGTCTGCGTGCGCTGAACGAAGCGTTCTCTGAACCGATGGTTTTCGACGCGGCGGCGGGTATC GFSDRLRAINEAFSEPMVFDAAAGI TCCTCCAGTTCAAGCCTGATCGGCTACAGCGCCTCGTCTCTGGGCTGGCTTGAAGGCAAGCGCCAGAAAGCCAAT TCTTCTTCTTCTTCTCTGATCGGTTACTCTGCGTCTTCTCTGGGTTGGCTGGAAGGTAAACGTCAGAAAGCGAAC SSSSSLIGYSASSLGWLEGKRQKAN AGCGAATTTACCTATAATGGGACGGTCGCCAGCCAGGCCGATTTTGCTCTTTCCAACGCCACTGGCGTCGATATC TCTGAATTCACCTACAACGGTACCGTTGCGTCTCAGGCGGACTTCGCGCTGTCTAACGCGACCGGTGTTGACATC SEFTYNGTVASQADFALSNATGVDI GACACTGAAATGCGCTGCTTCTCGGACTTGGAACATTCCTATCAGGCATCAAGCCGGGTGCTGACGACGGTTAGC GACACCGAAATGGCGCTGCTGCTGGACCTGGAACACTCTTACCAGGCGTCTTCTCGTGTTCTGACCACCGTTTCT DTEMALLLDLEHSYQASSRVLTTVS GCAATGCTTGATGATCTTCTTAACGCGGTG(SEQIDNO:19) GCGATGCTGGACGACCTGCTGAACGCGGTT(SEQIDNO:20) AMLDDLLNAV(SEQIDNO:18)
(150) Plasmid: pG8R261 Genus/Species: Brucella melitensis
(151) Host: E. coli ?6212(pYA232) Replicon: pBR ori
(152) Size: 801 bp Gene cloned: omp31 Brucella melitensis Marker(s):): pYA232 with Tc resistance needs DAP because plasmid does not complement host's ?asd mutation
(153) Tests:
(154) Description: omp31 sequence was optimized according to be expressed in S. Typhimurium. His-tag was added at the C-terminal end of each fragment before the stop codon. Then by using the XhoI site at the N-terminal and the XmaI site at the C-terminal ends, the fragment was introduced into pG8R114.
(155) Host genotype: ?6212=?80d lacZ?M15 deoR ?(lacZYA-argF)U169 supE44 ?.sup.? gyrA96 recA1 relA1 endA1 ?asd ?zhf-2::Tn10 hsdR17 (R.sup.? M.sup.+)
(156) Host phenotype: ?6212=Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s
(157) omp31 (SEQ ID NOS: 21, 22 and 23)
(158) TABLE-US-00004 ATGAAATCCGTAATTTTGGCGTCCATCGCCGCTATGTTCGCCACGTCCGCTATGGCT(SignalPeptideisremoved) GCCGACGTGGTTGTTTCTGAACCTTCCGCCCCCACTGCTGCTCCTGTTGACACCTTCTCGTGGACCGGC GCGGACGTTGTTGTTTCTGAACCGTCTGCGCCGACCGCGGCGCCGGTTGACACCTTCTCTTGGACCGGT ADVVVSEPSAPTAAPVDTFSWTG GGCTATATCGGTATCAACGCCGGTTACGCAGGCGGCAAGTTCAAGCATCCATTTTCTAGCTTTGACAAGGAAGAC GGTTACATCGGTATCAACGCGGGTTACGCGGGTGGTAAATTCAAACACCCGTTCTCTTCTTTCGACAAAGAAGAC GYIGINAGYAGGKFKHPFSSFDKED AACGAACAGGTTTCCGGTTCGCTCGACGTAACAGCTGGCGGCTTCGTCGGTGGTGTTCAGGCCGGTTACAACTGG AACGAACAGGTTTCTGGTTCTCTGGACGTTACCGCGGGTGGTTTCGTTGGTGGTGTTCAGGCGGGTTACAACTGG NEQVSGSLDVTAGGFVGGVQAGYNW CAGCTCGACAACGGCGTCGTGCTCGGCGCGGAAACCGACTTCCAGGGATCGAGCGTTACGGGTTCGATTTCAGCC CAGCTGGACAACGGTGTTGTTCTGGGTGCGGAAACCGACTTCCAGGGTTCTTCTGTTACCGGTTCTATCTCTGCG QLDNGVVLGAETDFQGSSVTGSISA GGTGCCAGCGGTCTCGAAGGCAAAGCTGAAACCAAGGTCGAGTGGTTCGGCACAGTTCGTGCCCGTCTTGGCTAC GGTGCGTCTGGTCTGGAAGGTAAAGCGGAAACCAAAGTTGAATGGTTCGGTACCGTTCGTGCGCGTCTGGGTTAC GASGLEGKAETKVEWFGTVRARLGY ACGGCTACCGAACGCCTCATGGTTTATGGTACCGGCGGTCTGGCCTATGGTAAGGTCAAGTCTGCGTTCAACCTG ACCGCGACCGAACGTCTGATGGTTTACGGTACCGGTGGTCTGGCGTACGGTAAAGTTAAATCTGCGTTCAACCTG TATERLMVYGTGGLAYGKVKSAFNL GGTGATGATGCAAGTGCCCTGCACACGTGGTCCGACAAGACGAAAGCTGGCTGGACCCTCGGCGCTGGTGCTGAA GGTGACGACGCGTCTGCGCTGCACACCTGGTCTGACAAAACCAAAGCGGGTTGGACCCTGGGTGCGGGTGCGGAA GDDASALHTWSDKTKAGWTLGAGAE TATGCCATCAACAACAACTGGACGCTCAAGTCGGAATACCTCTACACCGACCTCGGCAAGCGCAACCTCGTCGAC TACGCGATCAACAACAACTGGACCCTGAAATCTGAATACCTGTACACCGACCTGGGTAAACGTAACCTGGTTGAC YAINNNWTLKSEYLYTDLGKRNLVD GTTGACAATAGCTTCCTTGAGAGCAAGGTCAATTTCCACACTGTTCGCGTCGGTCTGAACTACAAGTTC(SEQIDNO:21) GTTGACAACTCTTTCCTGGAATCTAAAGTTAACTTCCACACCGTTCGTGTTGGTCTGAACTACAAATTC(SEQIDNO:22) VDNSFLESKVNFHTVRVGLNYKF(SEQIDNO:23)
(159) Plasmid: pG8R258 Genus/Species: Brucella melitensis
(160) Host: E. coli ?6212(pYA232) Replicon: pBR ori
(161) Size: 1818 bp Gene cloned: btuB Brucella melitensis
(162) Marker(s): pYA232 with Tc resistance needs DAP because plasmid does not complement host's ?asd mutation
(163) Description: btuB sequence was optimized according to be expressed in S. Typhimurium. His-tag was added at the C-terminal end of the fragment before the stop codon. Then by using the XhoI site at the N-terminal and the XmaI site at the C-terminal ends, the fragment was introduced into pG8R111.
(164) Host genotype: ?6212=?80d lacZ?M15 deoR ?(lacZYA-argF)U169 supE44 ?.sup.? gyrA96 recA1 relA1 endA1 ?asd ?zhf-2::Tn10 hsdR17 (R.sup.? M.sup.+)
(165) Host phenotype: ?6212=Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s
(166) btuB (SEQ ID NOS: 24, 25 and 26)
(167) TABLE-US-00005 ATGGCGCAGGATGGCGGGGATAAGGATGATGGTGTCACACTTGATACTATCGTGGTGACACCGCTCCGCCGGGCC ATGGAACAAGATGGTGGTGATAAAGATGATGGTGTTACACTGGACACTATCGTAGTAACTCCTCTGCGTCGTGCA MEQDGGDKDDGVTLDTIVVTPLRRA TCGTCGCTTCAGCGATCCACGTCCTCGGTGAGCGTTATTGACGCTGCCGATATCGAACGGTCCGCCGCGCCCGAT TCTTCTCTGCAGCGTTCTACCTCTTCTGTTTCTGTTATCGACGCGGCGGACATCGAACGTTCTGCGGCGCCGGAC SSLQRSTSSVSVIDAADIERSAAPD CTGCAATCCTTGCTGCAAACCTATAGCGGCATTTCGGTCAAGACGAATGGTGGGCAGGGGTCTTCCGCCGATATC CTGCAGTCTCTGCTGCAGACCTACTCTGGTATCTCTGTTAAAACCAACGGTGGTCAGGGTTCTTCTGCGGAGATC LQSLLQTYSGISVKTNGGQGSSADI TATATGCGCGGCATGTCGTCGAAGCAGACGGTCGTGCTGGTCAATGGGGTGCGCACGGCTTCGGCAACGAGTGGA TACATGCGTGGTATGTCTTCTAAACAGACCGTTGTTCTGGTTAACGGTGTTCGTACCGCGTCTGCGACCTCTGGT YMRGMSSKQTVVLVNGVRTASATSG TCGACCGCGCTTGCCAATATTCCGCTGACCTCCATCGAACGTATCGAGATTGCCAGGGGCGCGCATTCCTCGCAA TCTACCGCGCTGGCGAACATCCCGCTGACCTCTATCGAACGTATCGAAATCGCGCGTGGTGCGCACTCTTCTCAG STALANIPLTSIERIEIARGAHSSQ TATGGCGCGGATGCAATCGGCGGTGTCATCAATATCATCACCAAACAGGGCGGGGCCTGCGGCGAACGCGCATGG TACGGTGCGGACGCGATCGGTGGTGTTATCAACATCATCACCAAACAGGGTGGTGCGTGCGGTGAACGTGCGTGG YGADAIGGVINIITKQGGACGERAW TGCGGCAGCGTTTCAACAGGCGTGTCGCATCCATGGGGCGGTTATGCATCGGGTTCGTTACAAGGCCGCAGCAGC TGCGGTTCTGTTTCTACCGGTGTTTCTCACCCGTGGGGTGGTTACGCGTCTGGTTCTCTGCAGGGTCGTTCTTCT CGSVSTGVSHPWGGYASGSLQGRSS GACGGTATCGATTATGCCGTAGGGGCAGCGTTTACCGGCACTCAAGGCTATGATTTCACCACGCCGGAAGCATTC GACGGTATCGACTACGCGGTTGGTGCGGCGTTCACCGGTACCCAGGGTTACGACTTCACCACCCCGGAAGCGTTC DGIDYAVGAAFTGTQGYDFTTPEAF GGCCACGAGCCGGACGATGATGGTTTCCTGCAGGGCTCGTTCAATTTTGCGCTGTCGAAAGATTTCGACTGGGGC GGTCACGAACCGGACGACGACGGTTTCCTGCAGGGTTCTTTCAACTTCGCGCTGTCTAAAGACTTCGACTGGGGT GHEPDDDGFLQGSFNFALSKDFDWG AAAATCTATGCGGACGGCCTCTTCAGCCGTGGGCGCAACCAGTATGATGCGACCGCACCCGCATTCAACGAAGCG AAAATCTACGCGGACGGTCTGTTCTCTCGTGGTCGTAACCAGTACGACGCGACCGCGCCGGCGTTCAACGAAGCG KIYADGLFSRGRNQYDATAPAFNEA GATAGTACGGCCTTTACCGGCAAGGTCGGCACACGGATCGACCATACGGCCGACTGGTCCTCGACGGTGGAATTC GACTCTACCGCGTTCACCGGTAAAGTTGGTACCCGTATCGACCACACCGCGGACTGGTCTTCTACCGTTGAATTC DSTAFTGKVGTRIDHTADWSSTVEF AGCACCGGGATCGACAATAGCCGGAATTTCCGCAAGGGGATCGAAGGTTCGGACTGGTTCGAGACCAGGCGTTAC TCTACCGGTATCGACAACTCTCGTAACTTCCGTAAAGGTATCGAAGGTTCTGACTGGTTCGAAACCCGTCGTTAC STGIDNSRNFRKGIEGSDWFETRRY GGGGTGTTCGCCTCGACCGAAAAAAGCTTCGATACCGGCAAGGTCTCGCATGTTGTGACTGGCGGCGTTGAAGCC GGTGTTTTCGCGTCTACCGAAAAATCTTTCGACACCGGTAAAGTTTCTCATGTTGTTACCGGTGGTGTTGAAGCG GVFASTEKSFDTGKVSHVVTGGVEA TATCGGGAAAAAATCAATACGACCATCGATTATGACGAGACAGGCCGCGATCTTGCCGCCGTGTTCGGGCAATAT TACCGTGAAAAAATCAACACCACCATCGACTACGACGAAACCGGTCGTGACCTGGCGGCGGTTTTCGGTCAGTAC YREKINTTIDYDETGRDLAAVFGQY TCGCTGGAATATGATGCATTGCGTTTCGATGGCGGCATTCGCTACGACCATAATGGCCAGTTCGGCAATGTGACC TCTCTGGAATACGACGCGCTGCGTTTCGACGGTGGTATCCGTTACGACCACAACGGTCAGTTCGGTAACGTTACC SLEYDALRFDGGIRYDHNGQFGNVT ACCTATAATCTTGGCGCGAGCTATGAAATCCTGCCTGATCTGGTGCTGCGTTCATCCTATGCGACGGGTTTCCGC ACCTACAACCTGGGTGCGTCTTACGAAATCCTGCCGGACCTGGTTCTGCGTTCTTCTTACGCGACCGGTTTCCGT TYNLGASYEILPDLVLRSSYATGFR GCCCCGACTTTCAACGAGCTTTATTATCCGGGCTTTGCCAATCCCGACCTGCAACCCGAAAAATCCCGTTCTGTG GCGCCGACCTTCAACGAACTGTACTATCCTGGCTTCGCGAACCCGGACCTGCAGCCGGAAAAATCTCGTTCTGTT APTFNELYYPGFANPDLQPEKSRSV GAAGTCGGGCTGAACTGGCAGGCGACGGCTTCGACAAGCCTCGACATGGCACTCTATCAGACCCGGCTCAGCGAT GAAGTTGGTCTGAACTGGCAGGCGACCGCGTCTACCTCTCTGGACATGGCGCTGTACCAGACCCGTCTGTCTGAC EVGLNWQATASTSLDMALYQTRLSD GCAATCATGAGCACTGCGCCGTCCTATATTCCGTATAATATTGCAAGCGCGAAGGTGACCGGCCTTGAAGCGACA GCGATCATGTCTACCGCGCCGTCTTACATCCCGTACAACATCGCGTCTGCGAAAGTTACCGGTCTGGAAGCGACC AIMSTAPSYIPYNIASAKVTGLEAT CTCAGCCATAGCTTCAACGAACAATGGGGCATCAAGGGAATGGTGGACCTCAAGCGGCCTGTCGATGAAGATAGC CTGTCTCACTCTTTCAACGAACAGTGGGGTATCAAAGGTATGGTTGACCTGAAACGTCCGGTTGACGAAGACTCT LSHSFNEQWGIKGMVDLKRPVDEDS GGGAATGATCTTCCCTATCGCGAACGTTTCAAGGCGGCCGCCGAAGTGAACTTCAAGCCGGTGGAAAAGCTCGAT GGTAACGACCTGCCGTACCGTGAACGTTTCAAAGCGGCGGCGGAAGTTAACTTCAAACCGGTTGAAAAACTGGAC GNDLPYRERFKAAAEVNFKPVEKLD CTGACGGCACGGGTGCTCTATGGCGGTTCGCGCTATACCAATGCGAAAAATACGAAGAAACTCGGCGATTATGTC CTGACCGCGCGTGTTCTGTACGGTGGTTCTCGTTACACCAACGCGAAAAACACCAAAAAACTGGGTGACTACGTT LTARVLYGGSRYTNAKNTKKLGDYV ACCGCGGATTTTGTGGCGCTCTATTCGATCGACAAACAATCGCAGTTGAAGTTCTCGGTGGAGAATATCTTCGAC ACCGCGGACTTCGTTGCGCTGTACTCTATCGACAAACAGTCTCAGCTGAAATTCTCTGTTGAAAACATCTTCGAC TADFVALYSIDKQSQLKFSVENIFD AAGGATTACGAGACGAGTTCCGGCTATGTTGCGCCGGGCCGCACCATCACTATCGGGCTGACCCGTAATTTC(SEQID NO:24) AAGGACTACGAAACCTCTTCTGGTTACGTTGCGCCGGGTCGTACCATCACCATCGGTCTGACCCGTAACTTC(SEQID NO:25) KDYETSSGYVAPGRTITIGLTRNF(SEQID NO:26)
(168) Chimeric Antigens:
(169) Plasmid: pG8R231 Genus/Species: Brucella melitensis
(170) Host: E. coli ?6212(pYA232) Replicon: pBR ori
(171) Size: 1692 bp Gene cloned: tf-bp26-omp31 of Brucella melitensis (chimeric TBO)
(172) Marker(s): pYA232 with Tc resistance needs DAP because plasmid does not complement host's ?asd mutation
(173) Description: Antigenic parts of omp31, bp21 and tf sequences were optimized according to be expressed in S. Typhimurium. His-tag was added at the C-terminal end of the fusion fragment before the stop codon. Then by using the NcoI site at the N-terminal and the XmaI site at the C-terminal ends, the fusion fragment was introduced into pG8R111.
(174) Host genotype: ?6212=?80d lacZ?M15 deoR ?(lacZYA-argF)U169 supE44 ?.sup.? gyrA96 recA1 relA1 endA1 ?asd ?zhf-2::Tn10 hsdR17 (R.sup.? M.sup.+)
(175) Host phenotype: ?6212=Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s
(176) Chimeric construct including TF, BP26.sup.93-111 and Omp31.sup.48-74 (SEQ ID NOS: 27, 28, and 29)
(177) TABLE-US-00006 TF ATGACAAGAAGTGAAGGTTTGAACATGCAGGTTACCGAAACGCTCAATGAAGGGCTGAAGCGCGAG ATGACTCGTTCCGAGGGCCTGAACATGCAGGTTACCGAAACCCTGAACGAAGGTCTGAAACGCGAA MTRSEGLNMQVTETLNEGLKRE ATCAAAGTCGTGGTTCCGGCCGGGGATCTTGAAGCCAAGCTCGCTGAGCGGCTCGAAACCGCGCGCGGCCGCGCC ATTAAGGTTGTGGTTCCGGCAGGCGATCTGGAAGCAAAACTGGCTGAACGCCTGGAGACTGCGCGTGGTCGCGCA IKVVVPAGDLEAKLAERLETARGRA CGCATCAACGGCTTCCGTCCGGGCAAGGTGCCGACGGCTCACCTGCGCAAGATGTACGGCAAGTCCTTCATGGCCGAG CGCATTAACGGTTTCCGTCCGGGCAAAGTTCCGACCGCTCATCTGCGCAAAATGTACGGTAAGTCTTTCATGGCGGAA RINGFRPGKVPTAHLRKMYGKSFMAE ATCGTCAACGAAATCCTCAACGATTCGTCGCGTTCCATCCTTGCCGAACGCAACGAAAAGTCGGCGACCCAGCCTGAA ATTGTTAACGAGATTCTGAACGATTCTAGCCGTTCTATCCTGGCAGAGCGCAACGAAAAATCCGCGACTCAGCCGGAA IVNEILNDSSRSILAERNEKSATQPE GTCATCATGTCGGAAGACGAAAAAGAAGCCGAGAAGGTTCTCGACGGCAAGGCCGATTTCGTTTTCTCGCTGAACTAT GTGATCATGTCTGAAGACGAGAAAGAGGCGGAGAAAGTTCTGGATGGTAAAGCAGACTTTGTTTTCTCTCTGAACTAC VIMSEDEKEAEKVLDGKADFVFSLNY GAAGTGCTGCCGGCAATCGAGGTCAAGGACTTCTCCAAGATCGCCGTGACCCGTGAAGTCGTCGACATTTCCGATGAG GAGGTTCTGCCGGCTATCGAGGTGAAAGATTTCTCTAAAATCGCGGTGACCCGTGAAGTTGTGGATATTTCCGACGAG EVLPAIEVKDFSKIAVTREVVDISDE GAAGTCGATGAACAGGTCAAGCGCATTGCGTCGTCGACCCGCACCTTTGAAACCAAGAAGGGCAAGGCCGAAAAC GAGGTGGATGAACAGGTTAAACGTATCGCGTCTTCTACCCGCACCTTCGAGACCAAGAAAGGTAAGGCTGAAAAC EVDEQVKRIASSTRTFETKKGKAEN GAAGATCGCGTCACGATCGACTATCTGGGCAAGCTCGACGGCGAGCCGTTTGAAGGCGGTGCAGACAATGACGCA GAGGATCGCGTTACCATTGACTACCTGGGTAAACTGGACGGCGAGCCGTTTGAGGGTGGTGCAGACAACGATGCA EDRVTIDYLGKLDGEPFEGGADNDA CAGCTCGTTCTCGGTTCCGGCCAGTTCATTCCGGGCTTTGAAGAACAGCTCATTGGCTTGAAGGCTGGCGACGAG CAGCTGGTTCTGGGCTCCGGTCAGTTCATTCCGGGCTTTGAAGAGCAGCTGATCGGCCTGAAGGCTGGCGACGAA QLVLGSGQFIPGFEEQLIGLKAGDE AAGGTCATCACCGTAACGTTCCCGGCTGAATACGGCGCTGCGCATCTGGCTGGCAAGGAAGCAACCTTCGACATCAAG AAGGTTATTACTGTGACCTTTCCGGCGGAATACGGTGCGGCACATCTGGCTGGTAAGGAGGCGACCTTTGACATCAAA KVITVTFPAEYGAAHLAGKEATFDIK GTGAAGGAAGTTGCCAAGCCGAACGAACTCGTTCTCGATGACGAAACCGCAAAGAAGCTCGGCATTGAGTCGCTT GTGAAGGAGGTTGCGAAACCGAACGAACTGGTGCTGGATGATGAGACCGCAAAGAAGCTGGGCATCGAATCTCTG VKEVAKPNELVLDDETAKKLGIESL GAGCGTCTGCGTCAGGTTGTGCGCGAACAGATCGAAAGCCAGTACGGCCAGATCACCCGCCAGAAAGTGAAGCGT GAACGTCTGCGTCAGGTTGTTCGTGAACAGATCGAGTCTCAGTACGGTCAGATTACCCGTCAGAAGGTTAAGCGC ERLRQVVREQIESQYGQITRQKVKR CAGATTCTCGACGCCCTTGATGGTGATTATCAGTTTGAAACCCCGCAGAAGCTGGTTGACGCCGAGTTCAACAACATC CAGATCCTGGACGCTCTGGACGGTGACTATCAGTTTGAAACCCCGCAGAAACTGGTTGACGCGGAGTTTAACAACATT QILDALDGDYQFETPQKLVDAEFNNI TGGCAGCAGATCAACTTCGACCTGCAGCAGGCTGGCCGCACCTTTGAAGACGAGGAAACGACGGAAGAACGTGCT TGGCAGCAGATCAACTTCGACCTGCAGCAGGCTGGTCGTACTTTCGAGGATGAAGAGACCACTGAAGAAGCAGCG WQQINFDLQQAGRTFEDEETTEEAA CGCGAAGAATATCGCAAGCTTGCAGAACGCCGCGTTCGTCTTGGCCTCGTTCTCTCCGAAATCGGCGAGAAGGCA CGTGAAGAATACCGTAAGCTGGCGGAGCGTCGTGTGCGCCTGGGTCTGGTTCTGTCTGAGATCGGTGAGAAAGCG REEYRKLAERRVRLGLVLSEIGEKA GGCGTGGAAGTGACCGAAGAAGAACTGCAGCGCGCTGTTTACGATCAGGTTCGCCGCTATCCGGGTCAGGAAAAG GGCGTTGAGGTGACTGAGGAAGAACTGCAGCGTGCGGTGTATGACCAGGTGCGCCGTTATCCGGGCCAGGAGAAG GVEVTEEELQRAVYDQVRRYPGQEK Omp31.sup.48- GAAATCTACGACTTCCTGCGCCGTACGCCGGATGCCGTCGCCAATCTGCGCGCGCCGATCTTTGAAGAAAAGGTCGTC GAAATTTACGACTTCCTGCGTCGCACTCCGGACGCGGTGGCGAACCTGCGTGCACCGATTTTTGAGGAAAAAGTTGTT EIYDFLRRTPDAVANLRAPIFEEKVV GATCATCTGCTGGCCAACATCAATGTGACCGACAAGAAGGTCTCGAAGGAAGAGCTGACGGCTGAAGACGAAGAT GACCACCTGCTGGCTAACATCAACGTTACTGACAAAAAGGTGTCTAAAGAGGAGCTGACTGCAGAAGATGAGGAC DHLLANINVTDKKVSKEELTAEDED GCAGCTTCGGAAGCAAAGCCTGCCAAGAAGGCGGCTGCGAAGAAGAAGGCTGCGCCGAAGAAGAAGGCCGAAGAA GCTGCGAGCGAGGCAAAACCGGCTAAAAAAGCTGCTGCGAAGAAGAAGGCAGCACCGAAAAAGAAAGCTGAAGAG AASEAKPAKKAAAKKKAAPKKKAEE GGCAAGTCCGAAGAGGCT------------Linker----------Linker-----------Linker--------------CGCGAT
(178) Plasmid: pG8R259 Genus/Species: Brucella melitensis
(179) Host: E. coli ?6212(pYA232) Replicon: pBR ori
(180) Size: 1351 bp Gene cloned: BLS-I7/I12-Cu/Zn Brucella melitensis
(181) Marker(s): pYA232 with Tc resistance needs DAP because plasmid does not complement host's ?asd mutation
(182) Tests:
(183) Description: Antigenic parts of BLS, L7/L12 and Cu/Zn sequences were optimized according to be expressed in S. Typhimurium. His-tag was added at the C terminal of each fragment before stop codon. Then by using the NcoI site at the N-terminal and XmaI site at the C-terminal ends, the fragment was introduced into pG8R111.
(184) Parent: Depositor: Ghasemi, A. Date: Dec. 16, 2018
(185) Host genotype: ?6212=?80d lacZ?M15 deoR ?(lacZYA-argF)U169 supE44 ?.sup.? gyrA96 recA1 relA1 endA1 ?asd ?zhf-2::Tn10 hsdR17 (R.sup.? M.sup.+)
(186) Host phenotype: ?6212=Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s
(187) Chimeric Including BLS, Ribosomal Protein L7/L12 and Cu/Zn Superoxide Dismutase (SEQ ID NOS: 30, 31 and 32)
(188) TABLE-US-00007 BLS ATGAACCAAAGCTGTCCGAACAAGACATCCTTTAAAATCGCATTCATTCAGGCCCGCTGGCACGCCGACATCGTT ATGAATCAATCATGTCCTAATAAAACATCATTTAAAATAGCATTTATTCAAGCACGTTGGCATGCAGATATAGTT MNQSCPNKTSFKIAFIQARWHADIV GACGAAGCGCGCAAAAGCTTTGTCGCCGAACTGGCCGCAAAGACGGGTGGCAGCGTCGAGGTAGAGATATTCGAC GACGAAGCGCGTAAATCTTTCGTTGCGGAACTGGCGGCGAAAACCGGTGGTTCTGTTGAAGTTGAAATCTTCGAC DEARKSFVAELAAKTGGSVEVEIFD GTGCCGGGTGCATATGAAATTCCCCTTCACGCCAAGACATTGGCCAGAACCGGGCGCTATGCAGCCATCGTCGGT GTTCCGGGTGCGTACGAAATCCCGCTGCACGCGAAAACCCTGGCGCGTACCGGTCGTTACGCGGCGATCGTTGGT VPGAYEIPLHAKTLARTGRYAAIVG GCGGCCTTCGTGATCGACGGCGGCATCTATCGTCATGATTTCGTGGCGACGGCCGTTATCAACGGCATGATGCAG GCGGCGTTCGTTATCGACGGTGGTATCTACCGTCACGACTTCGTTGCGACCGCGGTTATCAACGGTATGATGCAG AAFVIDGGIYRHDFVATAVINGMMQ GTGCAGCTTGAAACGGAAGTGCCGGTGCTGAGCGTCGTGCTGACGCCGCACCATTTCCATGAAAGCAAGGAGCAT GTTCAGCTGGAAACCGAAGTTCCGGTTCTGTCTGTTGTTCTGACCCCGCACCACTTCCACGAATCTAAAGAACAC VQLETEVPVLSVVLTPHHFHESKEH CACGACTTCTTCCATGCTCATTTCAAGGTGAAGGGCGTGGAAGCGGCCCATGCCGCCTTGCAGATCGTGAGCGAG CACGACTTCTTCCACGCGCACTTCAAAGTTAAAGGTGTTGAAGCGGCACACGCAGCACTCCAGATCGTTTCTGAA HDFFHAHFKVKGVEAAFIAALQIVSE CGCAGCCGCATCGCCGCGCTTGTC-----Linker-------GCTGATCTCGCAAAGATCGTTGAAGACCTTTCGGCC CGTTCTCGTATCGCGGCACTGGTTGAAGCGGCAGCAAAAGCGGACCTGGCGAAAATCGTTGAAGACCTGTCTGCG RSRIAALVEAAAKADLAKIVEDLSA L7L12 CTGACCGTTCTGGAAGCCGCTGAGCTGTCCAAGCTTCTCGAAGAGAAGTGGGGCGTTTCGGCTGCTGCTCCGGTC CTGACCGTTCTGGAAGCGGCGGAACTGTCTAAACTGCTGGAAGAAAAATGGGGTGTTTCTGCGGCAGCGCCGGTT LTVLEAAELSKLLEEKWGVSAAAPV GCTGTTGCTGCTGCCGGTGGCGCTGCCCCTGCTGCTGCCGCAGAAGAAAAGACCGAATTCGACGTCGTTCTCGCT GCGGTTGCGGCAGCAGGTGGTGCAGCACCGGCAGCAGCAGCAGAAGAAAAAACCGAATTTGACGTTGTTCTGGCG AVAAAGGAAPAAAAEEKTEFDVVLA GACGGCGGCGCTAACAAGATCAACGTGATCAAGGAAGTGCGCGCACTCACCGGTCTCGGCCTCAAGGAAGCCAAG GACGGTGGTGCAAACAAAATCAACGTTATCAAAGAAGTTCGTGCACTGACCGGTCTGGGTCTGAAAGAAGCAAAA DGGANKINVIKEVRALTGLGLKEAK GACCTGGTCGAAGGCGCTCCGAAGGCTGTCAAGGAAGGCGCCTCGAAGGACGAAGCTGAGAAGATCAAGGCACAG GACCTGGTTGAAGGTGCGCCGAAAGCGGTTAAAGAAGGTGCGTCTAAAGACGAAGCGGAAAAAATCAAAGCGCAG DLVEGAPKAVKEGASKDEAEKIKAQ CTCGAAGCTGCTGGCGCCAAGGTTGAACTCAAG--------Linker---------AGCACGACGGTAAAAATGTATGAG CTGGAAGCGGCGGGTGCGAAAGTTGAACTGAAAGAAGCGGCGGCGAAAGAATCTACCACCGTTAAAATGTACGAA LEAAGAKVELKEAAAKESTTVKMYE GCGCTGCCGACCGGACCGGGTAAAGAAGTTGGCACCGTGGTCATTTCCGAAGCCCCGGGCGGGCTGCACTTCAAG GCGCTGCCGACCGGTCCGGGTAAAGAAGTTGGTACCGTTGTTATCTCTGAAGCGCCGGGTGGTCTGCACTTCAAA Cu/Zn ALPTGPGKEVGTVVISEAPGGLHFK GTGAATATGGAGAAGCTGACGCCGGGCTATCATGGCTTTCATGTTCACGAAAATCCAAGCTGCGCTCCGGGAGAA GTTAACATGGAAAAACTGACTCCTGGTTACCACGGTTTCCACGTTCACGAAAACCCGTCTTGCGCGCCGGGTGAA VNMEKLTPGYHGFHVHENPSCAPGE AAAGACGGCAAGATCGTACCGGCTCTTGCTGCCGGCGGGCATTATGATCCGGGTAATACCCATCACCATTTAGGG AAAGACGGCAAGATTGTTCCGGCGCTGGCGGCGGGTGGTCACTACGATCCGGGTAACACCCACCACCACCTGGGT KDGKIVPALAAGGHYDPGNTHHHLG CCTGAAGGTGATGGACATATGGGCGATTTGCCACGCCTGAGCGCCAATGCTGACGGCAAGGTGAGTGAAACCGTT CCGGAAGGTGACGGTCACATGGGTGACCTGCCGCGTCTGTCTGCGAACGCGGACGGTAAAGTTTCTGAAACCGTT PEGDGHMGDLPRLSANADGKVSETV GTCGCTCCACATCTCAAGAAATTGGCGGAAATCAAGCAGCGTTCTTTGATGGTCCATGTCGGAGGGGATAATTAT GTTGCGCCGCACCTGAAAAAACTGGCGGAAATCAAACAGCGTTCTCTGATGGTTCACGTTGGTGGTGACAACTAC VAPHLKKLAEIKQRSLMVHVGGDNY TCCGATAAGCCTGAGCCGCTTGGTGGCGGTGGTGCCCGTTTTGCCTGCGGCGTGATCGAA(SEQIDNO:30) TCTGACAAACCGGAACCGCTGGGTGGTGGTGGTGCGCGTTTCGCGTGCGGTGTTATCGAA(SEQIDNO:31) SDKPEPLGGGGARFACGVIE(SEQIDNO:32)
Example 3
(189) Construction and Characterization of PIESV Constructs Encoding Synthesis and Delivery of the B. melitensis Omp22, Omp25, Tf and Bp26 Protein Antigens.
(190) Since the objective is to construct PIESV strains that synthesize and deliver protective antigens to maximize induction or protective immune responses, it follows that the construct must grow well, invade and colonize effector lymphoid tissues efficiently and stably maintain the plasmid vector with stability in the ability to specify synthesis of the protective antigen. The amount of antigen synthesized by the construct is also important with higher levels of antigen synthesis favoring mucosal and systemic antibody production and lower levels enhancing induction of cellular immunities. To achieve our objectives the codon-optimized sequences were cloned into the three regulated lysis plasmid vectors (
(191)
(192)
(193)
Example 4
(194) Construction and Characterization of PIESV Constructs Encoding Synthesis and Delivery of the B. melitensis FIgK, Omp31 and BtuB Protein Antigens and Fusions Encoding Synthesis of Determinants from Three Antigens.
(195) The pG8R258, pG8R260 and pG8R261 encoding BtuB, FIgK and Omp31, respectively, in pG8R111 when placed in ?12341 had rapid degradation of synthesized antigen (BtuB and FIgK) or the antigen synthesized was very toxic and inhibited growth of the construct (Omp31) (
Example 5
(196) Demonstration of Protective Immunity to Brucella Challenge.
(197) Since wild-type B. abortus and B. melitensis are select agents requiring BSL3 and ABSL3 containment for experiments and animal studies, we chose to determine whether our PIESV constructs could inhibit the growth and persistence of the attenuated B. abortus vaccine strain S19. B. abortus and B. melitensis are very closely related and the B. melitensis antigens we are having synthesized and delivered by the PIESV constructs have over 99% amino acid sequence identity (except for the Omp31 protein). The S19 strain can infect mice without disease and declines in titer over an 8- to 10-week period (Yang et al. 2016). To verify this, we inoculated mice with 10.sup.7 CFU of S19 by the i.p., i.n. and s.c. routes and followed titers for 8 weeks. The data is presented in
(198) Upon validating that any of the identified protective antigens listed in Table 1 do indeed induce protection of mice to infection with the Brucella strain S19, we construct operon fusions in the appropriate plasmid vector (
Example 6
(199) Plasmid Map Examples and Sequences
(200)
(201) Each plasmid is stocked in the Curtiss collection as a plasmid in ?6212(pYA232) Escherichia coli. Additionally, each plasmid is stocked in the Salmonella collection in ?12509 S. Typhimurium UK-1 to make the actual vaccine.
(202) The stocking information for the plasmid and the Salmonella collections is provided for each plasmid. In addition, the entire plasmid sequence and the information for the codon optimization for each Brucella melitensis gene is provided.
(203) Below is the color coding scheme provided in the figures pertaining to full sequence of the plasmid with the inserted noted gene, codon optimized versions, restriction digest sites and HIS tags:
(204) TABLE-US-00008 XmaI=CCCGGG-aminoacids=PG
(205) A. pG8R251 with bp26 (
(206) Chi Number(pG8R/pYA number): ?12509(pG8R251)
(207) Genus: Salmonella Species: S. Typhimurium UK-1
(208) chi Genotype: ?P.sub.murA25::TT araC P.sub.araBAD murA ?asdA27::TT araC P.sub.araBAD c2 ?(wza-wcaM)-8 ?relA197::araC P.sub.araBAD lacI TT ?recF126 ?sifA26 ?P.sub.crp.sup.+ ?waaL46 ?pagL64::TT rhaRS P.sub.rhaBAD waaL pmi.sup.+ ?araBAD65::TT
(209) Phenotype: Grows in L broth with 0.1% arabinose. DAP not required, asd complemented by plasmid. Needs 0.1% rhamnose for LPS. Expresses Brucella melitensis bp26 gene when induced with IPTG.
(210) Description: pG8R251 was electroporated into ?12509 and grown on LB with 0.2% arabinose. Plasmid verified using PCR and sequencing. Western blot for Bp26 verified expression with proper regulation. Smooth LPS verified using LPS gel with 0.1% rhamnose. Plasmid is stable for >50 generations.
(211) TABLE-US-00009 Plasmid Parent: pG8R114 Chi Parent: ?12495 Source: RCIII Lab Depositor: Jessica Jacob Plasmid: pG8R251 Genus/Species: Escherichia coli Host: ?6212 Replicon: pBR ori Size: 6607 bp Gene cloned: bp26 Marker(s): Asd.sup.+:MurA.sup.+ Tests: PCR & Sequencing Description: Restriction Digestion (XhoI and PstI) and ligation used to insert Brucella melitensis bp26 gene from pG8R213 into parent pG8R114 plasmid. Parent: pG8R114 Depositor: Jessica Jacob
(212) Host genotype: 80d lacZ M15 deoR (lacZYA-argF)U169 supE44 gyrA96 recA1 relA1 endA1 asdA4 zhf-2::Tn10 hsdR17 (r.sup.? m.sup.+)
(213) Host phenotype: Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s Plasmid Derivation: Source: Reference/Duplicates:
(214) TABLE-US-00010 Primersequences: pG8R_consensus_F- (SEQIDNO:33) 5CAATTGATGGGTGAGCGTAGG3 pG8R_consensus_R- (SEQIDNO:34) 5TCTCTCATCCGCCAAAACAG3 bp26_CO_F (SEQIDNO:35) 5CAGGAAAACCAGATGACCAC3 bp26_CO_R (SEQIDNO:36) 5AGCGATCGGAACAGAGTTGT3
(215) B. pG8R241 with omp22 (
(216) Chi Number(pYA number): ?12509 (pG8R241)
(217) Genus: Salmonella Species: S. Typhimurium UK-1
(218) Chi Genotype: ?P.sub.murA25::TT araC P.sub.araBAD murA ?asdA27::TT araC P.sub.araBAD c2 ?(wza-wcaM)-8 ?relA197::araC P.sub.araBAD lacI TT ?recF126 ?sifA26 ?P.sub.crp.sup.+ ?waaL46 ?pagL64::TT rhaRS P.sub.rhaBAD waaL pmi.sup.+ ?araBAD65::TT
(219) Phenotype: Grows in L broth with 0.1% arabinose. DAP not required, asd complemented by plasmid. Needs 0.1% rhamnose for LPS. Expresses Brucella melitensis omp22 gene when induced with IPTG.
(220) Description: pG8R241 was electroporated into ?12509 and grown on LB with 0.2% arabinose. Plasmid verified using PCR and sequencing. Western blot for Omp22 verified expression with proper regulation. Smooth LPS verified using LPS gel with 0.1% rhamnose. Plasmid is stable for >50 generations.
(221) TABLE-US-00011 Plasmid Parent: pG8R110 Chi Parent: ?12495 Source: RCIII Lab Depositor: Jessica Jacob Plasmid: pG8R241 Genus/Species: Escherichia coli Host: ?6212 Replicon: p15A ori Size: 6513 bp Gene cloned: omp22 Marker(s): Asd.sup.+:MurA.sup.+ Tests: PCR & Sequencing Description: Restriction Digestion (XmaI and PstI) and ligation used to insert Brucella melitensis omp22 gene from pG8R214 into parent pG8R110 plasmid. Parent: pG8R110 Depositor: Jessica Jacob
(222) Host genotype: 80d lacZ M15 deoR (lacZYA-argF)U169 supE44 gyrA96 recA1 relA1 endA1 asdA4 zhf-2::Tn10 hsdR17(r m.sup.+) Host phenotype: Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s Plasmid Derivation: Source: Reference/Duplicates:
(223) TABLE-US-00012 Primersequences: pG8R_consensus_F- (SEQIDNO:33) 5CAATTGATGGGTGAGCGTAGG3 pG8R_consensus_R- (SEQIDNO:34) 5TCTCTCATCCGCCAAAACAG3 Omp22_CO_F (SEQIDNO:37) 5GGGTGGTACCGACTACACCT3 Omp22_CO_R (SEQIDNO:38) 5TCAGGTTGTTACGCTGTTCG3
(224) C. pG8R243 (with bp26)
(225) Chi Number(pG8R/pYA number): ?12509(pG8R243)
(226) Genus: Salmonella Species: S. Typhimurium UK-1
(227) Chi Genotype: ?P.sub.murA25::TT araC P.sub.araBAD murA ?asdA27::TT araC P.sub.araBAD c2 ?(wza-wcaM)-8 ?relA197::araC P.sub.araBAD lacI TT ?recF126 ?sifA26 ?P.sub.crp.sup.+ ?waaL46 ?pagL64::TT rhaRS P.sub.rhaBAD waaL pmi.sup.+ ?araBAD65::TT
(228) Phenotype: Grows in L broth with 0.1% arabinose. DAP not required, asd complemented by plasmid. Needs 0.1% rhamnose for LPS. Expresses Brucella melitensis bp26 gene when induced with IPTG.
(229) Description: pG8R243 was electroporated into ?12509 and grown on LB with 0.2% arabinose. Plasmid verified using PCR and sequencing. Western blot for Bp26 verified expression with proper regulation. Smooth LPS verified using LPS gel with 0.1% rhamnose. Plasmid is stable for >50 generations.
(230) TABLE-US-00013 Plasmid Parent: pG8R110 Chi Parent: ?12495 Source: RCIII Lab Depositor: Jessica Jacob Plasmid: pG8R243 Genus/Species: Escherichia coli Host: ?6212 Replicon: p15A ori Size: 6618 bp Gene cloned: bp26 Marker(s): Asd.sup.+:MurA.sup.+ Tests: PCR & Sequencing Description: Restriction Digestion (XmaI and PstI) and ligation used to insert Brucella melitensis bp26 gene from pG8R213 into parent pG8R110 plasmid. Parent: pG8R110 Depositor: Jessica Jacob
(231) Host genotype: 80d lacZ M15 deoR (lacZYA-argF)U169 supE44 gyrA96 recA1 relA1 endA1 asdA4 zhf-2::Tn10 hsdR17 (r m.sup.+) Host phenotype: Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s Plasmid Derivation: Source: Reference/Duplicates:
(232) TABLE-US-00014 Primersequences: pG8R_consensus_F- (SEQIDNO:33) 5CAATTGATGGGTGAGCGTAGG3 pG8R_consensus_R- (SEQIDNO:34) 5TCTCTCATCCGCCAAAACAG3 bp26_CO_F (SEQIDNO:35) 5CAGGAAAACCAGATGACCAC3 bp26_CO_R (SEQIDNO:36) 5AGCGATCGGAACAGAGTTGT3
(233) D. pG8R250 with tf (
(234) Chi Number(pYA number): ?12509 (pG8R250)
(235) Genus: Salmonella Species: S. Typhimurium UK-1
(236) Chi Genotype: ?P.sub.murA25::TT araC P.sub.araBAD murA ?asdA27::TT araC P.sub.araBAD c2 ?(wza-wcaM)-8 ?relA197::araC P.sub.araBAD lacI TT ?recF126 ?sifA26 ?P.sub.crp.sup.+ ?waaL46 ?pagL64::TT rhaRS P.sub.rhaBAD waaL pmi.sup.+ ?araBAD65::TT
(237) Phenotype: Grows in L broth with 0.1% arabinose. DAP not required, asd complemented by plasmid. Needs 0.1% rhamnose for LPS. Expresses Brucella melitensis tf gene when induced with IPTG.
(238) Description: pG8R250 was electroporated into ?12509 and grown on LB with 0.2% arabinose. Plasmid verified using PCR and sequencing. Western blot for tf verified expression with proper regulation. Smooth LPS verified using LPS gel with 0.1% rhamnose. Plasmid is stable for >50 generations.
(239) TABLE-US-00015 Plasmid Parent: pG8R114 Chi Parent: ?12495 Source: RCIII Lab Depositor: Jessica Jacob Plasmid: pG8R250 Genus/Species: Escherichia coli Host: ?6212 Replicon: pBR ori Size: 7396 bp Gene cloned: tf Marker(s): Asd.sup.+:MurA.sup.+ Tests: PCR & Sequencing Description: Restriction Digestion (XhoI and PstI) and ligation used to insert Brucella melitensis tf gene from pG8R212 into parent pG8R114 plasmid. Parent: pG8R114 Depositor: Jessica Jacob
(240) Host genotype: 80d lacZ M15 deoR (lacZYA-argF)U169 supE44 gyrA96 recA1 relA1 endA1 asdA4 zhf-2::Tn10 hsdR17 (r m.sup.+) Host phenotype: Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s Plasmid Derivation: Source: Reference/Duplicates:
(241) TABLE-US-00016 Primersequences: pG8R_consensus_F- (SEQIDNO:33) 5CAATTGATGGGTGAGCGTAGG3 pG8R_consensus_R- (SEQIDNO:34) 5TCTCTCATCCGCCAAAACAG3 tf_CO_F (SEQIDNO:39) 5CCCTGAACGAAGGTCTGAAA3 tf_CO_R (SEQIDNO:40) 5CAGATTTACCTTCTTCCGCTTT3
(242) E. pG8R248 with omp25 (FIGS. 38-40)
(243) chi Number(pYA number): ?12509 (pG8R248)
(244) Genus: Salmonella Species: S. Typhimurium UK-1
(245) Chi Genotype: ?P.sub.murA25::TT araC P.sub.araBAD murA ?asdA27::TT araC P.sub.araBAD c2 ?(wza-wcaM)-8 ?relA197::araC P.sub.araBAD lacI TT ?recF126 ?sifA26 ?P.sub.crp.sup.+ ?waaL46 ?pagL64::TT rhaRS P.sub.rhaBAD waaL pmi.sup.+ ?araBAD65::TT
(246) Phenotype: Grows in L broth with 0.1% arabinose. DAP not required, asd complemented by plasmid. Needs 0.1% rhamnose for LPS. Expresses Brucella melitensis omp25 gene when induced with IPTG.
(247) Description: pG8R248 was electroporated into ?12509 and grown on LB with 0.2% arabinose. Plasmid verified using PCR and sequencing. Western blot for omp25 verified expression with proper regulation. Smooth LPS verified using LPS gel with 0.1% rhamnose. Plasmid is stable for >50 generations.
(248) TABLE-US-00017 Plasmid Parent: pG8R114 Chi Parent: ?12495 Source: RCIII Lab Depositor: Jessica Jacob Plasmid: pG8R248 Genus/Species: Escherichia coli Host: ?6212 Replicon: pBR ori Size: 6511 bp Gene cloned: omp25 Marker(s): Asd.sup.+:MurA.sup.+ Tests: PCR & Sequencing Description: Restriction Digestion (XhoI and PstI) and ligation used to insert Brucella melitensis omp25 gene from pG8R215 into parent pG8R114 plasmid. Parent: pG8R114 Depositor: Jessica Jacob
(249) Host genotype: 80d lacZ M15 deoR (lacZYA-argF)U169 supE44 gyrA96 recA1 relA1 endA1 asdA4 zhf-2::Tn10 hsdR17 (r.sup.? m.sup.+) Host phenotype: Rec.sup.?(UV.sup.s) Asd.sup.? Lac.sup.? Nal.sup.r Tet.sup.s Plasmid Derivation: Source: Reference/Duplicates:
(250) TABLE-US-00018 Primersequences: pG8R_consensus_F- (SEQIDNO:33) 5CAATTGATGGGTGAGCGTAGG3 pG8R_consensus_R- (SEQIDNO:34) 5TCTCTCATCCGCCAAAACAG3 omp25_CO_F (SEQIDNO:41) 5TACTCTTGGGCTGGTGGGTA3 omp25_CO_R (SEQIDNO:42) 5CCGATACCAACACGGAAGTC3
Example 7
(251) General Materials and Methods.
(252) Bacterial strains, media and culture conditions. All PIESVs are derived from the highly virulent S. Typhimurium UK-1 strain (51). LB broth and agar (52) are used as complex media for propagation and plating of Salmonella strains. Purple broth (PB) (Difco), which is devoid of arabinose, mannose and rhamnose, is also used since LB but not PB contains low levels of these sugars. MacConkey agar with 0.5% lactose (Lac) and 0.1% arabinose (Ara) is used to enumerate PIESVs. Bacterial growth is monitored spectrophotometrically and by plating for colony counts. B. melitensis and B. abortus strains are grown in Brucella Broth (BB) and agar media in a 5% CO.sub.2 atmosphere. Potato infusion agar (PIA) is used for determination of challenge strain titers in animal studies.
(253) Molecular and genetic procedures. Methods for DNA isolation, restriction enzyme digestion, DNA cloning and use of PCR and real-time PCR for construction and verification of vectors and mutations are standard (53). All oligonucleotide and/or gene segment syntheses are done commercially with codon optimization to enhance translational efficiency in Salmonella and stabilize mRNA to destroy RNase E cleavage sites (54-56) to prolong mRNA half-life. Plasmid constructs are evaluated by DNA sequencing and for ability of sugar-regulated sequences to specify synthesis of proteins using gel electrophoresis and western blot analyses (57).
(254) In vitro characterizations of PIESV-Bm strains. PIESVs encoding B. melitensis antigens are compared with empty vector controls for stability of plasmid maintenance, integrity and antigen synthesis ability when strains are grown in the presence of arabinose and DAP for 50 generations. In other cases, strains are grown in the presence of IPTG for constitutive synthesis of B. melitensis antigens to determine whether that results in instability or reduced growth rates. If observed, protein engineering is conducted to rectify the problem to achieve stable synthesis and good growth. Genetic attributes are confirmed by methods described above. Measurement of LPS core and O-antigen are performed after electrophoresis using silver-stained gels (58). The complete sensitivity of PIESVs to all antibiotics are evaluated that might ever be used to treat Salmonella infections. Metabolic attributes of bacterial strains are evaluated using API-20E tests.
(255) Animal experimentation. Mice are used to evaluate attenuation, safety and immunogenicity of PIESVs delivering candidate B. melitensis protective antigens. Since animal studies at the ABSL3 containment level are very costly ($10/cage of mice/day), determination of whether PIESV constructs can prevent infection of mice from infection by the B. abortus S19 or RB51 strain or can increase the rate of clearance of these strains are tested in mice under ABSL2 containment. Based on the high degree of homology of the B. melitensis antigens to those in B. abortus (see Table 1) being evaluated for inducing protective immunity (?99%), protective immunity against these B. abortus strains should be observable. However, those skilled in the art will appreciate that the techniques disclosed herein support the construction of microorganisms engineered to express antigens to other Brucella species such as B. abortus, B. suis and B. canis. However, if necessary challenge studies of vaccinated mice are conducted with either the B. melitensis vaccine Rev1 or the wild-type 16M strain under ABSL3 containment. Equal numbers of female and male BALB/c mice, ages 6-8 weeks, are used in each experiment in the current study to obtain data from both genders. Mice are typically held in quarantine one-week for acclimation prior to immunization. PIESV strains are grown in LB broth with necessary supplements to an OD.sub.600 of ?0.9, sedimented by centrifugation at room temperature and suspended in PBS at densities of 5?10.sup.10 CFU/ml to enable i.n. doses of up to 1?10.sup.9 CFU to be administered in 20 ?l per mouse. Generally, doses of 10.sup.6 to 10.sup.7 CFU are adequate to induce maximum immune responses after i.n. vaccination. Animals are housed at the appropriate containment level in ventilated micro-isolator caging for immunization and challenge studies. When desired, sera and mucosal fluids are collected for quantitation of specific IgG and SIgA antibodies at two-week intervals. In other studies, measurement of increases in intracellular IFN-? by peripheral blood TCR?.sup.+ CD4 or CD8.sup.+ T cells harvested in gradient-isolated mononuclear cells three weeks after immunization is conducted. Immunized mice are i.n. challenged at 4 weeks after immunization with doses of vaccine strains S19 or RB51 (or, if necessary, with B. melitensis Rev1 of 16M-LacZ as previously described (59)). Spleens and lungs are harvested from CO.sub.2 euthanized mice, weighed, and homogenized in water to compare the extent of tissue colonization and persistence of the challenge strain and the vaccine strain (if any) by plating lysate dilutions on PIA plates at 37? C. under 5% CO.sub.2 (59).
(256) An evaluation will be conducted of the ability of the most efficacious PIESV strains in preventing Brucella infections in immunized mice tested for ability to prevent Brucella-induced abortion in pregnant guinea pigs. It should be noted that Brucella are unable to induce abortion in mice. Dunkin-Hartley guinea pigs (mostly females for pregnancy studies and a few males for breeding) weighing 250-300 g from Charles River are used for this purpose. Guinea pigs are acclimated for one week prior to being immunized subcutaneously in the inguinal region (60, 61) with candidate vaccine strains grown and prepared as described above.
(257) Monitoring Immune Responses. i. Antigen preparation: B. melitensis enzymes and antigens synthesized by PIESVs as His-tagged proteins from recombinant E. coli BL21 are purified. Salmonella B group LPS O-antigen are obtained commercially. An S. Typhimurium outer membrane protein (SOMP) fraction (isolated from a mutant strain ?9698 that is deficient in making LPS O-antigen and outer core, synthesis of nine fimbrial antigens synthesized in vitro and flagella and has a modified lipid A that is non-inflammatory) has been prepared. Extracts (heat-killed) are generated of S19, RB51, Rev1 and wild-type S. Typhimurium UK-1. These antigens are used as controls in western blots and for immunoassays as described below. ii. ELISA: Serum antibodies are measured in blood collected by submandibular bleeding and mucosal antibodies as extracted from nasal, intestinal and vaginal secretions. Sera and secretions are monitored in individual mice. A doubling dilution method is employed with the end point titer being the dilution giving an OD.sub.450 three times that for the reagent or unimmunized animal control. SIgA titers against the various antigens will are also monitored by ELISA (62, 63). To distinguish between Th1 and Th2 responses, titers of IgG1 and IgG2a are determined. These methods have been described previously (43, 64). Also employed is a fluorescent covalent microsphere immunoassay (FCMIA) technology to analyze the immune responses as a replacement for using ELISA. This assay can measure numerous analytes by using uniquely dually stained microspheres for the measurement of up to 50 analytes simultaneously (65). This assay is useful for immunophenotyping and for measuring levels of relevant cytokines induced in immunized mice. Immune sera are also tested for reaction with extracts of different Brucella species separated by PAGE by western blot analyses. iii. Cellular immune responses: Spleens of immunized mice are removed from euthanized animals in a sterile condition. To assess cellular immune responses, spleens are minced and homogenized with a syringe in 10 ml cold PBS containing 5 mM ethylene diamine tetraacetic acid (PBS-EDTA). The cells are washed twice with PBS-EDTA and mononuclear cells (MNCs) are isolated by Ficoll-Paque (GE Healthcare, Uppsala, Sweden) discontinuous gradient centrifugation. The cells are harvested in complete medium (RPMI 1640) supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 100 ?g/ml streptomycin and 10% heat inactivated FBS. The cell concentration is adjusted to 2?10.sup.6 in 2 ml of complete RPMI 1640 medium and then plated in 24-well flat-bottom plates. Cells are then be treated with a specific relevant antigen or a heat-killed Rev 1 extract and incubated at 37? C. in 5% CO.sub.2 for 48 h. Control wells receive PBS instead of the antigen. Supernatants are collected after 48 h and stored at ?70? C. Levels of IFN-?, IL-17, TNF? and IL-4 is measured. iv. Flow cytometry analyses: Flow cytometry is used to simultaneously detect production of intracellular IFN-?, TNF-?, IL-10, IL-17, IL-22, and Foxp3 by CD4+ and CD8+ T cells. For staining of intracellular IFN-?, 1.5?10.sup.6 splenocytes from immunized animals are seeded into a 24-well tissue culture plate. All samples are re-stimulated with 4 ?g/ml of antigen. Three days after the addition of stimuli, Golgi plug (BD Pharmingen) is added for 6 h to stop cytokine secretion. Splenocytes are stained with fluorochrome-conjugated monoclonal antibodies specific for cell surface molecules, namely CD4 and CD8, to phenotypically identify cytokine-secreting lymphocytes. Cells are then fixed in 2% p-formaldehyde solution and permeabilized to allow monoclonal antibodies access to the cytosol. After blocking Fc receptors and permeabilization, intracellular staining is performed using allophycocyanin-conjugated anti-IFN-? antibodies and reagents provided with the Cytofix/Cytoperm Plus Kit (BD Pharmingen) in accordance with manufacturer guidelines. Data is collected on a BD FACSCanto II analyzed using BD FACSDiva? software at the new Flow set-up in the Department of Infectious Disease and Immunology core facility, College of Veterinary Medicine, University of Florida.
(258) Statistical analyses. All results are analyzed using the most appropriate statistical test from the SAS program to evaluate the relative significance or lack thereof of results obtained.
(259) TABLE-US-00019 TABLE2 Plasmidscreatedforvaccineevaluationanddevelopment. ProteinSynthesized ProteinSynthesized CloneBank Parent inE.coli inSalmonella Designation Vector Gene/Size ?6212(pYA232) ?12509 pG8R110 NA None NA NA pG8R111 NA None NA NA pG8R114 NA None NA NA pG8R240 pG8R110 omp25/570bp No No pG8R241 omp22/564bp Yes Yes pG8R242 tf/1455bp Yes No pG8R243 bp26/666np Yes Yes pG8R244 pG8R111 omp25/570bp No No pG8R245 omp22/564bp No No pG8R246 tf/1455bp No No pG8R247 bp26/666np Yes No pG8R248 pG8R114 omp25/570bp No Yes pG8R249 omp22/564bp Yes No pG8R250 tf/1455bp Yes Yes pG8R251 bp26/666np Yes Yes
(260) TABLE-US-00020 TABLE3 Plasmidscreatedspecifyingfusionandnon fusionantigens. pG8R# Gene(Brucella) Parentvector ori 231 tf-bp26-omp31 pG8R111 pBR 258 btuB pG8R111 pBR 259 BLS-L7/L12- pG8R111 pBR Cu/ZnSOD 260 flgK pG8R111 pBR 261 omp31 pG8R114 pBR
(261) TABLE-US-00021 TABLE 4 Percent Identity bp/aa compared Signal (after GC content to Gene/ peptide/ deletion of before/after Brucella Antigen Gene aa cute signal codon abortus name ID Function site sequence) optimization homologs Reference Omp 31 omp31/ Outer Between .sup.666/222 56.2/48.sup. 65% (30, 31) 29595531 Membrane aa 19 Protein and 20 BtuB btuB/ TonB- NO 1794/598.sup. 56.3/52% 99% (28) 29593454 dependent receptor FlgK flgK/ Flagellar NO 1455/485.sup. .sup.58.1/51.2% 99% (28) 29595162 hook- associated protein FlgK BLS KJ401344.1 lumazine NO 477bp/158aa 57/49 100% (34, 35) synthase L7/L12 L27819.1 ribosomal NO 468bp/124aa 55.3/49.sup. 100% (36) protein Cu/Zn AGZ13506.1 superoxide NO 522/172aa 53/49 100% (37) dismutase
REFERENCES
(262) 1. Dean A S, Crump L, Greter H, Hattendorf J, Schelling E, Zinsstag J. Clinical manifestations of human brucellosis: a systematic review and meta-analysis. Plos Neglect Trop D. 2012; 6(12):e1929. Epub 2012/12/14. doi: 10.1371/journal.pntd.0001929. PubMed PMID: 23236528; PMCID: 3516581. 2. Corbel M J. Brucellosis: an overview. Emerg Infect Dis. 1997; 3(2):213-21. Epub 1997/04/01. doi: 10.3201/eid0302.970219. PubMed PMID: 9204307; PMCID: 2627605. 3. Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos E V. The new global map of human brucellosis. The Lancet Infectious diseases. 2006; 6(2):91-9. Epub 2006/01/28. doi: 10.1016/S1473-3099(06)70382-6. PubMed PMID: 16439329. 4. Kruse H, kirkemo A M, Handeland K. Wildlife as source of zoonotic infections. Emerg Infect Dis. 2004; 10(12):2067-72. Epub 2005/01/25. doi: 10.3201/eid1012.040707. PubMed PMID: 15663840; PMCID: PMC3323390. 5. Franz D R, Jahrling P B, Friedlander A M, McClain D J, Hoover D L, Bryne W R, Pavlin J A, Christopher C W, Eitzen E M. Clinical recognition and management of patients exposed to biological warfare agents. Jama-Journal of the American Medical Association. 1997; 278(5):399-411. doi: DOI 10.1001/jama.278.5.399. PubMed PMID: ISI:A1997XN51800032. 6. Yang X, Skyberg J A, Cao L, Clapp B, Thornburg T, Pascual D W. Progress in Brucella vaccine development. Frontiers in biology. 2013; 8(1):60-77. doi: 10.1007/s11515-012-1196-0. PubMed PMID: 23730309; PMCID: 3666581. 7. Perkins S D, Smither S J, Atkins H S. Towards a Brucella vaccine for humans. Fems Microbiol Rev. 2010; 34(3):379-94. Epub 2010/02/26. doi: 10.1111/j.1574-6976.2010.00211.x. PubMed PMID: 20180858. 8. Nicoletti P. Vaccination against Brucella. Advances in biotechnological processes. 1990; 13:147-68. Epub 1990/01/01. PubMed PMID: 2185782. 9. Beckett F W, MacDiarmid S C. The effect of reduced-dose Brucella abortus strain 19 vaccination in accredited dairy herds. The British veterinary journal. 1985; 141(5):507-14. Epub 1985/09/01. doi: 10.1016/0007-1935(85)90046-6. PubMed PMID: 4063777. 10. Blasco J M, Marin C M, Barberan M, Moriyon I, Diaz R. Immunization with Brucella melitensis Rev-1 against Brucella ovis infection of rams. Vet Microbiol. 1987; 14(4):381-92. doi: Doi 10.1016/0378-1135(87)90029-0. PubMed PMID: ISI:A1987K619100004. 11. Marianelli C, Ciuchini F, Tarantino M, Pasquali P, Adone R. Genetic bases of the rifampin resistance phenotype in Brucella spp. J Clin Microbiol. 2004; 42(12):5439-43. Epub 2004/12/08. doi: 10.1128/JCM.42.12.5439-5443.2004. PubMed PMID: 15583262; PMCID: 535235. 12. Franco M P, Mulder M, Gilman R H, Smits H L. Human brucellosis. The Lancet Infectious diseases. 2007; 7(12):775-86. doi: 10.1016/S1473-3099(07)70286-4. PubMed PMID: 18045560. 13. Roy Curtiss, III, Zhang X, Wanda S-Y, Kang H Y, Konjufca V, Li Y, Gunn B, Wang S, Scarpellini G, Lee I S. Induction of host immune responses using Salmonella-vectored vaccines. Virulence Mechanisms of Bacterial Pathogens, Fourth Edition: American Society of Microbiology; 2007. p. 297-313. 14. Shi H, Santander J, Brenneman K E, Wanda S Y, Wang S, Senechal P, Sun W, Roland K L, Curtiss R, III. Live recombinant Salmonella Typhi vaccines constructed to investigate the role of rpoS in eliciting immunity to a heterologous antigen. PLoS One. 2010; 5(6):e11142. Epub 2010/06/30. doi: 10.1371/journal.pone.0011142. PubMed PMID: 20585446; PMCID: 2887840. 15. Wang S, Shi H, Li Y, Shi Z, Zhang X, Baek C H, Mothershead T, Curtiss R, III. A colanic acid operon deletion mutation enhances induction of early antibody responses by live attenuated Salmonella vaccine strains. Infect Immun. 2013; 81(9):3148-62. doi: 10.1128/IAI.00097-13. PubMed PMID: 23774599; PMCID: 3754205. 16. Clark-Curtiss J E, Curtiss R, 3rd. Salmonella Vaccines: Conduits for Protective Antigens. J Immunol. 2018; 200(1):39-48. Epub 2017/12/20. doi: 10.4049/jimmunol.1600608. PubMed PMID: 29255088. 17. Kong W, Wanda S Y, Zhang X, Bollen W, Tinge S A, Roland K L, Curtiss R, III. Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment. Proc Natl Acad Sci USA. 2008; 105(27):9361-6. Epub 2008/07/09. doi: 0803801105 [pii] 10.1073/pnas.0803801105. PubMed PMID: 18607005; PMCID: 2453710. 18. Curtiss R, 3rd, Wanda S Y, Gunn B M, Zhang X, Tinge S A, Ananthnarayan V, Mo H, Wang S, Kong W. Salmonella enterica serovar typhimurium strains with regulated delayed attenuation in vivo. Infection and immunity. 2009; 77(3):1071-82. doi: 10.1128/IAI.00693-08. PubMed PMID: 19103774; PMCID: 2643627. 19. Ju?rez-Rodr?guez M D, Yang J, Kader R, Alamuri P, Curtiss R, 3rd, Clark-Curtiss J E. Live attenuated Salmonella vaccines displaying regulated delayed lysis and delayed antigen synthesis to confer protection against Mycobacterium tuberculosis. Infect Immun. 2012; 80(2):815-31. Epub 2011/12/07. doi: 10.1128/iai.05526-11. PubMed PMID: 22144485; PMCID: PMC3264310. 20. Torres-Escobar A, Ju?rez-Rodr?guez M D, Gunn B M, Branger C G, Tinge S A, Curtiss R, 3rd. Fine-tuning synthesis of Yersinia pestis LcrV from runaway-like replication balanced-lethal plasmid in a Salmonella enterica serovar typhimurium vaccine induces protection against a lethal Y. pestis challenge in mice. Infect Immun. 2010; 78(6):2529-43. Epub 2010/03/24. doi: 10.1128/iai.00005-10. PubMed PMID: 20308296; PMCID: PMC2876574. 21. Sanapala S, Rahav H, Patel H, Sun W, Curtiss R, III. Multiple antigens of Yersinia pestis delivered by live recombinant attenuated Salmonella vaccine strains elicit protective immunity against plague. Vaccine. 2016; 34(21):2410-6. doi: 10.1016/j.vaccine.2016.03.094. PubMed PMID: 27060051. 22. Xin W, Wanda S Y, Li Y, Wang S, Mo H, Curtiss R, 3rd. Analysis of type II secretion of recombinant pneumococcal PspA and PspC in a Salmonella enterica serovar Typhimurium vaccine with regulated delayed antigen synthesis. Infect Immun. 2008; 76(7):3241-54. Epub 2008/05/07. doi: 10.1128/iai.01623-07. PubMed PMID: 18458067; PMCID: PMC2446722. 23. Liu Q, Liu Q, Yi J, Liang K, Hu B, Zhang X, Curtiss R, III, Kong Q. Outer membrane vesicles from flagellin-deficient Salmonella enterica serovar Typhimurium induce cross-reactive immunity and provide cross-protection against heterologous Salmonella challenge. Sci Rep. 2016; 6:34776. doi: 10.1038/srep34776. PubMed PMID: 27698383; PMCID: PMC5048178. 24. Kong W, Clark-Curtiss J, Curtiss R, 3rd. Utilizing Salmonella for antigen delivery: the aims and benefits of bacterial delivered vaccination. Expert Rev Vaccines. 2013; 12(4):345-7. Epub 2013/04/09. doi: 10.1586/erv.13.7. PubMed PMID: 23560914. 25. Kong W, Brovold M, Koeneman B A, Clark-Curtiss J, Curtiss R, III. Turning self-destructing Salmonella into a universal DNA vaccine delivery platform. Proc Natl Acad Sci USA. 2012; 109(47):19414-9. doi: 10.1073/pnas.1217554109. PubMed PMID: 23129620; PMCID: 3511069. 26. Gunn B M, Wanda S Y, Burshell D, Wang C, Curtiss R, 3rd. Construction of recombinant attenuated Salmonella enterica serovar typhimurium vaccine vector strains for safety in newborn and infant mice. Clin Vaccine Immunol. 2010; 17(3):354-62. Epub 2010/01/08. doi: 10.1128/cvi.00412-09. PubMed PMID: 20053874; PMCID: PMC2837962. 27. Kong Q, Six D A, Roland K L, Liu Q, Gu L, Reynolds C M, Wang X, Raetz C R, Curtiss R, 3rd. Salmonella synthesizing 1-dephosphorylated [corrected] lipopolysaccharide exhibits low endotoxic activity while retaining its immunogenicity. J Immunol. 2011; 187(1):412-23. Epub 2011/06/03. doi: 10.4049/jimmunol.1100339. PubMed PMID: 21632711; PMCID: PMC3119770. 28. Gomez G, Pei J, Mwangi W, Adams L G, Rice-Ficht A, Ficht T A. Immunogenic and invasive properties of Brucella melitensis 16M outer membrane protein vaccine candidates identified via a reverse vaccinology approach. PloS one. 2013; 8(3):e59751. doi: 10.1371/journal.pone.0059751. PubMed PMID: 23533646; PMCID: 3606113. 29. Bowden R A, Cloeckaert A, Zygmunt M S, Dubray G. Evaluation of immunogenicity and protective activity in BALB/c mice of the 25-kDa major outer-membrane protein of Brucella melitensis (Omp25) expressed in Escherichia coli. Journal of medical microbiology. 1998; 47(1):39-48. doi: 10.1099/00222615-47-1-39. PubMed PMID: 9449948. 30. Ghasemi A, Salari M H, Zarnani A H, Pourmand M R, Ahmadi H, Mirshafiey A, Jeddi-Tehrani M. Immune reactivity of Brucella melitensis-vaccinated rabbit serum with recombinant Omp31 and DnaK proteins. Iran J Microbiol. 2013; 5(1):19-23. Epub 2013/03/08. PubMed PMID: 23467315; PMCID: PMC3577567. 31. Ghasemi A, Jeddi-Tehrani M, Mautner J, Salari M H, Zarnani A H. Simultaneous immunization of mice with Omp31 and TF provides protection against Brucella melitensis infection. Vaccine. 2015; 33(42):5532-8. doi: 10.1016/j.vaccine.2015.09.013. PubMed PMID: 26384448. 32. Yang X, Hudson M, Walters N, Bargatze R F, Pascual D W. Selection of protective epitopes for Brucella melitensis by DNA vaccination. Infection and immunity. 2005; 73(11):7297-303. doi: 10.1128/IAI.73.11.7297-7303.2005. PubMed PMID: 16239526; PMCID: 1273852. 33. Ghasemi A, Ranjbar R, Amani J. In silico analysis of chimeric TF, Omp31 and BP26 fragments of Brucella melitensis for development of a multi subunit vaccine candidate. Iran J Basic Med Sci. 2014; 17(3):172-80. Epub 2014/05/23. PubMed PMID: 24847419; PMCID: PMC4016687. 34. Velikovsky C A, Goldbaum F A, Cassataro J, Estein S, Bowden R A, Bruno L, Fossati C A, Giambartolomei G H. Brucella lumazine synthase elicits a mixed Th1-Th2 immune response and reduces infection in mice challenged with Brucella abortus 544 independently of the adjuvant formulation used. Infect Immun. 2003; 71(10):5750-5. Epub 2003/09/23. PubMed PMID: 14500496; PMCID: PMC201088. 35. Sciutto E, Toledo A, Cruz C, Rosas G, Meneses G, Laplagne D, Ainciart N, Cervantes J, Fragoso G, Goldbaum F A. Brucella spp. lumazine synthase: a novel antigen delivery system. Vaccine. 2005; 23(21):2784-90. Epub 2005/03/23. doi: 10.1016/j.vaccine.2004.11.043. PubMed PMID: 15780726. 36. Oliveira S C, Splitter G A. Immunization of mice with recombinant L7/L12 ribosomal protein confers protection against Brucella abortus infection. Vaccine. 1996; 14(10):959-62. Epub 1996/07/01. PubMed PMID: 8873388. 37. Sung K Y, Jung M, Shin M K, Park H E, Lee J J, Kim S, Yoo H S. Induction of immune responses by two recombinant proteins of Brucella abortus, outer membrane proteins 2b porin and Cu/Zn superoxide dismutase, in mouse model. J Microbiol Biotechnol. 2014; 24(6):854-61. Epub 2014/03/13. PubMed PMID: 24608566. 38. Jiang Y, Mo H, Willingham C, Wang S, Park J Y, Kong W, Roland K L, Curtiss R, III. Protection Against Necrotic Enteritis in Broiler Chickens by Regulated Delayed Lysis Salmonella Vaccines. Avian diseases. 2015; 59(4):475-85. doi: 10.1637/11094-041715-Reg. PubMed PMID: 26629620. 39. Ju?rez-Rodr?guez M D, Yang J, Kader R, Alamuri P, Curtiss R, III, Clark-Curtiss J E. Live attenuated Salmonella vaccines displaying regulated delayed lysis and delayed antigen synthesis to confer protection against Mycobacterium tuberculosis. Infect Immun. 2012; 80(2):815-31. doi: 10.1128/IAI.05526-11. PubMed PMID: 22144485; PMCID: 3264310. 40. Wang S, Li Y, Scarpellini G, Kong W, Shi H, Baek C H, Gunn B, Wanda S Y, Roland K L, Zhang X, Senechal-Willis P, Curtiss R, 3rd. Salmonella vaccine vectors displaying delayed antigen synthesis in vivo to enhance immunogenicity. Infection and immunity. 2010; 78(9):3969-80. doi: 10.1128/IAI.00444-10. PubMed PMID: 20605977; PMCID: 2937466. 41. Ashraf S, Kong W, Wang S, Yang J, Curtiss R, III. Protective cellular responses elicited by vaccination with influenza nucleoprotein delivered by a live recombinant attenuated Salmonella vaccine. Vaccine. 2011; 29(23):3990-4002. doi: 10.1016/j.vaccine.2011.03.066. PubMed PMID: 21466806; PMCID: 3092860. 42. Xin W, Wanda S Y, Zhang X, Santander J, Scarpellini G, Ellis K, Alamuri P, Curtiss R, 3rd. The Asd(+)-DadB(+) dual-plasmid system offers a novel means to deliver multiple protective antigens by a recombinant attenuated Salmonella vaccine. Infection and immunity. 2012; 80(10):3621-33. doi: 10.1128/IAI.00620-12. PubMed PMID: 22868499; PMCID: 3457550. 43. Li Y, Wang S, Xin W, Scarpellini G, Shi Z, Gunn B, Roland K L, Curtiss R, III. A sopB deletion mutation enhances the immunogenicity and protective efficacy of a heterologous antigen delivered by live attenuated Salmonella enterica vaccines. Infect Immun. 2008; 76(11):5238-46. PubMed PMID: 18765737. 44. Ameiss K, Ashraf S, Kong W, Pekosz A, Wu W H, Milich D, Billaud J N, Curtiss R, III. Delivery of woodchuck hepatitis virus-like particle presented influenza M2e by recombinant attenuated Salmonella displaying a delayed lysis phenotype. Vaccine. 2010; 28(41):6704-13. doi: 10.1016/j.vaccine.2010.07.083. PubMed PMID: 20691653; PMCID: 2939226. 45. Nakayama K, Kelly S M, Curtiss R, III Construction of an Asd.sup.+ expression-cloning Vector: stable maintenance and high level expression of cloned genes in a Salmonella vaccine strain. Nat Biotech. 1988; 6(6):693-7. 46. Ahman H, Kayhty H, Vuorela A, Leroy O, Eskola J. Dose dependency of antibody response in infants and children to pneumococcal polysaccharides conjugated to tetanus toxoid. Vaccine. 1999; 17(20-21):2726-32. PubMed PMID: 10418924. 47. Siegrist C. Vaccine immunology. In: Plotkin S A, Orenstein W, Offit P A, editors. Vaccines. 6th ed: Elsevier Inc.; 2013. p. 14-32. 48. Sun W, Olinzock J, Wang S, Sanapala S, Curtiss R, III. Evaluation of YadC protein delivered by live attenuated Salmonella as a vaccine against plague. Pathogens and disease. 2014; 70(2):119-31. doi: 10.1111/2049-632X.12076. PubMed PMID: 23913628; PMCID: 4028040. 49. Muralinath M, Kuehn M J, Roland K L, Curtiss R, 3rd. Immunization with Salmonella enterica serovar Typhimurium-derived outer membrane vesicles delivering the pneumococcal protein PspA confers protection against challenge with Streptococcus pneumoniae. Infect Immun. 2011; 79(2):887-94. Epub 2010/12/01. doi: 10.1128/iai.00950-10. PubMed PMID: 21115718; PMCID: PMC3028854. 50. Konjufca V, Jenkins M, Wang S, Ju?rez-Rodr?guez M D, Curtiss R, III. Immunogenicity of recombinant attenuated Salmonella enterica serovar Typhimurium vaccine strains carrying a gene that encodes Eimeria tenella antigen SO7. Infect Immun. 2008; 76(12):5745-53. Epub 2008/09/24. doi: IAI.00897-08 [pii] 10.1128/IAI.00897-08. PubMed PMID: 18809658; PMCID: 2583560. 51. Curtiss R, III., Porter S B, Munson M, Tinge S A, Hassan J O, Gentry-Weeks C, Kelly S M. Nonrecombinant and recombinant avirulent Salmonella live vaccines for poultry. In: Blankenship L C, Bailey J H S, Cox N A, Stern N J, Meinersmann R J, editors. Colonization control of human bacterial enteropathogens in poultry. New York Academic Press 1991. p. 169-98. 52. Bertani G. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J Bacteriol. 1951; 62(3):293-300. Epub 1951/09/01. PubMed PMID: 14888646. 53. Sambrook J, Russell D W. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press; 2001. 54. Ehretsmann C P, Carpousis A J, Krisch H M. Specificity of Escherichia coli endoribonuclease RNase E: in vivo and in vitro analysis of mutants in a bacteriophage T4 mRNA processing site. Genes Dev. 1992; 6(1)149-59. Epub 1992/01/01. PubMed PMID: 1730408. 55. McDowall K J, Kaberdin V R, Wu S W, Cohen S N, Lin-Chao S. Site-specific RNase E cleavage of oligonucleotides and inhibition by stem-loops. Nature. 1995; 374(6519):287-90. Epub 1995/03/16. doi: 10.1038/374287a0. PubMed PMID: 7533896. 56. Lin-Chao S, Wong T T, McDowall K J, Cohen S N. Effects of nucleotide sequence on the specificity of rne-dependent and RNase E-mediated cleavages of RNA I encoded by the pBR322 plasmid. J Biol Chem. 1994; 269(14):10797-803. Epub 1994/04/08. PubMed PMID: 7511607. 57. Kong Q, Liu Q, Roland K L, Curtiss R, III. Regulated delayed expression of rfaH in an attenuated Salmonella enterica serovar Typhimurium vaccine enhances immunogenicity of outer membrane proteins and a heterologous antigen. Infect Immun. 2009; 77(12):5572-82. Epub 2009/10/07. doi: IA1.00831-09 [pii] 10.1128/IAI.00831-09. PubMed PMID: 19805538; PMCID: 2786485. 58. Hitchcock P J, Brown T M. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. Journal of bacteriology. 1983; 154(1):269-77. Epub 1983/04/01. PubMed PMID: 6187729. 59. Yang X, Clapp B, Thornburg T, Hoffman C, Pascual D W. Vaccination with a DeltanorD DeltaznuA Brucella abortus mutant confers potent protection against virulent challenge. Vaccine. 2016; 34(44):5290-7. doi: 10.1016/j.vaccine.2016.09.004. PubMed PMID: 27639282; PMCID: 5053898. 60. Herzberg M, Elberg S S. Immunization against Brucella infection. III. Response of mice and guinea pigs to injection of viable and nonviable suspensions of a streptomycin-dependent mutant of Brucella melitensis. J Bacteriol. 1955; 69(4):432-5. Epub 1955/04/01. PubMed PMID: 14367297; PMCID: PMC357555. 61. Thornton D H, Muskett J C. The use of laboratory animals in the potency test of Brucella abortus S19 vaccine. Response of guinea-pigs to graduated doses of vaccine and challenge. J Comp Pathol. 1972; 82(2):201-8. Epub 1972/04/01. PubMed PMID: 4625200. 62. Engvall E, Perlmann P. Enzyme-linked immunosorbent assay (ELISA). Quantitative assay of immunoglobulin G. Immunochemistry. 1971; 8(9):871-4. Epub 1971/09/01. PubMed PMID: 5135623. 63. Van Weemen B K, Schuurs A H. Immunoassay using antigen-enzyme conjugates. FEBS Lett. 1971; 15(3):232-6. Epub 1971/06/24. doi: 0014-5793(71)80319-8 [pii]. PubMed PMID: 11945853. 64. Kang H Y, Srinivasan J, Curtiss R, III. Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuated Salmonella enterica serovar Typhimurium vaccine. Infect Immun. 2002; 70(4):1739-49. 65. Biagini R E, Sammons D L, Smith J P, MacKenzie B A, Striley C A, Semenova V, Steward-Clark E, Stamey K, Freeman A E, Quinn C P, Snawder J E. Comparison of a multiplexed fluorescent covalent microsphere immunoassay and an enzyme-linked immunosorbent assay for measurement of human immunoglobulin G antibodies to anthrax toxins. Clinical and diagnostic laboratory immunology. 2004; 11(1):50-5. Epub 2004/01/13. PubMed PMID: 14715544; PMCID: 321348. 66. Clapp B, Yang X, Thornburg T, Walters N, Pascual D W. Nasal vaccination stimulates CD8(+) T cells for potent protection against mucosal Brucella melitensis challenge. Immunol Cell Biol. 2016; 94(5):496-508. Epub 2016/01/12. doi: 10.1038/icb.2016.5. PubMed PMID: 26752510; PMCID: PMC4879022. 67. Lalsiamthara J, Gogia N, Goswami T K, Singh R K, Chaudhuri P. Intermediate rough Brucella abortus S19Deltaper mutant is DIVA enable, safe to pregnant guinea pigs and confers protection to mice. Vaccine. 2015; 33(22):2577-83. Epub 2015/04/15. doi: 10.1016/j.vaccine.2015.04.004. PubMed PMID: 25869887. 68. Miranda K L, Dorneles E M, Poester F P, Martins Filho P S, Pauletti R B, Lage A P. Different resistance patterns of reference and field strains of Brucella abortus. Braz J Microbiol. 2015; 46(1):265-9. Epub 2015/07/30. doi: 10.1590/s1517-838246120130625. PubMed PMID: 26221116; PMCID: PMC4512078.