COMPOUNDS AND METHODS FOR REDUCING ATXN3 EXPRESSION

20190247420 ยท 2019-08-15

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN3 mRNA in a cell or animal, and in certain instances reducing the amount of Ataxin-3 protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to prevent or ameliorate at least one symptom or hallmark of a neurodegenerative disease. Such symptoms and hallmarks include ataxia, neuropathy, and aggregate formation. Such neurodegenerative diseases include SCA3.

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of SEQ ID NO: 23-334.

2. The oligomeric compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1, when measured across the entire nucleobase sequence of the modified oligonucleotide.

3. The oligomeric compound of claim 1 or 2, wherein the modified oligonucleotide comprises at least one modified nucleoside.

4. The oligomeric compound of claim 3, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

5. The oligomeric compound of claim 4, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

6. The oligomeric compound of claim 5, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2-4 bridge, wherein the 2-4 bridge is selected from O-CH.sub.2-; and OCH(CH.sub.3).

7. The oligomeric compound of any of claims 3-6, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified non-bicyclic sugar moiety.

8. The oligomeric compound of claim 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicylic sugar moiety comprising a 2-MOE or 2-OMe.

9. The oligomeric compound of any of claims 4-8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

10. The oligomeric compound of claim 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

11. The oligomeric compound of any of claims 1-10, wherein the modified oligonucleotide has a sugar motif comprising: a 5-region consisting of 1-5 linked 5-nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3-region consisting of 1-5 linked 3-region nucleosides; wherein each of the 5-region nucleosides and each of the 3-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified DNA sugar moiety.

12. The oligomeric compound of any of claims 1-11, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

13. The oligomeric compound of claim 12, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

14. The oligomeric compound of claim 12 or 13 wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

15. The oligomeric compound of claim 12 or 13 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

16. The oligomeric compound of any of claims 12-15, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

17. The oligomeric compound of any of claims 1-16, wherein the modified oligonucleotide comprises at least one modified nucleobase.

18. The oligomeric compound of claim 17, wherein the modified nucleobase is a 5-methylcytosine.

19. The oligomeric compound of any of claims 1-18, wherein the modified oligonucleotide consists of 12-22, 12-20, 14-20, 16-20, or 18-20 linked nucleosides.

20. The oligomeric compound of any of claims 1-14, wherein the modified oligonucleotide consists of 16, 17, 18, 19 or 20 linked nucleosides.

21. The oligomeric compound of any of claims 1-20 consisting of the modified oligonucleotide.

22. The oligomeric compound of any of claims 1-20 comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

23. The oligomeric compound of claim 22, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

24. The oligomeric compound of claim 22 or 23, wherein the conjugate linker consists of a single bond.

25. The oligomeric compound of claim 23, wherein the conjugate linker is cleavable.

26. The oligomeric compound of claim 25, wherein the conjugate linker comprises 1-3 linker-nucleosides.

27. The oligomeric compound of any of claims 22-26, wherein the conjugate group is attached to the modified oligonucleotide at the 5-end of the modified oligonucleotide.

28. The oligomeric compound of any of claims 22-26, wherein the conjugate group is attached to the modified oligonucleotide at the 3-end of the modified oligonucleotide.

29. The oligomeric compound of any of claims 1-28 comprising a terminal group.

30. The oligomeric compound of any of claims 1-29 wherein the oligomeric compound is a singled-stranded oligomeric compound.

31. The oligomeric compound of any of claim 1-25 or 27-30, wherein the oligomeric compound does not comprise linker-nucleosides.

32. An oligomeric duplex comprising an oligomeric compound of any of claims 1-29 and 31.

33. An antisense compound comprising or consisting of an oligomeric compound of any of claims 1-31 or an oligomeric duplex of claim 32.

34. A modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of SEQ ID NO: 23-334.

35. An oligomeric compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 614-637 of SEQ ID NO: 1, nucleobases 833-852 of SEQ ID NO: 1, or nucleobases 1091-1131 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1 as measured over the entirety of the modified oligonucleotide.

36. A pharmaceutical composition comprising an oligomeric compound of any of claims 1-31 and 35, an oligomeric duplex of claim 32, or a modified oligonucleotide of claim 34 and a pharmaceutically acceptable carrier or diluent.

37. A method comprising administering to an animal a pharmaceutical composition of claim 36.

38. A method of treating a disease associated with ATXN3 comprising administering to an individual having or at risk for developing a disease associated with ATXN3 a therapeutically effective amount of a pharmaceutical composition according to claim 36; and thereby treating the disease associated with ATXN3.

39. The method of claim 38, wherein the disease associated with ATXN3 is a neurodegenerative disease.

40. The method of claim 39, wherein the neurodegenerative disease is SCA3.

41. The method of claim 39, wherein at least one symptom or hallmark of the neurodegenerative disease is ameliorated.

42. The method of claim 41, wherein the symptom or hallmark is ataxia, neuropathy, and aggregate formation.

43. A chirally enriched population of oligomeric compounds of any of claim 1-32 or 35 wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

44. The chirally enriched population of claim 43, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.

45. The chirally enriched population of claim 43, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.

46. The chirally enriched population of claim 43, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage

47. The chirally enriched population of claim 46, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage.

48. The chirally enriched population of claim 46, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.

49. The chirally enriched population of claim 46, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

50. The chirally enriched population of claim 43 or claim 46 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5 to 3 direction.

51. A chirally enriched population of oligomeric compounds of any of claim 1-32 or 35, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

52. A chirally enriched population of modified oligonucleotides of claim 34 wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

53. The chirally enriched population of claim 52, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.

54. The chirally enriched population of claim 52, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.

55. The chirally enriched population of claim 52, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage

56. The chirally enriched population of claim 55, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage.

57. The chirally enriched population of claim 55, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.

58. The chirally enriched population of claim 55, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

59. The chirally enriched population of claim 52 or claim 55 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5 to 3 direction.

60. A chirally enriched population of modified oligonucleotides of claim 34, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0007] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including as well as other forms, such as includes and included, is not limiting. Also, terms such as element or component encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0008] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

[0009] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

[0010] Unless otherwise indicated, the following terms have the following meanings:

Definitions

[0011] As used herein, 2-deoxynucleoside means a nucleoside comprising 2-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0012] As used herein, 2-substituted nucleoside means a nucleoside comprising a 2-substituted sugar moiety. As used herein, 2-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2-substituent group other than H or OH.

[0013] As used herein, administering means providing a pharmaceutical agent to an animal.

[0014] As used herein, animal means a human or non-human animal.

[0015] As used herein, antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

[0016] As used herein, antisense compound means an oligomeric compound or oligomeric duplex capable of achieving at least one antisense activity.

[0017] As used herein, ameliorate in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. In certain embodiments, the symptom or hallmark is ataxia, neuropathy, and aggregate formation. In certain embodiments, amelioration of these symptoms results in improved motor function, reduced neuropathy, or reduction in number of aggregates.

[0018] As used herein, bicyclic nucleoside or BNA means a nucleoside comprising a bicyclic sugar moiety. As used herein, bicyclic sugar or bicyclic sugar moiety means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0019] As used herein, chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

[0020] As used herein, cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

[0021] As used herein, complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, fully complementary or 100% complementary in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

[0022] As used herein, conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0023] As used herein, conjugate linker means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0024] As used herein, conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0025] As used herein, contiguous in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.

[0026] As used herein, gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the gap and the external regions may be referred to as the wings. Unless otherwise indicated, gapmer refers to a sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides of the gap of a gapmer are unmodified 2-deoxyfuranosyl. Thus, the term MOE gapmer indicates a gapmer having a sugar motif of 2-MOE nucleosides in both wings and a gap of 2-deoxynucleosides. Unless otherwise indicated, a MOE gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

[0027] As used herein, hotspot region is a range of nucleobases on a target nucleic acid amenable to oligomeric compounds for reducing the amount or activity of the target nucleic acid as demonstrated in the examples hereinbelow.

[0028] As used herein, hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0029] As used herein, the term internucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage. Phosphorothioate linkage is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0030] As used herein, linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0031] As used herein, non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substitutent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0032] As used herein, mismatch or non-complementary means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compound are aligned.

[0033] As used herein, MOE means methoxyethyl. 2-MOE means a OCH.sub.2CH.sub.2OCH.sub.3 group at the 2 position of a furanosyl ring.

[0034] As used herein, motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

[0035] As used herein, mRNA means an RNA transcript that encodes a protein and includes pre-mRNA and mature mRNA unless otherwise specified.

[0036] As used herein, neurodegenerative disease means a condition marked by progressive loss of structure or function of neurons, including death of neurons. In certain embodiments, neurodegenerative disease is spinocerebellar ataxia type 3 (SCA3).

[0037] As used herein, nucleobase means an unmodified nucleobase or a modified nucleobase. As used herein an unmodified nucleobase is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). As used herein, a modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A 5-methylcytosine is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

[0038] As used herein, nucleoside means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. Linked nucleosides are nucleosides that are connected in a continuos sequence (i.e., no additional nucleosides are presented between those that are linked).

[0039] As used herein, oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A singled-stranded oligomeric compound is an unpaired oligomeric compound. The term oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a duplexed oligomeric compound.

[0040] As used herein, oligonucleotide means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

[0041] As used herein, pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water; sterile saline; or sterile buffer solution.

[0042] As used herein pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0043] As used herein pharmaceutical composition means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an antisense compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

[0044] As used herein, phosphorus moiety means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

[0045] As used herein prodrug means a therapeutic agent in a form outside the body that is converted to a different form within an animal or cells thereof. Typically conversion of a prodrug within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

[0046] As used herein, reducing or inhibiting the amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

[0047] As used herein, RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

[0048] As used herein, self-complementary in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0049] As used herein, standard cell assay means the assay described in Example 1 and reasonable variations thereof.

[0050] As used herein, stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0051] As used herein, sugar moiety means an unmodified sugar moiety or a modified sugar moiety. As used herein, unmodified sugar moiety means a 2-OH(H) furanosyl moiety, as found in RNA (an unmodified RNA sugar moiety), or a 2-H(H) moiety, as found in DNA (an unmodified DNA sugar moiety). Unmodified sugar moieties have one hydrogen at each of the 1, 3, and 4 positions, an oxygen at the 3 position, and two hydrogens at the 5 position. As used herein, modified sugar moiety or modified sugar means a modified furanosyl sugar moiety or a sugar surrogate. As used herein, modified furanosyl sugar moiety means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars. As used herein, sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

[0052] As used herein, target nucleic acid and target RNA mean a nucleic acid that an antisense compound is designed to affect.

[0053] As used herein, target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0054] As used herein, terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0055] As used herein, therapeutically effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.

[0056] The present disclosure provides the following non-limiting numbered embodiments:

Embodiment 1

[0057] An oligomeric compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of SEQ ID NO: 23-334.

Embodiment 2

[0058] The oligomeric compound of embodiment 1, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1, when measured across the entire nucleobase sequence of the modified oligonucleotide.

Embodiment 3

[0059] The oligomeric compound of embodiments 1 or 2, wherein the modified oligonucleotide comprises at least one modified nucleoside.

Embodiment 4

[0060] The oligomeric compound of embodiments 3, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

Embodiment 5

[0061] The oligomeric compound of embodiment 4, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

Embodiment 6

[0062] The oligomeric compound of embodiment 5, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2-4 bridge, wherein the 2-4 bridge is selected from OCH2-; and OCH(CH3)-.

Embodiment 7

[0063] The oligomeric compound of any of embodiments 3-6, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified non-bicyclic sugar moiety.

Embodiment 8

[0064] The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicylic sugar moiety comprising a 2-MOE or 2-OMe.

Embodiment 9

[0065] The oligomeric compound of any of embodiments 4-8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

Embodiment 10

[0066] The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

Embodiment 11

[0067] The oligomeric compound of any of embodiments 1-10, wherein the modified oligonucleotide has a sugar motif comprising:

[0068] a 5-region consisting of 1-5 linked 5-nucleosides;

[0069] a central region consisting of 6-10 linked central region nucleosides; and

[0070] a 3-region consisting of 1-5 linked 3-region nucleosides; wherein each of the 5-region nucleosides and each of the 3-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified DNA sugar moiety.

Embodiment 12

[0071] The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

Embodiment 13

[0072] The oligomeric compound of embodiment 12, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

Embodiment 14

[0073] The oligomeric compound of embodiment 12 or 13 wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 15

[0074] The oligomeric compound of embodiment 12 or 13 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

Embodiment 16

[0075] The oligomeric compound of any of embodiments 12-15, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

Embodiment 17

[0076] The oligomeric compound of any of embodiments 1-16, wherein the modified oligonucleotide comprises at least one modified nucleobase.

Embodiment 18

[0077] The oligomeric compound of embodiment 17, wherein the modified nucleobase is a 5-methylcytosine.

Embodiment 19

[0078] The oligomeric compound of any of embodiments 1-18, wherein the modified oligonucleotide consists of 12-22, 12-20, 14-20, 16-20, or 18-20 linked nucleosides.

Embodiment 20

[0079] The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide consists of 16, 17, 18, 19 or 20 linked nucleosides.

Embodiment 21

[0080] The oligomeric compound of any of embodiments 1-20 consisting of the modified oligonucleotide.

Embodiment 22

[0081] The oligomeric compound of any of embodiments 1-20 comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

Embodiment 23

[0082] The oligomeric compound of embodiment 22, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

Embodiment 24

[0083] The oligomeric compound of embodiment 22 or 23, wherein the conjugate linker consists of a single bond.

Embodiment 25

[0084] The oligomeric compound of embodiment 23, wherein the conjugate linker is cleavable.

Embodiment 26

[0085] The oligomeric compound of embodiment 25, wherein the conjugate linker comprises 1-3 linker-nucleosides.

Embodiment 27

[0086] The oligomeric compound of any of embodiments 22-26, wherein the conjugate group is attached to the modified oligonucleotide at the 5-end of the modified oligonucleotide.

Embodiment 28

[0087] The oligomeric compound of any of embodiments 22-26, wherein the conjugate group is attached to the modified oligonucleotide at the 3-end of the modified oligonucleotide.

Embodiment 29

[0088] The oligomeric compound of any of embodiments 1-28 comprising a terminal group.

Embodiment 30

[0089] The oligomeric compound of any of embodiments 1-29 wherein the oligomeric compound is a singled-stranded oligomeric compound.

Embodiment 31

[0090] The oligomeric compound of any of embodiments 1-25 or 27-30, wherein the oligomeric compound does not comprise linker-nucleosides.

Embodiment 32

[0091] An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-29 and 31.

Embodiment 33

[0092] An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-31 or an oligomeric duplex of embodiment 32.

Embodiment 34

[0093] A modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of SEQ ID NO: 23-334.

Embodiment 35

[0094] An oligomeric compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 614-637 of SEQ ID NO: 1, nucleobases 833-852 of SEQ ID NO: 1, or nucleobases 1091-1131 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1 as measured over the entirety of the modified oligonucleotide.

Embodiment 36

[0095] A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-31 and 35, an oligomeric duplex of embodiment 32, or a modified oligonucleotide of embodiment 34 and a pharmaceutically acceptable carrier or diluent.

Embodiment 37

[0096] A method comprising administering to an animal a pharmaceutical composition of embodiments 36.

Embodiment 38

[0097] A method of treating a disease associated with ATXN3 comprising administering to an individual having or at risk for developing a disease associated with ATXN3 a therapeutically effective amount of a pharmaceutical composition according to embodiment 36; and thereby treating the disease associated with ATXN3.

Embodiment 39

[0098] The method of embodiment 38, wherein the disease associated with ATXN3 is a neurodegenerative disease.

Embodiment 40

[0099] The method of embodiment 39, wherein the neurodegenerative disease is SCA3.

Embodiment 41

[0100] The method of embodiment 39, wherein at least one symptom or hallmark of the neurodegenerative disease is ameliorated.

Embodiment 42

[0101] The method of embodiment 41, wherein the symptom or hallmark is ataxia, neuropathy, and aggregate formation.

Embodiment 43

[0102] A chirally enriched population of oligomeric compounds of any of embodiments 1-32 or 35 wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

Embodiment 44

[0103] The chirally enriched population of embodiment 43, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.

Embodiment 45

[0104] The chirally enriched population of embodiment 43, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.

Embodiment 46

[0105] The chirally enriched population of embodiment 43, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage

Embodiment 47

[0106] The chirally enriched population of embodiment 46, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 48

[0107] The chirally enriched population of embodiment 46, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 49

[0108] The chirally enriched population of embodiment 46, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

Embodiment 50

[0109] The chirally enriched population of embodiment 43 or embodiment 46 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5 to 3 direction.

Embodiment 51

[0110] A chirally enriched population of oligomeric compounds of any of embodiments 1-32 or 35, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

Embodiment 52

[0111] A chirally enriched population of modified oligonucleotides of embodiment 34 wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

Embodiment 53

[0112] The chirally enriched population of embodiment 52, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.

Embodiment 54

[0113] The chirally enriched population of embodiment 52, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.

Embodiment 55

[0114] The chirally enriched population of embodiment 52, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage

Embodiment 56

[0115] The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 57

[0116] The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 58

[0117] The chirally enriched population of embodiment 55, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

Embodiment 59

[0118] The chirally enriched population of embodiment 52 or embodiment 55 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5 to 3 direction.

Embodiment 60

[0119] A chirally enriched population of modified oligonucleotides of embodiment 34, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

[0120] I. Certain Oligonucleotides

[0121] In certain embodiments, provided herein are oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.

[0122] A. Certain Modified Nucleosides

[0123] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

[0124] 1. Certain Sugar Moieties

[0125] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0126] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2, 4, and/or 5 positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2-F, 2-OCH.sub.3 (OMe or O-methyl), and 2-O(CH.sub.2).sub.2OCH.sub.3 (MOE). In certain embodiments, 2-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, OC.sub.1-C.sub.10 alkoxy, OC.sub.1-C.sub.10 substituted alkoxy, OC.sub.1-C.sub.10 alkyl, OC.sub.1-C.sub.10 substituted alkyl, S-alkyl, N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl, O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(O)N(R.sub.m)(R.sub.a), where each R.sub.m and R.sub.a is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the 2-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5-methyl (R or S), 5-vinyl, and 5-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2-F-5-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.).

[0127] In certain embodiments, a 2-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2-substituent group selected from: F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CHCH.sub.2, OCH.sub.2CHCH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(O)N(R.sub.m)(R.sub.n)), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

[0128] In certain embodiments, a 2-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2-substituent group selected from: F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(O)N(H)CH.sub.3 (NMA).

[0129] In certain embodiments, a 2-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2-substituent group selected from: F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.

[0130] Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4 and the 2 furanose ring atoms. Examples of such 4 to 2 bridging sugar substituents include but are not limited to: 4-CH.sub.2-2, 4-(CH.sub.2).sub.2-2, 4-(CH.sub.2).sub.3-2, 4-CH.sub.2O-2 (LNA), 4-CH.sub.2S-2, 4-(CH.sub.2).sub.2O-2 (ENA), 4-CH(CH.sub.3)O-2 (referred to as constrained ethyl or cEt), 4-CH.sub.2OCH.sub.2-2, 4-CH.sub.2N(R)-2, 4-CH(CH.sub.2OCH.sub.3)O-2 (constrained MOE or cMOE) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4-C(CH.sub.3)(CH.sub.3)O-2 and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4-CH.sub.2N(OCH.sub.3)-2 and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4-CH.sub.2ON(CH.sub.3)-2 (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4-CH.sub.2C(H)(CH.sub.3)-2 (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4-CH.sub.2C(CH.sub.2)-2 and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4-C(R.sub.aR.sub.b)N(R)O-2, 4-C(R.sub.aR.sub.b)ON(R)-2, 4-CH.sub.2ON(R)-2, and 4-CH.sub.2N(R)O- 2, wherein each R, R.sub.a, and R.sub.b is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

[0131] In certain embodiments, such 4 to 2 bridges independently comprise from 1 to 4 linked groups independently selected from: [C(R.sub.a)(R.sub.b)].sub.n, [C(R.sub.a)(R.sub.b)].sub.nO, C(R.sub.a)C(R.sub.b), C(R.sub.a)N, C(NR.sub.a), C(O), C(S), O, Si(R.sub.a).sub.2, S(O).sub.x, and N(R.sub.a);

[0132] wherein:

[0133] x is 0, 1, or 2;

[0134] n is 1, 2, 3, or 4;

[0135] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(O)H), substituted acyl, CN, sulfonyl (S(O).sub.2-J.sub.1), or sulfoxyl (S(O)-J.sub.1); and

[0136] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(O)H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.

[0137] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J Am. Chem. Soc., 20017, 129, 8362-8379; Wengel et a., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

[0138] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the -L configuration or in the -D configuration.

##STR00001##

-L-methyleneoxy (4-CH.sub.2O-2) or -L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the -D configuration, unless otherwise specified.

[0139] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5-substituted and 4-2 bridged sugars).

[0140] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4-sulfur atom and a substitution at the 2-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5 position.

[0141] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (THP). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see, e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

##STR00002##

(F-HNA, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

##STR00003##

wherein, independently, for each of said modified THP nucleoside:

[0142] Bx is a nucleobase moiety;

[0143] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5 or 3-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and

[0144] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(X)J.sub.1, OC(X)NJ.sub.1J.sub.2, NJ.sub.3C(X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0145] In certain embodiments, modified THP nucleosides are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments, R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments, R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0146] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term morpholino means a sugar surrogate having the following structure:

##STR00004##

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as modified morpholinos.

[0147] In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (PNA), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

[0148] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides).

[0149] 2. Certain Modified Nucleobases

[0150] In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

[0151] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (CCCH.sub.3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0152] Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manohara et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

[0153] 3. Certain Modified Internucleoside Linkages

[0154] In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (PO) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (PS), and phosphorodithioates (HS-PS). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (CH.sub.2N(CH.sub.3)OCH.sub.2), thiodiester, thionocarbamate (OC(O)(NH)S); siloxane (OSiH.sub.2O); and N,N-dimethylhydrazine (CH.sub.2N(CH.sub.3)N(CH.sub.3)). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0155] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein B indicates a nucleobase:

##STR00005##

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0156] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3-CH.sub.2N(CH.sub.3)O-5), amide-3 (3-CH.sub.2C(O)N(H)-5), amide-4 (3-CH.sub.2N(H)C(O)-5), formacetal (3-OCH.sub.2O-5), methoxypropyl, and thioformacetal (3-SCH.sub.2O-5). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.

[0157] B. Certain Motifs

[0158] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

[0159] 1. Certain Sugar Motifs

[0160] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

[0161] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or wings and a central or internal region or gap. The three regions of a gapmer motif (the 5-wing, the gap, and the 3-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3-most nucleoside of the 5-wing and the 5-most nucleoside of the 3-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5-wing differs from the sugar motif of the 3-wing (asymmetric gapmer).

[0162] In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.

[0163] In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2-deoxy nucleoside.

[0164] In certain embodiments, the gapmer is a deoxy gapmer. In embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2-deoxy nucleoside. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.

[0165] In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2-modification.

[0166] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in the wings and the gap nucleosides comprise unmodified deoxynucleosides sugars. Thus, a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3-wing.

[0167] In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.

[0168] 2. Certain Nucleobase Motifs

[0169] In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0170] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3-end of the oligonucleotide. In certain embodiments, the block is at the 5-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5-end of the oligonucleotide.

[0171] In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

[0172] 3. Certain Internucleoside Linkage Motifs

[0173] In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (PO). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (PS). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0174] C. Certain Lengths

[0175] It is possible to increase or decrease the length of an oligonuclotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0176] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides

[0177] D. Certain Modified Oligonucleotides

[0178] In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

[0179] E. Certain Populations of Modified Oligonucleotides

[0180] Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for -D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucltoides of a chirally enriched population are enriched for both -D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular sterochemical configuration.

[0181] F. Nucleobase Sequence

[0182] In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0183] II. Certain Oligomeric Compounds

[0184] In certain embodiments, the invention provides oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3 and/or 5-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5-end of oligonucleotides.

[0185] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

[0186] A. Certain Conjugate Groups

[0187] In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

[0188] 1. Conjugate Moieties

[0189] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0190] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0191] 2. Conjugate Linkers

[0192] Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

[0193] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0194] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0195] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0196] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0197] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

[0198] In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0199] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

[0200] In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2-deoxy nucleoside that is attached to either the 3 or 5-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2-deoxyadenosine.

[0201] B. Certain Terminal Groups

[0202] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5-phosphate. Stabilized 5-phosphates include, but are not limited to 5-phosphanates, including, but not limited to 5-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2-linked nucleosides. In certain such embodiments, the 2-linked nucleoside is an abasic nucleoside.

[0203] III. Oligomeric Duplexes

[0204] In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.

[0205] IV. Antisense Activity

[0206] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not byridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

[0207] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently DNA-like to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

[0208] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

[0209] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0210] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

[0211] V. Certain Target Nucleic Acids

[0212] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.

[0213] A. Complementarity/Mismatches to the Target Nucleic Acid

[0214] It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

[0215] In certain embodiments, oligomeric compounds comprise oligonucletoides that are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.

[0216] In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligomeric compound comprising an oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3-end of the wing region.

[0217] B. ATXN3

[0218] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is ATXN3. In certain embodiments, ATXN3 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No: NM_004993.5); SEQ ID NO: 2 (GENBANK Accession No: GENBANK Accession No. NT_026437.12 truncated from nucleotides 73,524,000 to 73,574,000); SEQ ID NO: 3 (GENBANK Accession No: NM_001164778.1); SEQ ID NO: 4 (GENBANK Accession No: NM_001127696.1); SEQ ID NO: 5 (GENBANK Accession No: NM_001164781.1); SEQ ID NO: 6 (GENBANK Accession No: NR_028454.1); SEQ ID NO: 7 (GENBANK Accession No: NM_001164780.1); SEQ ID NO: 8 (GENBANK Accession No: NR_028469.1); SEQ ID NO: 9 (GENBANK Accession No: NM_001164779.1); SEQ ID NO: 10 (GENBANK Accession No: NR_028461.1); SEQ ID NO: 11 (GENBANK Accession No: NR_028466.1); SEQ ID NO: 12 (GENBANK Accession No: NR_028462.1); SEQ ID NO: 13 (GENBANK Accession No: NR_028467.1); SEQ ID NO: 14 (GENBANK Accession No: NR_031765.1); SEQ ID NO: 15 (GENBANK Accession No: NM_001164782.1): SEQ ID NO: 16 (GENBANK Accession No: NR_028465.1); SEQ ID NO: 17 (GENBANK Accession No: NR_028457.1); SEQ ID NO: 18 (GENBANK Accession No: NM_001164777.1); and SEQ ID NO: 19 (GENBANK Accession No: NM_001164774.1).

[0219] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1-19 reduces the amount of ATXN3 mRNA, and in certain embodiments reduces the amount of Ataxin-3 protein. In certain embodiments, contacting a cell in an animal with an oligomeric compound complementary to SEQ ID NO: 1-19 ameliorate one or more symptoms or hallmarks of neurodegenerative disease. In certain embodiments, such symptoms and hallmarks include ataxia, neuropathy, and aggregate formation. In certain embodiments, the neurodegenerative disease is spinocerebellar ataxia type 3 (SCA3).

[0220] VI. Certain Hotspot Regions

[0221] 1. Nucleobases 614-637 of SEQ ID NO: 1

[0222] In certain embodiments, modified oligonucleotides are complementary to nucleobases 614-637 of SEQ ID NO: 1. In certain embodiments, nucleobases 614-637 of SEQ ID NO: 1 is a hotspot region. In certain embodiments, such modified oligonucleotides are 18 nucleobases in length. In certain embodiments, such modified oligonucleotides are gapmers. In certain such embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by mixed phosphodiester (o) and phosphorothioate (s) internucleoside linkages. In certain embodiments, the mixed phosphodiester (o) and phosphorothioate (s) internucleoside linkages arranged in order from 5 to 3: sooosssssssssooss.

[0223] The nucleobase sequences of SEQ ID Nos: 73, 74, and 75 are complementary to nucleobases 614-637 of SEQ ID NO: 1.

[0224] In certain embodiments, modified oligonucleotides complementary to nucleobases 614-637 of SEQ ID NO: 1 achieve at least 40% reduction of ATXN3 mRNA in vitro in the standard cell assay.

[0225] 2. Nucleobases 833-852 of SEQ ID NO: 1

[0226] In certain embodiments, modified oligonucleotides are complementary to nucleobases 833-852 of SEQ ID NO: 1. In certain embodiments, nucleobases 833-852 of SEQ ID NO: 1 is a hotspot region. In certain embodiments, such modified oligonucleotides are 18 nucleobases in length. In certain embodiments, such modified oligonucleotides are gapmers. In certain such embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by mixed phosphodiester (o) and phosphorothioate (s) internucleoside linkages. In certain embodiments, the mixed phosphodiester (o) and phosphorothioate (s) internucleoside linkages arranged in order from 5 to 3: sooosssssssssooss.

[0227] The nucleobase sequences of SEQ ID Nos: 86 and 87 are complementary to nucleobases 833-852 of SEQ ID NO: 1.

[0228] In certain embodiments, modified oligonucleotides complementary to nucleobases 833-852 of SEQ ID NO: 1 achieve at least 30% reduction of ATXN3 mRNA in vitro in the standard cell assay.

[0229] 3. Nucleobases 1091-1131 of SEQ ID NO: 1

[0230] In certain embodiments, modified oligonucleotides are complementary to nucleobases 1091-1131 of SEQ ID NO: 1. In certain embodiments, nucleobases 1091-1131 of SEQ ID NO: 1 is a hotspot region. In certain embodiments, such modified oligonucleotides are 18 nucleobases in length. In certain embodiments, such modified oligonucleotides are gapmers. In certain such embodiments, the gapmers are 5-8-5 MOE gapmers. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by mixed phosphodiester (o) and phosphorothioate (s) internucleoside linkages. In certain embodiments, the mixed phosphodiester (o) and phosphorothioate (s) internucleoside linkages arranged in order from 5 to 3: sooosssssssssooss.

[0231] The nucleobase sequences of SEQ ID Nos: 98, 99, 100, 101, and 102 are complementary to nucleobases 1091-1131 of SEQ ID NO: 1.

[0232] In certain embodiments, modified oligonucleotides complementary to nucleobases 1091-1131 of SEQ ID NO: 1 achieve at least 30% reduction of ATXN3 mRNA in vitro in the standard cell assay.

[0233] C. Certain Target Nucleic Acids in Certain Tissues

[0234] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.

[0235] VII. Certain Pharmaceutical Compositions

[0236] In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds or a salt thereof. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compound. In certain embodiments, a pharmaceutical composition consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more oligomeric compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more oligomeric compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS.

[0237] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0238] In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0239] In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

[0240] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0241] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0242] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0243] In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80 and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0244] In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal, intracerebroventricular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain.

Nonlimiting Disclosure and Incorporation by Reference

[0245] Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

[0246] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0247] Although the sequence listing accompanying this filing identifies each sequence as either RNA or DNA as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as RNA or DNA to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2-OH in place of one 2-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence ATCGATCG encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence AUCGAUCG and those having some DNA bases and some RNA bases such as AUCGATCG and oligomeric compounds having other modified nucleobases, such as AT.sup.mCGAUCG, wherein .sup.mC indicates a cytosine base comprising a methyl group at the 5-position.

[0248] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 1 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, all tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0249] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the .sup.1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: .sup.2H or .sup.3H in place of .sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and .sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

EXAMPLES

[0250] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1: Effect of Modified Oligonucleotides on Human ATXN3 In Vitro, Single Dose

[0251] Modified oligonucleotides complementary to an ATXN3 nucleic acid were designed and tested for their effect on ATXN3 mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

[0252] Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with a 2,000 nM concentration of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and ATXN3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS4392 (forward primer sequence TCAGGACAGAGTTCACATCCATGT, designated herein as SEQ ID NO: 20; reverse primer sequence TTCACTCATAGCATCACCTAGATCACT, designated herein as SEQ ID NO: 21; probe sequence AAGGCCAGCCACCAGTTCAGGAGC, designated herein as SEQ ID NO: 22) was used to measure mRNA levels. ATXN3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent reduction of the amount of ATXN3 mRNA, relative to untreated control cells (these conditions describe a standard cell assay). The oligonucleotides marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of these oligonucleotides.

[0253] The modified oligonucleotides in the table below were designed as 5-8-5 MOE gapmers. The gapmers are 18 nucleosides in length, wherein the central gap segment comprises eight 2-deoxynucleosides and is flanked by wing segments on both the 5 end and on the 3 end comprising five nucleosides each. Each nucleoside in the 5 wing segment and each nucleoside in the 3 wing segment comprises a MOE modification. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkages are arranged in order from 5 to 3: sooosssssssssooss; wherein (o) is phosphodiester and (s) is phosphorothioate. Start site indicates the 5-most nucleoside to which the gapmer is targeted in the human gene sequence. Stop site indicates the 3-most nucleoside to which the gapmer is targeted human gene sequence.

[0254] Each modified oligonucleotide listed in Table 1 is targeted to either human ATXN3 mRNA sequence (isoform 1), designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_004993.5) or the human ATXN3 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_026437.12 truncated from nucleotides 73,524,000 to 73,574,000), or both. N/A indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

TABLE-US-00001 TABLE1 PercentreductionofhumanATXN3mRNAbymodified oligonucleotidesrelativetocontrol SEQ SEQ SEQ SEQ IDNo: IDNo: IDNo: IDNo: SEQ IONIS 1Start 1Stop 2Start 2Stop % ID No Site Site Site Site Sequence(5 to3) Inhib. No 650362 14 31 1049 1066 A.sub.es.sup.mC.sub.eo.sup.mC.sub.eo.sup.mC.sub.eo.sup.mC.sub.es.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 0 23 650363 37 54 1072 1089 G.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.es.sup.mC.sub.dsG.sub.ds.sup.mG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 10 24 650364 43 60 1078 1095 T.sub.es.sup.mC.sub.eoT.sub.eoG.sub.eoG.sub.esA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.eo.sup.mC.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 0 25 650365 48 65 1083 1100 A.sub.esT.sub.eoT.sub.eoT.sub.eoG.sub.esT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esG.sub.e 2 26 650366 53 70 1088 1105 T.sub.esG.sub.eoT.sub.eoT.sub.eoT.sub.esA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.eoG.sub.eoA.sub.esG.sub.es.sup.mC.sub.e 25 27 650367 59 76 1094 1111 A.sub.es.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.eoT.sub.eoG.sub.esT.sub.es.sup.mC.sub.e 8 28 650368 64 81 1099 1116 G.sub.esA.sub.eoT.sub.eoG.sub.eoG.sub.esA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.eoT.sub.eoT.sub.esA.sub.esT.sub.e 0 29 650369 69 86 1104 1121 T.sub.esG.sub.eoG.sub.eoA.sub.eoA.sub.esG.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoA.sub.esT.sub.esG.sub.e 13 30 650370 87 104 N/A N/A G.sub.esA.sub.eoG.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 33 31 650371 92 109 N/A N/A A.sub.esA.sub.eoA.sub.eoG.sub.eoT.sub.esG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 20 32 650372 97 114 10822 10839 A.sub.esG.sub.eo.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esT.sub.es.sup.mC.sub.e 57 33 650373 100 117 10825 10842 T.sub.esT.sub.eoG.sub.eoA.sub.eoG.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.eoA.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 19 34 650374 123 140 10848 10865 T.sub.esG.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.esT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.esG.sub.e 39 35 650375 147 164 10872 10889 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.eoA.sub.eoT.sub.esA.sub.esT.sub.e 0 36 650376 170 187 10895 10912 G.sub.es.sup.mC.sub.eoT.sub.eoG.sub.eoA.sub.esT.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.eoG.sub.eoA.sub.esG.sub.esG.sub.e 36 37 650377 195 212 10920 10937 A.sub.esT.sub.eoT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.es.sup.mC.sub.e 29 38 650378 218 235 10943 10960 .sup.mC.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.esG.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 39 39 650379 248 265 N/A N/A A.sub.esA.sub.eoG.sub.eoG.sub.eo.sup.mC.sub.esT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esG.sub.e 55 40 650380 251 268 N/A N/A .sup.mC.sub.esA.sub.eoG.sub.eoA.sub.eoA.sub.esG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.eoA.sub.eoA.sub.esA.sub.esA.sub.e 17 41 650381 256 273 11517 11534 A.sub.esT.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 21 42 650382 261 278 11522 11539 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.esA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.eoA.sub.eoG.sub.esG.sub.es.sup.mC.sub.e 43 43 650383 266 283 11527 11544 T.sub.esG.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.esG.sub.e 14 44 650384 271 288 11532 11549 A.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoA.sub.esT.sub.esT.sub.e 29 45 650385 294 311 N/A N/A .sup.mC.sub.esT.sub.eoT.sub.eoA.sub.eoT.sub.esA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.eoA.sub.eoG.sub.esA.sub.esG.sub.e 9 46 650386 320 337 13842 13859 .sup.mC.sub.esT.sub.eoA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoT.sub.es.sup.mC.sub.esA.sub.e 30 47 650387 325 342 13847 13864 T.sub.esA.sub.eoG.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 0 48 650388 330 347 13852 13869 A.sub.esG.sub.eoG.sub.eoA.sub.eoT.sub.esT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 15 49 650389 335 352 13857 13874 T.sub.esG.sub.eoA.sub.eoA.sub.eo.sup.mC.sub.esA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.esT.sub.esA.sub.e 2 50 650390 340 357 13862 13879 A.sub.es.sup.mC.sub.eoT.sub.eoG.sub.eoT.sub.esT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.eoT.sub.eoT.sub.esA.sub.esG.sub.e 33 51 650391 345 362 13867 13884 T.sub.es.sup.mC.sub.eoT.sub.eoG.sub.eoG.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.eo.sup.mC.sub.eoA.sub.esG.sub.esG.sub.e 11 52 650392 349 366 13871 13888 A.sub.esT.sub.eoA.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.eoT.sub.eoG.sub.esA.sub.esA.sub.e 23 53 650393 372 389 13894 13911 A.sub.esT.sub.eoA.sub.eoG.sub.eoG.sub.esA.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eoA.sub.esG.sub.es.sup.mC.sub.e 39 54 650394 404 421 14353 14370 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoA.sub.esT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.eoA.sub.eoT.sub.esA.sub.esA.sub.e 24 55 650395 422 439 14371 14388 T.sub.esA.sub.eoA.sub.eo.sup.mC.sub.eoT.sub.esG.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 8 56 650396 432 449 14381 14398 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoA.sub.eoA.sub.esT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esT.sub.esA.sub.e 0 57 650397 433 450 14382 14399 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.esA.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esT.sub.e 13 58 650398 454 471 18837 18854 A.sub.esT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esA.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 34 59 650399 459 476 18842 18859 A.sub.esG.sub.eoA.sub.eoG.sub.eoA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.eoA.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 5 60 650400 462 479 18845 18862 A.sub.esA.sub.eoG.sub.eoA.sub.eoG.sub.esA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.eoG.sub.eoT.sub.esT.sub.esA.sub.e 17 61 650401 478 495 18861 18878 T.sub.esA.sub.eoA.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.eoT.sub.eo.sup.mC.sub.esA.sub.esA.sub.e 25 62 650402 483 500 18866 18883 G.sub.esA.sub.eoT.sub.eoA.sub.eoT.sub.esT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 47 63 650403 489 506 18872 18889 G.sub.esT.sub.eoA.sub.eoT.sub.eo.sup.mC.sub.esT.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.eoT.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 6 64 650404 494 511 18877 18894 G.sub.esA.sub.eoT.sub.eoA.sub.eoT.sub.esG.sub.dsT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.eoA.sub.eoT.sub.esT.sub.esA.sub.e 19 65 650405 517 534 18900 18917 T.sub.esA.sub.eoA.sub.eoT.sub.eoT.sub.esG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.eoA.sub.eoA.sub.esA.sub.esG.sub.e 0 66 650406 540 557 N/A N/A A.sub.esA.sub.eoT.sub.eoA.sub.eoT.sub.esA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoT.sub.eoT.sub.es.sup.mC.sub.es.sup.mC.sub.e 17 67 650407 542 559 N/A N/A .sup.mC.sub.esA.sub.eoA.sub.eoA.sub.eoT.sub.esA.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 2 68 650408 562 579 24416 24433 T.sub.esG.sub.eoG.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 19 69 650409 567 584 24421 24438 .sup.mC.sub.esA.sub.eoA.sub.eoT.sub.eo.sup.mC.sub.esT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 30 70 650410 568 585 24422 24439 G.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.es.sup.mC.sub.e 57 71 650411 591 608 24445 24462 A.sub.esT.sub.eo.sup.mC.sub.eoT.sub.eoG.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.eoG.sub.eoT.sub.es.sup.mC.sub.esA.sub.e 12 72 650412 614 631 24468 24485 G.sub.esA.sub.eoT.sub.eoG.sub.eo.sup.mC.sub.esA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 45 73 650413 615 632 24469 24486 .sup.mC.sub.esG.sub.eoA.sub.eoT.sub.eoG.sub.es.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.eoG.sub.eoA.sub.es.sup.mC.sub.es.sup.mC.sub.e 41 74 650414 620 637 24474 24491 T.sub.esT.sub.eoG.sub.eoG.sub.eoT.sub.es.sup.mC.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 41 75 650415 625 642 24479 24496 A.sub.esA.sub.eoG.sub.eoT.sub.eoT.sub.esT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 0 76 650416 630 647 24484 24501 .sup.mC.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eoT.sub.esA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.eoT.sub.eo.sup.mC.sub.esG.sub.esA.sub.e 23 77 650417 638 655 24492 24509 A.sub.esT.sub.eoT.sub.eo.sup.mC.sub.eoT.sub.esT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.eoA.sub.eoG.sub.esT.sub.esT.sub.e 0 78 650418 661 678 N/A N/A T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoT.sub.esG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.eoG.sub.eoT.sub.esT.sub.esG.sub.e 26 79 650419 684 701 25197 25214 .sup.mC.sub.esG.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.eoT.sub.eoT.sub.esT.sub.esA.sub.e 47 80 650420 708 725 25221 25238 G.sub.esA.sub.eoG.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.eoT.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 37 81 650421 738 755 25251 25268 A.sub.esA.sub.eoA.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 7 82 650422 761 778 25274 25291 G.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.esA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.eoG.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 47 83 650423 787 804 25300 25317 .sup.mC.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esA.sub.esT.sub.e 0 84 650424 810 827 25323 25340 A.sub.esT.sub.eoA.sub.eoG.sub.eo.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.eoA.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 12 85 650425 833 850 N/A N/A A.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esT.sub.esA.sub.e 31 86 650426 835 852 N/A N/A G.sub.esG.sub.eoA.sub.eoA.sub.eo.sup.mC.sub.esT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoA.sub.es.sup.mC.sub.esT.sub.e 33 87 650427 856 873 26607 26624 .sup.mC.sub.esA.sub.eoT.sub.eoA.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 48 88 650428 879 896 26630 26647 A.sub.esG.sub.eoA.sub.eoT.sub.eoT.sub.esT.sub.dsG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.eoT.sub.eoG.sub.esT.sub.es.sup.mC.sub.e 20 89 650429 902 919 26653 26670 T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 3 90 650430 922 939 26673 26690 T.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.esA.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 47 91 650431 925 942 N/A N/A T.sub.esT.sub.eoT.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.eo.sup.mC.sub.eoT.sub.esT.sub.es.sup.mC.sub.e 0 92 650432* 976 993 36638 36655 T.sub.esA.sub.eoG.sub.eoG.sub.eoT.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 68 93 650433* 999 1016 36661 36678 .sup.mC.sub.esA.sub.eoT.sub.eoG.sub.eoG.sub.esA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esT.sub.e 21 94 650434* 1022 1039 36684 36701 .sup.mC.sub.esT.sub.eoG.sub.eoA.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 49 95 650435* 1045 1062 36707 36724 A.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.esG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoA.sub.esA.sub.esG.sub.e 12 96 650436* 1068 1085 43250 43267 A.sub.esT.sub.eoG.sub.eoT.sub.eo.sup.mC.sub.esT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esT.sub.esA.sub.e 32 97 650437 1091 1108 43273 43290 A.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eoG.sub.esG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.es.sup.mC.sub.esT.sub.e 67 98 650438 1092 1109 43274 43291 G.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.esG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 69 99 650439 1097 1114 43279 43296 .sup.mC.sub.esT.sub.eoA.sub.eoA.sub.eoA.sub.esG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esA.sub.esG.sub.e 36 100 650440 1102 1119 43284 43301 A.sub.esG.sub.eoT.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoG.sub.esG.sub.esT.sub.e 40 101 650441 1114 1131 43296 43313 A.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.esT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.eoT.sub.eoT.sub.esT.sub.es.sup.mC.sub.e 31 102 650442 1173 1190 43355 43372 G.sub.esA.sub.eoA.sub.eoA.sub.eoG.sub.esT.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.esA.sub.esA.sub.e 27 103 650443 1196 1213 43378 43395 T.sub.esG.sub.eoT.sub.eoA.sub.eoA.sub.esT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.eoA.sub.eoT.sub.esA.sub.esA.sub.e 35 104 650444 1219 1236 43401 43418 .sup.mC.sub.esA.sub.eoT.sub.eoT.sub.eoA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 18 105 650445 1250 1267 43432 43449 .sup.mC.sub.esT.sub.eoA.sub.eoA.sub.eoA.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.esT.sub.e 17 106 650446 1279 1296 43461 43478 .sup.mC.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.eoT.sub.eoT.sub.esT.sub.esG.sub.e 17 107 650447 1302 1319 43484 43501 G.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.eoG.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 21 108 650448 1327 1344 43509 43526 .sup.mC.sub.esT.sub.eoA.sub.eoA.sub.eoT.sub.esA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.eoA.sub.eoT.sub.es.sup.mC.sub.esA.sub.e 39 109 650449 1350 1367 43532 43549 T.sub.esT.sub.eoA.sub.eoA.sub.eoT.sub.esT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.es.sup.mC.sub.e 51 110 650450 1402 1419 43584 43601 T.sub.esT.sub.eoG.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.eoA.sub.eoA.sub.esG.sub.esA.sub.e 21 111 650451 1425 1442 43607 43624 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoA.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 15 112 650452 1450 1467 43632 43649 .sup.mC.sub.esT.sub.eoG.sub.eo.sup.mC.sub.eoA.sub.esA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eoA.sub.esG.sub.esA.sub.e 20 113 650453 1473 1490 43655 43672 G.sub.esA.sub.eoG.sub.eoG.sub.eo.sup.mC.sub.esG.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.eoT.sub.eoT.sub.esA.sub.esG.sub.e 17 114 650454 1518 1535 43700 43717 T.sub.esA.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.eoA.sub.eoA.sub.esA.sub.esA.sub.e 12 115 650455 1541 1558 43723 43740 .sup.mC.sub.esT.sub.eoA.sub.eoT.sub.eoT.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.eoG.sub.eoA.sub.esG.sub.es.sup.mC.sub.e 13 116 650456 1564 1581 43746 43763 T.sub.esG.sub.eoG.sub.eoT.sub.eoT.sub.esA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.eoT.sub.eoG.sub.esA.sub.esA.sub.e 0 117 650457 1588 1605 43770 43787 A.sub.esG.sub.eoA.sub.eoT.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.eoA.sub.eoA.sub.esG.sub.esG.sub.e 0 118 650458 1613 1630 43795 43812 A.sub.es.sup.mC.sub.eoT.sub.eoA.sub.eoT.sub.esT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.esG.sub.e 6 119 650459 1636 1653 43818 43835 .sup.mC.sub.esT.sub.eoG.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.eoA.sub.eoG.sub.esA.sub.esA.sub.e 15 120 650460 1659 1676 43841 43858 A.sub.es.sup.mC.sub.eoG.sub.eoG.sub.eoT.sub.esA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.eoA.sub.eoA.sub.esG.sub.esG.sub.e 8 121 650461 1695 1712 43877 43894 G.sub.esA.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoA.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 18 122 650462 1720 1737 43902 43919 G.sub.esA.sub.eoA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.eoA.sub.eoG.sub.esA.sub.esA.sub.e 15 123 650463 1743 1760 43925 43942 .sup.mC.sub.esA.sub.eoA.sub.eoA.sub.eoA.sub.esG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.eoG.sub.eoA.sub.esA.sub.esA.sub.e 11 124 650464 1766 1783 43948 43965 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.esA.sub.e 29 125 650465 1803 1820 43985 44002 G.sub.esA.sub.eoA.sub.eoA.sub.eoT.sub.esA.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 2 126 650466 1826 1843 44008 44025 G.sub.esA.sub.eoG.sub.eoT.sub.eoT.sub.esT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.esA.sub.e 57 127 650467 1849 1866 44031 44048 G.sub.esT.sub.eoA.sub.eo.sup.mC.sub.eoT.sub.esT.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esA.sub.e 33 128 650468 1891 1908 44073 44090 G.sub.es.sup.mC.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.esT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.eoA.sub.eoT.sub.esT.sub.esT.sub.e 34 129 650469 1915 1932 44097 44114 G.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.esT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.eoA.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 14 130 650470 1938 1955 44120 44137 T.sub.esA.sub.eoA.sub.eoG.sub.eoG.sub.esT.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.eoA.sub.eoA.sub.esG.sub.esT.sub.e 0 131 650471 1971 1988 44153 44170 A.sub.esA.sub.eoG.sub.eoG.sub.eo.sup.mC.sub.esG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.eoA.sub.eoG.sub.esG.sub.esG.sub.e 19 132 650472 1996 2013 44178 44195 T.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eoT.sub.esT.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.eoA.sub.eoA.sub.esG.sub.esG.sub.e 2 133 650473 2019 2036 44201 44218 A.sub.esT.sub.eoA.sub.eo.sup.mC.sub.eoT.sub.esA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esA.sub.esG.sub.e 6 134 650474 2042 2059 44224 44241 .sup.mC.sub.esT.sub.eoA.sub.eoA.sub.eo.sup.mC.sub.esA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esT.sub.esG.sub.e 18 135 650475 2073 2090 44255 44272 A.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.eoT.sub.eoA.sub.es.sup.mC.sub.esG.sub.e 19 136 650476 2096 2113 44278 44295 G.sub.esA.sub.eoA.sub.eoG.sub.eoG.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.eoA.sub.eoT.sub.esG.sub.esT.sub.e 29 137 650477 2141 2158 44323 44340 .sup.mC.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.eoG.sub.eoA.sub.esA.sub.esA.sub.e 32 138 650478 2166 2183 44348 44365 A.sub.es.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.eoA.sub.eoG.sub.esA.sub.esA.sub.e 36 139 650479 2189 2206 44371 44388 G.sub.esA.sub.eoA.sub.eoG.sub.eo.sup.mC.sub.esA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.eo.sup.mC.sub.eoA.sub.esT.sub.esT.sub.e 0 140 650480 2213 2230 44395 44412 .sup.mC.sub.esA.sub.eoA.sub.eoG.sub.eo.sup.mC.sub.esT.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 0 141 650481 2236 2253 44418 44435 A.sub.esT.sub.eoG.sub.eoT.sub.eoT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoA.sub.esT.sub.es.sup.mC.sub.e 34 142 650482 2279 2296 44461 44478 .sup.mC.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoG.sub.esT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.eoA.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 4 143 650483 2302 2319 44484 44501 T.sub.esA.sub.eoA.sub.eoA.sub.eo.sup.mC.sub.esA.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.eoG.sub.eoT.sub.esG.sub.esT.sub.e 3 144 650484 2325 2342 44507 44524 A.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoA.sub.esA.sub.esG.sub.e 31 145 650485 2348 2365 44530 44547 T.sub.esT.sub.eoA.sub.eoT.sub.eoA.sub.esG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.eoA.sub.eoG.sub.esT.sub.esA.sub.e 3 146 650486 2371 2388 44553 44570 A.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.esA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esT.sub.esT.sub.e 32 147 650487 2396 2413 44578 44595 T.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.es.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.eoA.sub.eoG.sub.esA.sub.esG.sub.e 9 148 650488 2419 2436 44601 44618 T.sub.esT.sub.eoG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esT.sub.e 14 149 650489 2442 2459 44624 44641 T.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.eoA.sub.eo.sup.mC.sub.esT.sub.esA.sub.e 19 150 650490 2466 2483 44648 44665 A.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.es.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.eoA.sub.eoG.sub.esA.sub.es.sup.mC.sub.e 28 151 650491 2501 2518 44683 44700 G.sub.esA.sub.eoT.sub.eoG.sub.eoG.sub.esA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.eoG.sub.eoA.sub.esT.sub.esA.sub.e 0 152 650492 2527 2544 44709 44726 .sup.mC.sub.esA.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.esT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.eoG.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 28 153 650493 2550 2567 44732 44749 T.sub.esG.sub.eoG.sub.eoA.sub.eoT.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.eoT.sub.eoG.sub.esA.sub.esA.sub.e 23 154 650494 2573 2590 44755 44772 .sup.mC.sub.esG.sub.eoA.sub.eoA.sub.eoG.sub.esT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eoA.sub.esA.sub.esA.sub.e 59 155 650495 2596 2613 44778 44795 G.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eoT.sub.esA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.eoT.sub.eoA.sub.esT.sub.esA.sub.e 4 156 650496 2619 2636 44801 44818 G.sub.esT.sub.eoG.sub.eoT.sub.eoG.sub.es.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.esA.sub.e 0 157 650497 2639 2656 44821 44838 A.sub.esA.sub.eoA.sub.eoA.sub.eo.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 1 158 650498 2642 2659 44824 44841 .sup.mC.sub.esA.sub.eoA.sub.eoA.sub.eoA.sub.esA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esA.sub.esT.sub.e 22 159 650499 2665 2682 44847 44864 T.sub.esT.sub.eoA.sub.eoG.sub.eoT.sub.esT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.eoA.sub.eoT.sub.es.sup.mC.sub.es.sup.mC.sub.e 38 160 650500 2713 2730 44895 44912 A.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.esT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esT.sub.esA.sub.e 0 161 650501 2736 2753 44918 44935 A.sub.esA.sub.eoA.sub.eoA.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.eo.sup.mC.sub.eoG.sub.esA.sub.esA.sub.e 0 162 650502 2759 2776 44941 44958 A.sub.esT.sub.eoT.sub.eoG.sub.eoG.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.eoA.sub.eoT.sub.esG.sub.esA.sub.e 3 163 650503 2782 2799 44964 44981 G.sub.esT.sub.eoA.sub.eoA.sub.eoG.sub.esG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.eoA.sub.eoG.sub.esA.sub.esA.sub.e 6 164 650504 2853 2870 45035 45052 T.sub.esT.sub.eoA.sub.eoT.sub.eoA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.eoA.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 0 165 650505 2876 2893 45058 45075 A.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.eoT.sub.eoT.sub.esT.sub.esA.sub.e 35 166 650506 2899 2916 45081 45098 T.sub.esG.sub.eoA.sub.eoG.sub.eoG.sub.esG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 32 167 650507 2927 2944 45109 45126 G.sub.esT.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.esA.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.eoA.sub.eoG.sub.es.sup.mC.sub.esT.sub.e 55 168 650508 2951 2968 45133 45150 G.sub.esG.sub.eoT.sub.eoA.sub.eoA.sub.esT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 0 169 650509 2977 2994 45159 45176 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.esG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.eoG.sub.eoA.sub.es.sup.mC.sub.esA.sub.e 31 170 650510 3000 3017 45182 45199 T.sub.esG.sub.eoG.sub.eoA.sub.eoA.sub.esA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.eoG.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 13 171 650511 3025 3042 45207 45224 T.sub.esG.sub.eoA.sub.eoA.sub.eoA.sub.esA.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.eoT.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 0 172 650512 3048 3065 45230 45247 G.sub.esG.sub.eoT.sub.eoA.sub.eoG.sub.es.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.esA.sub.esA.sub.e 64 173 650513 3076 3093 45258 45275 G.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eoA.sub.esT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 60 174 650514 3100 3117 45282 45299 A.sub.es.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eoT.sub.esA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.eoA.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 8 175 650515 3105 3122 45287 45304 T.sub.esA.sub.eoT.sub.eoA.sub.eoA.sub.esA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.eoT.sub.eoT.sub.esA.sub.esA.sub.e 0 176 650516 3123 3140 45305 45322 T.sub.esA.sub.eoG.sub.eoG.sub.eoG.sub.esT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.eoA.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 5 177 650517 3146 3163 45328 45345 .sup.mC.sub.esA.sub.eoT.sub.eoA.sub.eoT.sub.esT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.eoT.sub.eoG.sub.es.sup.mC.sub.esT.sub.e 35 178 650518 3169 3186 45351 45368 T.sub.esA.sub.eoG.sub.eoG.sub.eoA.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esA.sub.esA.sub.e 21 179 650519 3391 3408 45573 45590 .sup.mC.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.esG.sub.e 28 180 650520 3491 3508 45673 45690 T.sub.es.sup.mC.sub.eoT.sub.eoA.sub.eoG.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.eo.sup.mC.sub.eoG.sub.es.sup.mC.sub.esA.sub.e 0 181 650521 3514 3531 45696 45713 G.sub.es.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 43 182 650522 3537 3554 45719 45736 A.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.esG.sub.e 41 183 650523 3560 3577 45742 45759 A.sub.esT.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eoA.sub.es.sup.mC.sub.esA.sub.e 26 184 650524 3583 3600 45765 45782 G.sub.esG.sub.eoA.sub.eoT.sub.eo.sup.mC.sub.esT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.eoA.sub.eoA.sub.esT.sub.esG.sub.e 18 185 650525 3606 3623 45788 45805 G.sub.esA.sub.eoT.sub.eoG.sub.eoA.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eoA.sub.eoG.sub.esT.sub.esG.sub.e 17 186 650526 3629 3646 45811 45828 T.sub.esA.sub.eoA.sub.eoA.sub.eoT.sub.esT.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.eo.sup.mC.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 17 187 650527 3659 3676 45841 45858 .sup.mC.sub.esA.sub.eoA.sub.eoT.sub.eoT.sub.esA.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.eoA.sub.eoA.sub.esT.sub.es.sup.mC.sub.e 9 188 650528 3681 3698 45863 45880 G.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eo.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esG.sub.es.sup.mC.sub.e 63 189 650529 3684 3701 45866 45883 .sup.mC.sub.esT.sub.eoG.sub.eoG.sub.eo.sup.mC.sub.esA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoA.sub.es.sup.mC.sub.esT.sub.e 33 190 650530 3707 3724 45889 45906 T.sub.esT.sub.eoT.sub.eoT.sub.eoG.sub.esA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.eoT.sub.eoT.sub.esA.sub.es.sup.mC.sub.e 33 191 650531 3731 3748 45913 45930 A.sub.esT.sub.eoA.sub.eoG.sub.eo.sup.mC.sub.esT.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.e 7 192 650532 3754 3771 45936 45953 T.sub.esG.sub.eoG.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.eoG.sub.eoT.sub.esA.sub.esT.sub.e 50 193 650533 3777 3794 45959 45976 T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoG.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.eoT.sub.eoA.sub.es.sup.mC.sub.esA.sub.e 24 194 650534 3800 3817 45982 45999 G.sub.esT.sub.eoG.sub.eoA.sub.eoA.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.esT.sub.e 42 195 650535 3823 3840 46005 46022 .sup.mC.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.esA.sub.esG.sub.e 0 196 650536 3859 3876 46041 46058 T.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esA.sub.e 0 197 650537 3889 3906 46071 46088 .sup.mC.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eoT.sub.esA.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.eoA.sub.eoT.sub.esT.sub.esA.sub.e 0 198 650538 3916 3933 46098 46115 T.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.esA.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.eoT.sub.eoA.sub.esG.sub.esA.sub.e 0 199 650539 3939 3956 46121 46138 .sup.mC.sub.esT.sub.eoG.sub.eoT.sub.eoA.sub.es.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 32 200 650540 3962 3979 46144 46161 T.sub.esT.sub.eoA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.eoG.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 0 201 650541 3985 4002 46167 46184 T.sub.esA.sub.eoT.sub.eoG.sub.eoA.sub.esA.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.eoT.sub.eoT.sub.es.sup.mC.sub.es.sup.mC.sub.e 26 202 650542 4008 4025 46190 46207 A.sub.esT.sub.eoT.sub.eoA.sub.eoA.sub.esA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.eoA.sub.eoT.sub.es.sup.mC.sub.esT.sub.e 31 203 650543 4045 4062 46227 46244 G.sub.esA.sub.eoT.sub.eoT.sub.eoA.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.eoA.sub.eoA.sub.esT.sub.esT.sub.e 28 204 650544 4068 4085 46250 46267 T.sub.esA.sub.eoG.sub.eoA.sub.eoT.sub.esT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.eoT.sub.eoA.sub.esG.sub.esA.sub.e 23 205 650545 4091 4108 46273 46290 T.sub.esT.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.esT.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 26 206 650546 4114 4131 46296 46313 A.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoG.sub.esT.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esA.sub.e 10 207 650547 4137 4154 46319 46336 G.sub.esT.sub.eoT.sub.eoT.sub.eoA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.eoG.sub.eo.sup.mC.sub.es.sup.mC.sub.esT.sub.e 12 208 650548 4160 4177 46342 46359 T.sub.esT.sub.eoT.sub.eoG.sub.eoG.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoT.sub.eoA.sub.esG.sub.esT.sub.e 19 209 650549 4183 4200 46365 46382 A.sub.esA.sub.eoT.sub.eoA.sub.eoT.sub.esT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.eoT.sub.eoG.sub.esT.sub.esA.sub.e 23 210 650550 4206 4223 46388 46405 A.sub.esA.sub.eoA.sub.eoA.sub.eoA.sub.esA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esT.sub.esA.sub.e 12 211 650551 4247 4264 46429 46446 T.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eoG.sub.esA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.eoA.sub.eoA.sub.esG.sub.esA.sub.e 34 212 650552 4272 4289 46454 46471 G.sub.esT.sub.eoT.sub.eoT.sub.eoT.sub.esT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.eoT.sub.eoT.sub.esA.sub.es.sup.mC.sub.e 10 213 650553 4295 4312 46477 46494 .sup.mC.sub.esA.sub.eoA.sub.eoT.sub.eoG.sub.esA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esG.sub.esT.sub.e 34 214 650554 4318 4335 46500 46517 T.sub.esG.sub.eoG.sub.eoA.sub.eo.sup.mC.sub.esT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.e 44 215 650555 4365 4382 46547 46564 T.sub.es.sup.mC.sub.eoT.sub.eoG.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.eoA.sub.eoA.sub.esT.sub.esT.sub.e 10 216 650556 4388 4405 46570 46587 G.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.esT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.eoG.sub.eoA.sub.esT.sub.esT.sub.e 12 217 650557 4424 4441 46606 46623 .sup.mC.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.esG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 9 218 650558 4645 4662 46827 46844 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.esT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.eoG.sub.eoG.sub.esT.sub.esT.sub.e 29 219 650559 4734 4751 46916 46933 .sup.mC.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.esG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.e 0 220 650560 4758 4775 46940 46957 T.sub.esT.sub.eoT.sub.eoT.sub.eoA.sub.esA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.eoT.sub.eoA.sub.esG.sub.es.sup.mC.sub.e 8 221 650561 4781 4798 46963 46980 T.sub.es.sup.mC.sub.eoT.sub.eoG.sub.eoT.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.eoA.sub.eoT.sub.esG.sub.esG.sub.e 6 222 650562 4804 4821 46986 47003 T.sub.esT.sub.eoA.sub.eoT.sub.eoG.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoA.sub.esT.sub.esT.sub.e 16 223 650563 4868 4885 47050 47067 .sup.mC.sub.esG.sub.eoT.sub.eoA.sub.eoA.sub.esG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.eoA.sub.eo.sup.mC.sub.esA.sub.esT.sub.e 0 224 650564 4892 4909 47074 47091 .sup.mC.sub.esA.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eoA.sub.eoT.sub.esT.sub.esG.sub.e 0 225 650565 5092 5109 47274 47291 T.sub.esG.sub.eo.sup.mC.sub.eoG.sub.eoA.sub.esT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.esT.sub.e 45 226 650566 5128 5145 47310 47327 .sup.mC.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.esG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.eo.sup.mC.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 14 227 650567 5167 5184 47349 47366 T.sub.esG.sub.eoT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.eoG.sub.eoG.sub.esG.sub.es.sup.mC.sub.e 34 228 650568 5245 5262 47427 47444 T.sub.esA.sub.eoG.sub.eoG.sub.eoA.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.eoT.sub.eoA.sub.esT.sub.esA.sub.e 0 229 650569 5268 5285 47450 47467 .sup.mC.sub.es.sup.mC.sub.eo.sup.mC.sub.eoG.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.eoA.sub.eoG.sub.esT.sub.esT.sub.e 1 230 650570 5406 5423 47588 47605 T.sub.esA.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.eoT.sub.eoT.sub.esT.sub.esG.sub.e 15 231 650571 5551 5568 47733 47750 A.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.esT.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.eoG.sub.eoT.sub.esT.sub.esT.sub.e 49 232 650572 5575 5592 47757 47774 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoG.sub.eoG.sub.esA.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.eoA.sub.eoA.sub.esA.sub.es.sup.mC.sub.e 0 233 650573 5602 5619 47784 47801 A.sub.esA.sub.eoA.sub.eoA.sub.eoT.sub.esA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.eoA.sub.eo.sup.mC.sub.esG.sub.es.sup.mC.sub.e 11 234 650574 5797 5814 47979 47996 A.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.esA.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eoG.sub.esG.sub.esT.sub.e 8 235 650575 5927 5944 48109 48126 T.sub.esG.sub.eoG.sub.eo.sup.mC.sub.eo.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.eoG.sub.eoT.sub.esG.sub.esT.sub.e 7 236 650576 5953 5970 48135 48152 .sup.mC.sub.esA.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.esA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.eo.sup.mC.sub.eoT.sub.esT.sub.esT.sub.e 8 237 650577 5976 5993 48158 48175 T.sub.esA.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.eoG.sub.eoA.sub.es.sup.mC.sub.esT.sub.e 8 238 650578 5999 6016 48181 48198 G.sub.esT.sub.eoT.sub.eo.sup.mC.sub.eoT.sub.esT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.eoT.sub.eo.sup.mC.sub.esA.sub.es.sup.mC.sub.e 57 239 650579 6022 6039 48204 48221 T.sub.esG.sub.eoA.sub.eoT.sub.eoT.sub.esA.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eoA.sub.esT.sub.es.sup.mC.sub.e 32 240 650580 6045 6062 48227 48244 T.sub.esA.sub.eoA.sub.eoA.sub.eoG.sub.esT.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoT.sub.esG.sub.es.sup.mC.sub.e 0 241 650581 6103 6120 48285 48302 G.sub.esA.sub.eoT.sub.eoG.sub.eo.sup.mC.sub.esT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.eoA.sub.eoG.sub.esG.sub.esG.sub.e 0 242 650582 6128 6145 48310 48327 G.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eoG.sub.esG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 20 243 650583 6158 6175 48340 48357 T.sub.esT.sub.eoA.sub.eoT.sub.eoT.sub.esA.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.esT.sub.esA.sub.e 35 244 650584 6188 6205 48370 48387 T.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eoG.sub.esA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.eoT.sub.eoA.sub.esG.sub.esA.sub.e 0 245 650585 6211 6228 48393 48410 .sup.mC.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eo.sup.mC.sub.esG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.eoA.sub.eoA.sub.esT.sub.es.sup.mC.sub.e 30 246 650586 6285 6302 48467 48484 A.sub.esG.sub.eoA.sub.eo.sup.mC.sub.eo.sup.mC.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.eoA.sub.eoA.sub.esA.sub.esT.sub.e 13 247 650587 6308 6325 48490 48507 T.sub.esT.sub.eoA.sub.eoG.sub.eo.sup.mC.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 17 248 650588 6331 6348 48513 48530 .sup.mC.sub.esG.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.esA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.eoT.sub.esT.sub.esA.sub.e 0 249 650589 6354 6371 48536 48553 T.sub.esA.sub.eoT.sub.eoG.sub.eo.sup.mC.sub.esT.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 11 250 650590 6378 6395 48560 48577 .sup.mC.sub.es.sup.mC.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 24 251 650591 6401 6418 48583 48600 T.sub.esT.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.esA.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.eoT.sub.eo.sup.mC.sub.esT.sub.esA.sub.e 15 252 650592 6430 6447 48612 48629 A.sub.esG.sub.eoG.sub.eoA.sub.eoA.sub.esT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.eoA.sub.eoT.sub.esA.sub.esT.sub.e 4 253 650593 6453 6470 48635 48652 A.sub.esT.sub.eoT.sub.eoG.sub.eoA.sub.esG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.eoA.sub.eoA.sub.esA.sub.esT.sub.e 33 254 650594 6476 6493 48658 48675 T.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.dsG.sub.eo.sup.mC.sub.eoA.sub.esA.sub.esG.sub.e 9 255 650595 6552 6569 48734 48751 A.sub.esT.sub.eoT.sub.eoA.sub.eoG.sub.esA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoT.sub.esT.sub.esA.sub.e 29 256 650596 6575 6592 48757 48774 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoA.sub.eoA.sub.esT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.esG.sub.e 16 257 650597 6606 6623 48788 48805 T.sub.esA.sub.eoT.sub.eoA.sub.eo.sup.mC.sub.esA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.eoA.sub.eoT.sub.esT.sub.esT.sub.e 0 258 650598 6629 6646 48811 48828 T.sub.es.sup.mC.sub.eoT.sub.eoG.sub.eoT.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.esA.sub.esA.sub.e 43 259 650599 6659 6676 48841 48858 A.sub.esA.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoT.sub.eoT.sub.esT.sub.esG.sub.e 0 260 650600 6682 6699 48864 48881 .sup.mC.sub.esA.sub.eo.sup.mC.sub.eoA.sub.eoG.sub.esT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.eoA.sub.eoT.sub.es.sup.mC.sub.esA.sub.e 0 261 650601 6705 6722 48887 48904 G.sub.esG.sub.eoG.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.eo.sup.mC.sub.eoG.sub.esG.sub.es.sup.mC.sub.e 2 262 650602 6728 6745 48910 48927 A.sub.es.sup.mC.sub.eoA.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.es.sup.mC.sub.esA.sub.e 16 263 650603 6751 6768 48933 48950 G.sub.es.sup.mC.sub.eoA.sub.eoA.sub.eoA.sub.esT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.eo.sup.mC.sub.eoG.sub.esA.sub.esG.sub.e 27 264 650604 6774 6791 48956 48973 G.sub.esA.sub.eoA.sub.eoG.sub.eoG.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.eoG.sub.eoT.sub.esA.sub.esA.sub.e 6 265 650605 6797 6814 48979 48996 .sup.mC.sub.esG.sub.eoG.sub.eo.sup.mC.sub.eoT.sub.esT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.esA.sub.e 27 266 650606 6808 6825 48990 49007 .sup.mC.sub.esT.sub.eoT.sub.eoT.sub.eoG.sub.esG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.eo.sup.mC.sub.eoT.sub.esT.sub.esT.sub.e 15 267 650607 6820 6837 49002 49019 T.sub.esG.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.esA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoT.sub.esG.sub.esG.sub.e 0 268 650608 6843 6860 49025 49042 T.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.eoA.sub.eoG.sub.esA.sub.esA.sub.e 25 269 650609 6880 6897 49062 49079 A.sub.esA.sub.eoT.sub.eoA.sub.eoA.sub.esT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.eoT.sub.eoT.sub.esT.sub.esA.sub.e 0 270 650612 N/A N/A 13822 13839 G.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eoT.sub.esG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esG.sub.esT.sub.e 50 271 650616 N/A N/A 26677 26694 A.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoT.sub.esT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.eoG.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 4 272 650617 N/A N/A 26686 26703 A.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.eoT.sub.eo.sup.mC.sub.esA.sub.esA.sub.e 0 273 650625 N/A N/A 24160 24177 T.sub.esG.sub.eoG.sub.eoA.sub.eoA.sub.esG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esT.sub.esT.sub.e 15 274 650626 N/A N/A 24210 24227 T.sub.esA.sub.eoA.sub.eoG.sub.eoG.sub.esT.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoA.sub.esA.sub.esA.sub.e 0 275 650629 N/A N/A 24515 24532 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoT.sub.esG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.eoG.sub.eoT.sub.esT.sub.esG.sub.e 9 276 650633 N/A N/A 28195 28212 .sup.mC.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.esA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esA.sub.esG.sub.e 38 277 650634 N/A N/A 28217 28234 G.sub.esA.sub.eoT.sub.eoG.sub.eoT.sub.es.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.eoA.sub.eoG.sub.esA.sub.esA.sub.e 25 278 650635 N/A N/A 28222 28239 A.sub.esA.sub.eoG.sub.eoA.sub.eoG.sub.esG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esA.sub.esT.sub.e 12 279 650640 N/A N/A 1233 1250 .sup.mC.sub.esG.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoG.sub.esG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.eoG.sub.eoG.sub.es.sup.mC.sub.esA.sub.e 0 280 650641 N/A N/A 1754 1771 .sup.mC.sub.es.sup.mC.sub.eo.sup.mC.sub.eoG.sub.eoT.sub.esA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 8 281 650642 N/A N/A 1820 1837 .sup.mC.sub.esT.sub.eoA.sub.eoA.sub.eoA.sub.esA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eoG.sub.es.sup.mC.sub.es.sup.mC.sub.e 17 282 650643 N/A N/A 7243 7260 A.sub.esT.sub.eoA.sub.eoG.sub.eo.sup.mC.sub.esA.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.eoT.sub.eoG.sub.esT.sub.esA.sub.e 0 283 7283 7300 650644 N/A N/A 8090 8107 .sup.mC.sub.esA.sub.eoG.sub.eoA.sub.eoT.sub.esG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoA.sub.eoT.sub.esA.sub.esT.sub.e 8 284 650645 N/A N/A 9762 9779 T.sub.esT.sub.eoA.sub.eoA.sub.eo.sup.mC.sub.esA.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.eoT.sub.eoG.sub.es.sup.mC.sub.esA.sub.e 28 285 650646 N/A N/A 10816 10833 A.sub.esA.sub.eoG.sub.eoT.sub.eoG.sub.esA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.esT.sub.esA.sub.e 0 286 650647 N/A N/A 10975 10992 A.sub.esA.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.eoA.sub.eoA.sub.esA.sub.esA.sub.e 36 287 650648 N/A N/A 11515 11532 T.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoA.sub.esG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.eoT.sub.eoG.sub.esT.sub.esT.sub.e 30 288 650649 N/A N/A 11609 11626 A.sub.esA.sub.eoA.sub.eoG.sub.eoG.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.eoG.sub.eoG.sub.esT.sub.esG.sub.e 35 289 650650 N/A N/A 11690 11707 A.sub.esA.sub.eoA.sub.eoA.sub.eoA.sub.esT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.esA.sub.esG.sub.e 26 290 11984 12001 650651 N/A N/A 15320 15337 A.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eoG.sub.esG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.eoA.sub.eoA.sub.es.sup.mC.sub.es.sup.mC.sub.e 23 291 650652 N/A N/A 16170 16187 A.sub.esG.sub.eoA.sub.eoA.sub.eoA.sub.esG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoA.sub.esG.sub.esG.sub.e 10 292 16488 16505 650653 N/A N/A 17193 17210 A.sub.esT.sub.eoT.sub.eoT.sub.eoA.sub.esA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.eoA.sub.eoT.sub.esA.sub.es.sup.mC.sub.e 2 293 650654 N/A N/A 17686 17703 .sup.mC.sub.esA.sub.eoT.sub.eoG.sub.eo.sup.mC.sub.esA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esA.sub.esT.sub.e 8 294 650655 N/A N/A 17703 17720 T.sub.es.sup.mC.sub.eoA.sub.eo.sup.mC.sub.eoT.sub.esA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoG.sub.eoG.sub.esG.sub.es.sup.mC.sub.e 25 295 650656 N/A N/A 18799 18816 A.sub.esA.sub.eoG.sub.eoT.sub.eoT.sub.esA.sub.dsG.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.eoT.sub.eoA.sub.esT.sub.esA.sub.e 0 296 650657 N/A N/A 20598 20615 T.sub.es.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esG.sub.e 16 297 650658 N/A N/A 23358 23375 A.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoA.sub.esG.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.eo.sup.mC.sub.eoT.sub.esA.sub.esA.sub.e 16 298 650659 N/A N/A 24393 24410 A.sub.esT.sub.eoA.sub.eoT.sub.eoA.sub.esG.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.eoA.sub.eoA.sub.esA.sub.esA.sub.e 0 299 650660 N/A N/A 25114 25131 A.sub.esA.sub.eoG.sub.eoG.sub.eo.sup.mC.sub.esA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.eoG.sub.eoT.sub.esA.sub.esA.sub.e 22 300 650661 N/A N/A 26689 26706 A.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.es.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.e 0 301 650662 N/A N/A 26813 26830 T.sub.esG.sub.eo.sup.mC.sub.eo.sup.mC.sub.eo.sup.mC.sub.esG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.eoG.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 10 302 650663 N/A N/A 27243 27260 G.sub.esT.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoT.sub.esA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.eoT.sub.eoT.sub.esT.sub.es.sup.mC.sub.e 0 303 650664 N/A N/A 28181 28198 T.sub.esG.sub.eoA.sub.eoG.sub.eoT.sub.esT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.eoA.sub.eoA.sub.esA.sub.esA.sub.e 12 304 650665 N/A N/A 28226 28243 mC.sub.esA.sub.eoT.sub.eoT.sub.eoA.sub.esA.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.es.sup.mC.sub.e 16 305 650666 N/A N/A 28231 28248 T.sub.es.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.eoG.sub.eoA.sub.esT.sub.esG.sub.e 26 306 650667 N/A N/A 28236 28253 A.sub.esA.sub.eoA.sub.eoT.sub.eoA.sub.esT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.eoA.sub.eoA.sub.esG.sub.esA.sub.e 12 307 650668 N/A N/A 28266 28283 A.sub.esG.sub.eo.sup.mC.sub.eo.sup.mC.sub.eoA.sub.esT.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.eoA.sub.eo.sup.mC.sub.esT.sub.esG.sub.e 57 308 650669 N/A N/A 35157 35174 A.sub.esG.sub.eoA.sub.eoT.sub.eoT.sub.esT.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.eoG.sub.eoG.sub.esA.sub.esT.sub.e 0 309 650670 N/A N/A 35981 35998 A.sub.esA.sub.eoT.sub.eoG.sub.eoA.sub.esG.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.eoT.sub.eoA.sub.esT.sub.esA.sub.e 38 310 650671 N/A N/A 38694 38711 T.sub.esA.sub.eoG.sub.eoA.sub.eoA.sub.esA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.eoA.sub.eoG.sub.esT.sub.esT.sub.e 11 311 650672 N/A N/A 43232 43249 G.sub.es.sup.mC.sub.eoA.sub.eoT.sub.eo.sup.mC.sub.esA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.eoG.sub.eoA.sub.esA.sub.esA.sub.e 14 312 Subscripts: e represents a 2-MOE-nucleoside; d represents a 2-deoxynucleoside; s represents a phosphorothioate internucleoside linkage; and o represents a phosphodiester internucleoside linkage. Superscript m preceding a C indicates that the cytosine is a 5-methylcytosine.

[0255] Additional modified oligonucleotide were designed targeting the ATXN3 nucleic acid sequences listed in Table 2.

TABLE-US-00002 TABLE 2 ATXN3 nucleic acids GenBank Human ATXN3 transcript SEQ ID Accession number variant name No NM_001164778.1 transcript variant o, mRNA 3 NM_001127696.1 transcript variant ad, mRNA 4 NM_001164781.1 transcript variant y, mRNA 5 NR_028454.1 transcript variant d, non-coding 6 NM_001164780.1 transcript variant u, mRNA 7 NR_028469.1 transcript variant af, non-coding 8 NM_001164779.1 transcript variant r, mRNA 9 NR_028461.1 transcript variant p, non-coding 10 NR_028466.1 transcript variant x, non-coding 11 NR_028462.1 transcript variant q, non-coding 12 NR_028467.1 transcript variant z, non-coding 13 NR_031765.1 transcript variant c, non-coding 14 NM_001164782.1 transcript variant ae, mRNA 15 NR_028465.1 transcript variant w, non-coding 16 NR_028457.1 transcript variant k, non-coding 17 NM_001164777.1 transcript variant j, mRNA 18 NM_001164774.1 transcript variant b, mRNA 19

[0256] Modified oligonucleotides complementary to the ATXN3 nucleic acids from Table 2 were tested for the effect on ATXN3 mRNA according to the protocol described above. The modified oligonucleotides in the table below were designed as 5-8-5 MOE gapmers. The gapmers are 18 nucleosides in length, wherein the central gap segment comprises eight 2-deoxynucleosides and is flanked by wing segments on both the 5 end and on the 3 end comprising five nucleosides each. Each nucleoside in the 5 wing segment and each nucleoside in the 3 wing segment comprises a MOE modification. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkages are arranged in order from 5 to 3: sooosssssssssooss; wherein (o) is phosphodiester and (s) is phosphorothioate. Start site indicates the 5-most nucleoside to which the gapmer is targeted in the human gene sequence. Stop site indicates the 3-most nucleoside to which the gapmer is targeted human gene sequence.

TABLE-US-00003 TABLE3 PercentreductionofhumanATXN3mRNAby modifiedoligonucleotidesrelativetocontrol Target SEQ IONIS SEQ Start Stop Sequence % ID No IDNo Site Site (5 to3) Inhib. No 650361 3 443 460 .sup.mC.sub.esT.sub.eoG.sub.eoT.sub.eo.sup.mC.sub.esT.sub.ds 1 313 G.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds .sup.mC.sub.dsT.sub.eoA.sub.eoA.sub.esT.sub.esT.sub.e 650611 4 248 265 T.sub.esT.sub.eoA.sub.eoT.sub.eoA.sub.esA.sub.ds 48 314 .sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds A.sub.dsA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esG.sub.e 650613 5 87 104 T.sub.esT.sub.eoG.sub.eo.sup.mC.sub.eoT.sub.esT.sub.ds 0 315 A.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650614 6 128 145 T.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.esT.sub.ds 8 316 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds T.sub.dsA.sub.eoG.sub.eoA.sub.esG.sub.esA.sub.e 650615 7 87 104 A.sub.esT.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.esT.sub.ds 7 317 .sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650618 8 687 704 G.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eoA.sub.es.sup.mC.sub.ds 5 318 T.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds A.sub.ds.sup.mC.sub.eoT.sub.eoT.sub.esT.sub.esT.sub.e 650620 9 87 104 A.sub.esA.sub.eoG.sub.eoT.sub.eoT.sub.esA.sub.ds 20 319 A.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650621 10 443 460 T.sub.esA.sub.eoA.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.ds 2 320 G.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds .sup.mC.sub.dsT.sub.eoA.sub.eoA.sub.esT.sub.esT.sub.e 650622 11 87 104 T.sub.esA.sub.eoT.sub.eoA.sub.eoG.sub.esA.sub.ds 3 321 A.sub.dsT.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650623 12 443 460 .sup.mC.sub.es.sup.mC.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.es 23 322 .sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.ds G.sub.dsT.sub.dsA.sub.eoA.sub.eoT.sub.esT.sub.esG.sub.e 650619 13 290 307 A.sub.es.sup.mC.sub.eo.sup.mC.sub.eoA.sub.eo.sup.mC.sub.esT.sub.ds 27 323 G.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ds G.sub.eoA.sub.eoA.sub.esA.sub.esA.sub.e 650624 13 375 392 A.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.ds 9 324 T.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds A.sub.eoT.sub.eoT.sub.esG.sub.esA.sub.e 650627 13 471 488 A.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eo.sup.mC.sub.es.sup.mC.sub.ds 9 325 T.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds G.sub.dsT.sub.eoA.sub.eoA.sub.esA.sub.esG.sub.e 650628 14 87 104 T.sub.esT.sub.eoT.sub.eoT.sub.eoA.sub.esT.sub.dsG.sub.ds 0 326 G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds T.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650630 15 87 104 T.sub.esT.sub.eoT.sub.eoG.sub.eo.sup.mC.sub.esT.sub.ds 11 327 G.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.ds T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650631 16 248 265 T.sub.esT.sub.eo.sup.mC.sub.eoA.sub.eoT.sub.esT.sub.ds 17 328 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds A.sub.dsA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esG.sub.e 650632 16 794 811 A.sub.esT.sub.eoT.sub.eoT.sub.eoT.sub.es.sup.mC.sub.ds 0 329 A.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds G.sub.dsG.sub.eo.sup.mC.sub.eoT.sub.esT.sub.es.sup.mC.sub.e 650636 16 848 865 T.sub.esA.sub.eoT.sub.eoT.sub.eoA.sub.esA.sub.ds 6 330 G.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds G.sub.dsT.sub.eo.sup.mC.sub.eoA.sub.esG.sub.es.sup.mC.sub.e 650637 17 535 552 A.sub.esA.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.esA.sub.ds 20 331 .sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ds A.sub.dsA.sub.eoG.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650610 18 87 104 .sup.mC.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.esA.sub.ds 0 332 G.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds T.sub.dsT.sub.eo.sup.mC.sub.eoT.sub.es.sup.mC.sub.esG.sub.e 650638 18 125 142 .sup.mC.sub.esT.sub.eoG.sub.eoT.sub.eo.sup.mC.sub.esT.sub.ds 1 333 G.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds A.sub.dsG.sub.eoA.sub.eoA.sub.esA.sub.esA.sub.e 650639 19 248 265 .sup.mC.sub.esT.sub.eoG.sub.eo.sup.mC.sub.eoT.sub.esG.sub.ds 0 334 T.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.ds A.sub.dsA.sub.eoA.sub.eoA.sub.es.sup.mC.sub.esG.sub.e
Subscripts: e represents a 2-MOE nucleoside; d represents a 2-deoxynucleoside; s represents a phosphorothioate internucleoside linkage; and o represents a phosphodiester internucleoside linkage. Superscript m preceding a C indicates that the cytosine is a 5-methylcytosine.

Example 2: Effect of Modified Oligonucleotides on Human ATXN3 In Vitro, Multiple Doses

[0257] Modified oligonucleotides selected from Example 1 were also tested at various doses in HepG2 cells in studies of in vitro reduction of human ATXN3 mRNA. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

[0258] Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.11 M, 0.33 M, 1.00 M, 3.00 M, and 9.00 M concentrations of modified oligonucleotide, as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and ATXN3 mRNA levels were measured by quantitative real-time PCR. Human ATXN3 primer probe set RTS4392 was used to measure mRNA levels. ATXN3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent reduction of ATXN3, relative to untreated control cells. 0 indicate that the antisense oligonucleotide did not reduce ATXN3 mRNA levels. The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is also presented in the table below.

TABLE-US-00004 TABLE 4 Percent reduction of human ATXN3 mRNA by modified oligonucleotides relative to control IONIS 0.11 IC.sub.50 No M 0.33 M 1.00 M 3.00 M 9.00 M (M) 650372 2 24 39 76 80 1.4 650379 6 13 29 52 66 3.2 650410 16 20 42 68 85 1.3 650437 0 32 59 77 90 1.0 650438 8 19 42 68 78 1.5 650466 15 15 45 53 76 1.9 650494 15 17 32 53 82 1.9 650507 9 8 37 59 81 1.9 650512 2 23 46 73 82 1.3 650513 25 42 63 72 84 0.6 650528 8 32 47 68 81 1.2 650532 1 20 31 60 76 2.0 650578 9 24 41 54 64 2.5 650668 1 19 41 65 77 1.7

Example 3: Acute Tolerability of Modified Oligonucleotides Complementary to Human ATXN3 in C57BL/6 Mice

[0259] Modified oligonucleotides selected from the examples above were tested in mice to assess tolerability of the oligonucleotides in vivo. Female wild type C57BL/6 mice were divided into treatment groups consisting of four mice. The mice were administered a single intracerebroventricular (ICV) dose of 700 g of a modified oligonucleotide listed in the table below. One group of four mice was administered a single ICV dose of PBS as a control to which the modified oligonucleotide treated groups was compared.

[0260] At 3 hours post injection, each mouse was evaluated according to 7 different criteria. The 7 criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to a tail pinch; (7) regular breathing. For each of the 7 different criteria, each mouse was given a sub-score of 0 if it met the criteria or 1 if it did not. After all of the 7 criteria were evaluated, the sub-scores were summed for each mouse and then averaged for each group. For example, if a mouse was bright, alert, and responsive 3 hours after the 700 g ICV dose, and met all other criteria, it would get a summed score of 0. If another mouse was not bright, alert, and responsive 3 hours after the 700 g ICV dose but met all other criteria, it would receive a score of 1. The results are presented as the average score for each treatment group.

TABLE-US-00005 TABLE 5 Acute tolerability scores Treatment (IONIS No) Score PBS 0.00 650372 5.25 650410 3.25 650438 6.50 650507 0.75 650512 1.25 650513 6.00 650528 2.50 650668 3.25

Example 4: Acute Tolerability of Modified Oligonucleotides Complementary to Human ATXN3 in Sprague Dawley Rats (3 mg)

[0261] Sprague Dawley rats were separated into groups of 4 rats for the experiment presented in the table below. Each rat in each group of rats was administered a single 3 mg intrathecal (IT) dose of an oligonucleotide described in example 1 or example 2 above. At 3 hours after injection, the movement of 7 different parts of the body was evaluated for each rat. The 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; (7) the rat's head. For each of the 7 different body parts, each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group (the functional observational battery score or FOB). For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1. Saline treated rats generally receive a score of 0. A score of at the top end of the range would be suggestive of acute toxicity. Results are presented as the average score for each treatment group.

TABLE-US-00006 TABLE 6 Acute tolerability scores Compound 3 hr ID FOB PBS 0.50 650410 3.25 650507 0.25 650512 0.75 650528 1.75 650668 1.75