INDUCED DENDRITIC CELLS AND USES THEREOF
20190247430 ยท 2019-08-15
Inventors
- Renata Stripecke (Hannover, DE)
- Gustavo Salguero-Lopez (Hannover, DE)
- Anusara Daenthanasanmak (Hannover, DE)
- Arnold Ganser (Hannover, DE)
Cpc classification
A61K2035/124
HUMAN NECESSITIES
A61K49/0008
HUMAN NECESSITIES
C12N2501/22
CHEMISTRY; METALLURGY
A61K35/15
HUMAN NECESSITIES
A61K2035/122
HUMAN NECESSITIES
A61K2039/5154
HUMAN NECESSITIES
A01K67/0271
HUMAN NECESSITIES
C12N5/0639
CHEMISTRY; METALLURGY
A61K2239/38
HUMAN NECESSITIES
A61K39/46434
HUMAN NECESSITIES
International classification
A61K35/15
HUMAN NECESSITIES
Abstract
The present invention relates to cells engineered to express at least one cytokine and at least one antigen which induces the self differentiation of dendritic cell (DC) progenitor cells into functional antigen-presenting induced DC (iDC). Moreover, therapeutic uses of said iDC for regenerating the immune system after transplantation of hematopoietic stem cells are disclosed. Said iDC are also useful for generating mice with a functional endogenously regenerated humanized immune system producing antigen-specific T and B cell responses which can be used as animal models for the study of the human adaptive immune responses.
Claims
1. A mouse with a regenerated human immune system produced by the steps of: a) transplanting human hematopoietic stem cells into a mouse; and b) administering to the mouse induced human dendritic cells (iDCs), wherein said human iDCs are engineered to express i) at least on cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into human DCs; and ii) at least one antigen wherein the human iDCs optionally comprise at least one vector, wherein said vector mediates the expression of said at least one cytokine and said at least one antigen, and wherein said administration of the human iDCs induces reconstitution of peripheral lymph nodes, and/or increases the frequency and/or absolute numbers of the de novo endogenously developed nave and mature CD4.sup.+ T helper cells and cytotoxic CD8.sup.+ T cells, and/or increases the frequency and/or absolute numbers of mature B cells and/or increases the production of human immunoglobulins.
2. The mouse of claim 1, wherein the cytokine is selected from the group consisting of GM-CSF, IL-4, IFN-, IL-15, TGF-B, TNF-, FLT3L, IL-3 and CD40L.
3. The mouse of claim 1, wherein the iDC expresses a combination of cytokines selected from the group consisting of (i) FLT3L and IL-3; (ii) FLT3L and CD40L; (iii) FLT3L and IFN-; (iv) GM-CSF and IFN- and IL-15; (v) GM-CSF and IFN- and TNF-; and (vi) GM-CSF and IFN- and TGF-B.
4. The mouse of claim 1, wherein the antigen expressed by the iDCs is an antigen which can induce a cytotoxic or humoral immune response selected from the group consisting of xeno-reactivity, allo-reactivity, neo-reactivity or auto-immunity.
5. The mouse of claim 1, wherein the mouse is characterized by the presence of endogenous T-cells and endogenous progenitors of dendritic cells.
6. The mouse of claim 1, wherein the mouse strain has a primary immune deficiency that leads to dysfunction or absence of an adaptive immune system (including T and B cells).
7. The mouse of claim 1, wherein the mouse is selected from the group of strains consisting of NOD-Rag1.sup.nullIL2R.sup.null-NRG, NOD/LtSz-SCID/IL2R.sup.null-NSG and NOD/SCID/IL2R.sup.null-NOG.
8. A mouse with a regenerated human immune system comprising human hematopoietic stem cells and induced human iDCs, wherein said human iDCs are engineered to express i) at least on cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into human DCs; and ii) at least one antigen, wherein the human iDCs optionally comprise at least one vector, wherein said vector mediates the expression of said at least one cytokine and the at least one antigen.
9. A method of producing a mouse of claim 1, comprising the steps: a) transplanting human hematopoietic stem cells to an immunodeficient mouse; and b) administering to the mouse induced human dendritic cells (iDCs), wherein said human iDCs is engineered to express i) at least on cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into human DCs; and ii) at least one antigen wherein the human iDCs optionally comprise at least one vector, wherein said vector mediates the expression of said at least one cytokine and said at least one antigen, and wherein said administration of the human iDCs induces reconstitution of peripheral lymph nodes, and/or increases the frequency and/or absolute numbers of the de novo endogenously developed nave and mature CD4.sup.+ T helper cells and cytotoxic CD8.sup.+ T cells, and/or increases the frequency and/or absolute numbers of mature B cells and/or increases the production of human immunoglobulins.
10. A method of producing a mouse of claim 8, comprising the steps: a) transplanting human hematopoietic stem cells to an immunodeficient mouse; and b) administering to the mouse induced human dendritic cells (iDCs), wherein said human iDCs is engineered to express i) at least on cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into human DCs; and ii) at least one antigen wherein the human iDCs optionally comprise at least one vector, wherein said vector mediates the expression of said at least one cytokine and said at least one antigen, and wherein said administration of the human iDCs induces reconstitution of peripheral lymph nodes, and/or increases the frequency and/or absolute numbers of the de novo endogenously developed nave and mature CD4.sup.+ T helper cells and cytotoxic CD8.sup.+ T cells, and/or increases the frequency and/or absolute numbers of mature B cells and/or increases the production of human immunoglobulins.
11. A method of producing human antibodies comprising the step of immunizing a mouse of claim 1 with an antigen.
12. A method of producing human antibodies comprising the step of immunizing a mouse of claim 8 with an antigen.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212] In a first aspect, the present invention relates to an induced dendritic cell (iDC) engineered to express [0213] a) at least one cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into DCs; and [0214] b) at least one antigen; [0215] for use as a medicament.
[0216] In a second aspect, the present invention relates to n iDC engineered to express [0217] a) at least one cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into DCs; and [0218] b) at least one antigen; [0219] for use in the regeneration of the immune system of an immunodeficient subject following transplantation of hematopoietic stem cells (HSC).
[0220] In a third aspect, the present invention relates to the iDC according to aspect 2, wherein the vector is a lentiviral vector.
[0221] In a fourth aspect, the present invention relates to the iDC according to aspect 3, wherein the lentiviral vector is integrase defective.
[0222] In a fifth aspect, the present invention relates to the iDC according to any one of aspects 2 to 4, wherein the iDC expressing at least one antigen expresses at least one cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into DCs.
[0223] In a sixth aspect, the present invention relates to the method according to aspect 5, wherein the cytokine is selected from the group consisting of GM-CSF, IL-4, IFN-, IL-15, TGF-B, TNF-, FLT3L, IL-3 and CD40L.
[0224] In a seventh aspect, the present invention relates to the iDC according to aspect 6, wherein the iDC expresses a combination of cytokines selected from the group consisting of (i) FLT3L and IL-3; (ii) FLT3L and CD40L; (iii) FLT3L and IFN ; (iv) GM-CSF and IFN- and IL-15; (v) GM-CSF and IFN- and TNF-; and (vi) GM-CSF and IFN- and TGF-B.
[0225] In an eighth aspect, the present invention relates to the iDC according to any one of aspects 2 to 7, wherein one antigen is expressed by the iDC is an antigen which can induce a cytotoxic or humoral immune response selected from the group consisting of xeno-reactivity, allo-reactivity, neo-reactivity or auto-immunity.
[0226] In a ninth aspect, the present invention relates to the iDC according to any one of aspects 2 to 8, wherein the immunodeficiency of the subject is an immunodeficiency selected from the group consisting of immunodeficiency caused by ionizing radiation, immunodeficiency caused by the administration of at least one cytotoxic pharmaceutical, primary immunodeficiency and immunodeficiency caused by a pathogen.
[0227] In a tenth aspect, the present invention relates to the iDC according to any one of aspects 2 to 9, wherein the hematopoietic stem cell transplant is autologous.
[0228] In an eleventh aspect, the present invention relates to the iDC according to any one of aspects 2 to 9, wherein the stem cell transplant is heterologous.
[0229] In a twelfth aspect, the present invention relates to the iDC according to any one of aspects 2 to 11, wherein the subject is human.
[0230] In a thirteenth aspect, the present invention relates to an iDC engineered to express [0231] a) at least one cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into DCs; and [0232] b) at least one antigen;
for use as a medicament for the treatment of cancer which spreads lymphatically or a disease caused by a lymphotrophic pathogen.
[0233] In a fourteenth aspect, the present invention relates to an iDC comprising at least one integrase-defective lentiviral vector, wherein said vector mediates expression of [0234] a) at least one cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into DCs; and [0235] b) at least one antigen.
[0236] In a fifteenth aspect, the present invention relates to a method for regenerating an immune system in an immunodeficient subject comprising the steps of [0237] a) transplanting hematopoietic stem cells to the subject; and [0238] b) administering to the subject an induced dendritic cell (iDC) engineered to express at least one antigen and at least one cytokine which induces the self-differentiation of human dendritic cell (DC) progenitor cells into DCs.
[0239] In a sixteenth aspect, the present invention relates to the method according the aspect 15, wherein the subject is a mouse and the HSC are derived from a human.
[0240] In a seventeenth aspect, the present invention relates to the method according to the aspect 16, wherein the mouse is characterized by the presence of endogenous T-cells and endogenous progenitors of dendritic cells.
[0241] In an eighteenth aspect, the method according to aspects 16 or 17, wherein the mouse strain has a primary immune deficiency that leads to dysfunction or absence of adaptive immune system (including T and B cells).
[0242] In a nineteenth aspect, the present invention relates to the method according to any one of aspects 16 to 18, wherein the mouse is selected from the group of strains consisting of NOD-Rag1.sup.nullIL2Ry.sup.null-NRG, NOD/LtSz-SCID/IL2Ry.sup.null-NSG and NOD/SCID/IL2Ry.sup.null-NOG.
[0243] In a twentieth aspect, the present invention relates to the method according to any one of aspects 15 to 19, wherein the vector mediates the expression of the antigen pp65 and the cytokines (i) GM-CSF and (ii) interferon- and/or interleukin-4.
[0244] In a twenty-first aspect, the present invention relates to a mouse with a regenerated immune system produced by a method according to any one of aspects 16 to 20.
[0245] In a twenty-second aspect, the present invention relates to use of the mouse according to aspect 21 for the study of the human immune system or for the testing of drugs, implants or devices for their use in humans.
[0246] The following example is merely intended to illustrate the invention. They shall not limit the scope of the claims in any way.
EXAMPLES
Example 1
Materials and Methods
Lentiviral Vector Construction and Integrase-Defective Lentivirus Production
[0247] The self-inactivating (SIN) lentiviral backbone vector and the monocistronic vectors expressing the CMV-pp65 and firefly luciferase, LV-fLUC were previously described (Salguero, G. et al., 2011, Preconditioning therapy with lentiviral vector-programmed dendritic cells accelerates the homeostatic expansion of antigen-reactive human T cells in NOD.Rag1/.IL-2rgammac/ mice. Hum Gene Ther 22: 1209-1224). Construction of the bicistronic lentiviral vector expressing the human granulocyte-macrophage colony stimulating factor and of the human interferon alpha (LV-G2) interspaced with a P2A element (RRL-cPPT-CMV-hGMCSF-P2A-hIL4) was constructed and extensively characterized as previously described (Daenthanasanmak, A. et al., 2012, Integrase-defective lentiviral vectors encoding cytokines induce differentiation of human dendritic cells and stimulate multivalent immune responses in vitro and in vivo. Vaccine 30: 5118-5131). The structural integrity of all constructs was reconfirmed by restriction digestion and sequencing analysis of the promoters and transgenes. Large scale lentivirus production was performed by transient co-transfection of human embryonic kidney 293T cells as formerly described (Stripecke, R., 2009, Lentiviral vector-mediated genetic programming of mouse and human dendritic cells. Methods Mol Biol 506: 139-158.). To generate integrase-defective lentivirus, four packaging plasmids were used in the co-transfection: the plasmid containing the lentiviral vector expressing the cytokines, the plasmid expressing gag/pol containing a D64V point mutation in the integrase gene (pcDNA3 g/pD64V.4CTE), the plasmid expressing rev (pRSV-REV) and the plasmid encoding the VSV-G envelope (pMD.G). Virus supernatants were collected and concentrated by ultracentrifugation and the titers were evaluated by assessing p24 antigen concentration with enzyme-linked immunoabsorbent assay (ELISA) (Cell Biolabs, Inc. San Diego, USA). One g of p24 equivalent/ml corresponds to approximately 110.sup.7 infective viral particles/ml.
Human CD34 Positive Peripheral Blood Stem Cell Isolation
[0248] Peripheral blood mononuclear cells (PBMCs) were obtained from leukapheresis of hematopoietic adult stem cell transplantation adult donors subjected to haematopoietic stem cell mobilization regimen with G-CSF (Granocyte, Chugai Pharma). All studies were performed in accordance with protocols approved by the Hannover Medical School Ethics Review Board. CD34+ cells were positively selected by MACS using a CD34 magnetic cell isolation kit (Miltenyi Biotech, Bergisch-Gladbach, Germany). After two rounds of positive magnetic selection, cell purity obtained was above 97% with a contamination of CD3+ T cells bellow 0.2% as evaluated by flow cytometry.
Generation of Human Conventional-IFN and Smyle DCs,
[0249] The autologous CD34 negative PBMC fraction was used for further positive selection of CD14.sup.+ monocytes using CD14 isolation beads (Miltenyi Biotech). For lentiviral gene transfer, monocytes were kept in culture with serum-free Cellgro medium in the presence of recombinant human GM-CSF and IL-4 (50 ng/ml each, Cellgenix, Freiburg, Germany) for 8 h prior to transduction. For generation of SmyleDC/pp65, 510.sup.6 CD14.sup.+ monocytes were transduced at a multiplicity of infection (M.O.I.) of 5 (corresponding to 2.5 g/mL p24 equivalent) of both ID-LV-G2 and in the presence of 5 g/ml protamine sulfate (Valeant, Dusseldorf, Germany) for 16 h. After transduction, Smyle/pp65 DC were washed twice with phosphate-buffered saline (PBS) and further maintained in culture with serum-free Cellgro medium. For production of conventional IFN--DCs monocytes were incubated with ID-LV-pp65 as described above. Following 16 h transduction, LV was removed and cells were maintained in culture in the presence of recombinant human GM-CSF (50 ng/ml), and IFN- (1000 U/ml, PBL InterferonSource, New Jersey, USA). Cytokines for Con-IFN/pp65 were replenished every 3 days, while SmyleDC were incubated without cytokines in the medium. iDC were harvested after 7, 14 and 21 days of culture. For mouse immunizations, Smyle/pp65 at day 1 or Con-IFN/pp65 DC at day 7 after transduction were resuspended in PBS, used for s.c. injection. The number of viable counts was determined with trypan blue exclusion.
Mouse Transplantation with Human HSC
[0250] NOD.Cg-Rag1.sup.tmlMomIl2rg.sup.tmlWjl (NOD;Rag1.sup./;IL-2r.sup./, NRG) mice were bred and maintained under pathogen free conditions in an IVC system (BioZone, United Kingdom). All procedures involving mice were reviewed and approved by the Lower Saxony and followed the guidelines provided by the Animal Facility at Hannover Medical School. For HSC transplantation, 4-week old mice were sublethally irradiated (450 cGy) using a .sup.137Cs column irradiator (gammacell, company, country). Mouse recipients were intravenously injected with 510.sup.5 human CD34+ peripheral blood HSC into the tail vein. Mice were bled at different time points (6, 10 and 13) after human HSC transplantation to monitor the status of human hematopoietic cell engraftment and were sacrificed at week 20 for final analyses. For DC immunizations, Smyle/pp65 or Con-IFN/pp65 DC were collected from culture plates and resuspended at a concentration of 510.sup.5 cells in 100 L of PBS. HSC-reconstituted mice were injected at 10 and 11 week after HSC transplantation with DC suspensions by subcutaneously injection into the mouse right hind limb using a 27-gauge needle.
Flow Cytometry Analysis
[0251] Engraftment of human hematopoietic cells in human HSC-reconstituted mice was evaluated in peripheral blood and spleens using the following mouse anti-human antibodies: PerCP anti-CD45, Alexa700 anti-CD19, Pacific blue anti-CD4, APC anti-CD3, PE-Cy7 anti-CD8, FITC anti-CD45RA, PE anti-CD62L (Biolegend), PE anti-CD14, FITC anti-Lineage positive, APC anti-CD11c, PE anti-CD123 (Becton Dickinson). For peripheral blood analyses, blood was lysed by two rounds of incubation with erythrocyte lysis buffer (0.83% ammonium chloride/20 mM Hepes, pH 7.2) for 5 min at room temperature followed by stabilization with cold phosphate buffered saline (PBS) and centrifugation for 5 min at 300 g. Cells were incubated with antibodies for 30 min at 4 C. Harvested spleen cells were treated with erythrocyte lysis buffer (0.83% ammonium chloride/20mMHepes, pH 7.2) for 5 min, washed with phosphate buffered saline (PBS) and incubated with antibodies for 30 min on ice. After a washing step, cells were resuspended in PBS and acquired in LSR flow cytometer (Becton Dickinson). For DC phenotypic characterization the following anti-human antibodies were used: PE anti-CD80, PerCP anti-HLA-DR, APC anti-CD86, APC anti-CD83 (Becton Dickinson). For DC staining, cells were collected, washed once with PBS and incubated with mouse IgG (50 g/mL) on ice for 15 min followed by incubation with the antibodies. Cells were washed, resuspended in cell fix solution (Becton Dickinson) and further analyzed using a FACSCalibur cytometer. Analyses were performed using FlowJo software (Tree Star, Inc.).
Histology and Immunohistochemistry Analysis of Human T Cell Engraftment
[0252] LN from human HSC-reconstituted NRG or C57B16 wild type mice were harvested and embedded in optimal cutting temperature compound (O.C.T. Sakura Finetek, Torrance, Calif., USA) for cryopreservation. Frozen sections (5 m) were fixed by acetone and stained with monoclonal anti-mouse or human CD3 (eBioscience, San Diego, Calif., USA), anti mouse or human CD11c (eBioscience), anti-mouse LYVE-1 (Dako), anti-CD31 mouse (BD Bioscience). Immunofluorescence analyses were performed in a AXIOCAM fluorescence microscope (Zeiss).
In Vivo Bio-Luminescence Imaging Analyses
[0253] Mice were anesthetized with ketamine (100 mg/kg intraperitoneally) and xylazine (10 mg/kg intraperitoneally), and an aqueous solution of d-luciferin (150 mg/kg intraperitoneally) was injected 5 minutes before imaging. Mice were placed into a dark chamber of the charge-coupled device camera (IVIS 200, Xenogen, Cranbury, N.J., USA), and grayscale body surface reference images (digital photograph) were taken under weak illumination. After the light source was switched off, photons emitted from luciferase-expressing cells within the animal body and transmitted through the tissue were quantified over a defined time of up to 5 minutes using the software program Living Image (Xenogen) as an overlay on Igor (Wavemetrics, Seattle, Wash., USA). For anatomical localization, a pseudocolor image representing light intensity (blue, least intense; red, most intense) was generated in Living Image and superimposed over the grayscale reference image. Quantified luminescence consists in averaged photon radiance on the surface of the animal and is expressed as photons/sec/cm.sup.2/sr where sr=steradian.
Functional Analyses of Pp65-CTLs Recovered from Mouse LN and Spleen
[0254] For evaluation of immune responses against CMV-pp65, splenocytes from each group were harvested, pooled stained with APC-conjugated anti-human CD3 and sorted using a XDP cell sorter (Beckman Coulter). Human CD3.sup.+ cells were seeded at a density of 10.000 cells per well in anti-human IFN--coated 96-well ELISPOT plate and incubated overnight in the presence of 10 g/mL of pp65 overlapping peptide pool (Miltenyi). CEF recall peptide pool corresponding to a mixture of CMV, Epstein-Barr virus and influenza virus epitopes (PANA Tecs GmbH, Tuebingen, Germany) was used as positive control. Next day, cells were washed and plates were further incubated with biotin-conjugated anti-human IFN- antibodies followed by alkaline phosphatase-conjugated streptavidine. Plates were developed using NBT/BCIP liquid substrate and analyzed in an AELVIS ELISPOT reader (AELVIS GmbH, Hannover, Germany). For analyses of lymphocytes obtained from LN, cells were expanded ex vivo for seven days in the presence of SmyleDC or SmyleDC/pp65 and exposed to pp65 overlapping peptide pool on a ELISPT plate and IFN- spots were counted.
Immunoglobulin Production in HSC-NRG Mice
[0255] Plasma was harvested from HSC-NRG mice 20 weeks after reconstitution (8 weeks after second Smyle or IFN-conDC) and screened by ELISA for the presence of total human IgM an total human IgG as described elsewhere (Becker, P. D. et al., 2010, Generation of human antigen-specific monoclonal IgM antibodies using vaccinated human immune system mice PLoS One 5). Total IgM and IgG determination was performed by coating 96-well plates either with AffiniPure F(ab)2 fragment goat anti-human IgM (Fc5-specific, Jackson ImmunoResearch) or AffiniPure goat anti-human IgG (Fc fragment-specific; Jackson ImmunoResearch). Control human serum protein calibrator (Dako) with known IgM (0.8 mg/ml) and IgG (10.4 mg/ml) concentrations was used as a standard to be compared to the samples. After coating, the plates were washed in ELISA wash buffer (PBS, 0.5% Tween-20), blocked with 4% of milk and further incubated with serial dilution of mouse plasma (starting at a dilution of 1:5). Enzyme-conjugated detection antibodies were added at a dilution of 1:2500 for HRP-conjugated anti-IgG and a dilution of 1:5000 for HRP-conjugated anti-IgM (both from Jackson ImmunoResearch). TMB substrate/stop solution (Biosource) was used for the development of the ELISA assay.
Statistical Analysis
[0256] Parametric (t test) and non-parametric (Kruskall-Wallis) statistical analyses were performed to compare the differences among groups for engrarftment of hematopoietic lineages in HIS-NRG mice. Analyses were performed in Graph prism 5.sup.th version software. All tests were two-sided, and P<0.05 was considered significant.
Results
LV-Induced Smyle/Pp65 DC Generation and Characterization
[0257] We have recently shown that integrase-defective (ID)-LV used to promote constitutive expression of human GM-CSF and IFN in human monocytes induced highly viable IFN-DC with high activating status and high viability and engraftment properties in vivo (Daenthanasanmak, A. et al., 2012, Integrase-defective lentiviral vectors encoding cytokines induce differentiation of human dendritic cells and stimulate multivalent immune responses in vitro and in vivo Vaccine 30: 5118-5131). These LV-induced DC, named as Smyle (Self-differentiated, myeloid-derived, lentivirus-induced) DC, could be additionally co-transduced with a ID-LV for expression of the CMV tegument viral protein pp65. Smyle/pp65 potently stimulated anti CMV-specific CTL responses in vitro and in vivo. Here, we aimed to test the feasibility of Smyle/pp65 DC generation using leukapheresis obtained from GCSF-mobilized hematopoietic stem cell donors (
[0258] Both Smyle/pp65 and Con-IFN/pp65 maintained in culture secreted several endogenously up-regulated cytokines, that accumulated in the culture supernatants and were detectable by cytokine array analyses: IFN-g, IL-10, IL-12, 1L-13, IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, MCP-1 and TNF- showed an overall enhanced activation of Con-IFN/pp65 (
Smyle/Pp65 Supports Recovery of Lymphocyte Compartment after Human HSC Transplantation
[0259] In order to evaluate the potential of Smyle/pp65 to induce immune-reconstitution in a HSC transplantation setting, we first established a humanized immune system model of (HIS) by transferring human CD34.sup.+ cells into four-week old, sub-lethally irradiated NOD.Rag1.sup./ (NRG) mice. We detected CD3.sup.+ human T cells in peripheral blood already at six weeks post HSCT (0.35%), reaching average frequencies of 8.6% twenty weeks after CD34.sup.+ HSC transfer (data not shown). Human CD19.sup.+ B cells predominated within detectable human CD45.sup.+ cells, with levels ranging from 84% (week 6) up to 77% (week 20) (data not shown). 20 weeks after HSC reconstitution of HIS-NRG, human CD45.sup.+ cells corresponded to 3.9% of total splenocytes and CD19.sup.+ B cells represented to the majority of the human cell content (84%). Human CD3.sup.+ T lymphocytes corresponded to 7.8% of human CD45-expressing cells and contained CD4.sup.+ and CD8.sup.+ at a ratio of 1:1 (data not shown).
[0260] We next assessed whether immunization with Smyle/pp65 improved immune reconstitution in HIS-NRG mice. We followed a prime/boost immunization scheme consisting in one injection of DC in week 10 after HSCT followed by a boost injection one week later. Immunizations were performed by subcutaneous injections of Smyle/pp65 harvested immediately after LV-transduction or 7 days-cultured Con-IFN/pp65. DC cell suspensions (510.sup.5) were injected into the right flank, as previously described (Salguero, G. et al., 2011, Preconditioning therapy with lentiviral vector-programmed dendritic cells accelerates the homeostatic expansion of antigen-reactive human T cells in NOD.Rag1/.IL-2rgammac/ mice Hum Gene Ther 22: 1209-1224). Non-immunized mice served as controls (
[0261] We further analyzed the cell content of spleens from vaccinated and control mice 20 week after HSC reconstitution (
Smyle/Pp65 Immunization Induces Reconstitution of Peripheral Lymph Nodes.
[0262] We next analyzed mice injected with Smyle/pp65 or Con-IFN/pp65 DCs for the presence of lymph nodes (LN) 20 weeks after HSC reconstitution. We detected a high frequency of LN formation in mice injected with Smyle/pp65 (65%), whereas control mice or mice injected with Con-IFN/pp65 showed low occurrence of LN structures (11% and 28%, respectively) (
[0263] We next performed immunohistological analyses of LN obtained from Smyle/pp65-imunized NRG mice. LN architecture in LN from reconstituted NRG showed lack of B cell follicles compared to normal wild type LNs obtained from wild type C57BL/6 (
[0264] We next evaluated whether injected Smyle/pp65 DC were able to migrate to the reconstituted LN formed in HIS-NRG mice. Smyle/pp65 were co-transduced with a LV expressing firefly luciferase (LV-fLUC), such that they could produce bioluminescence upon exposure to Luciferin. Smyle/pp65-fLUC were injected into the hind limb of HSC-NRG mice 6 weeks after immunization at the right side, where LNs were more frequently found (
Smyle/Pp65 Induces Specific Immune Responses in HIS-NRG Mice
[0265] We have previously demonstrated that Smyle/pp65 stimulates anti-pp65 specific responses in a peripheral blood lymphocyte (PBL) mouse model (Daenthanasanmak, A. et al., 2012, Integrase-defective lentiviral vectors encoding cytokines induce differentiation of human dendritic cells and stimulate multivalent immune responses in vitro and in vivo. Vaccine 30: 5118-5131). Here we evaluate whether Smyle/pp65 immunization reconstituted NRG mice could stimulate specific T cell responses against CMV-pp65. Since we observed a significant effect of Smyle/pp65 in LN formation, we first wanted to test if these findings correlated with enhanced antigen specific reactivity against CMV-pp65 in local LN. We first evaluated the cell content of reconstituted LN after Smyle/pp65 immunization by flow cytometry. The majority of LN cells were human CD45.sup.+ (77%), with 73% corresponding to CD3.sup.+ T lymphocytes and 3.8% corresponding to CD19.sup.+ B cells (
Immunoglobulin Production in HSC-NRG Mice
[0266] We characterized the B lymphocyte compartment in reconstituted NRG mice DC after immunization. Frequency of CD19.sup.+ B lymphocytes (this is a relatively early B cell population) was not significantly different among all groups previous immunization (1.6%, 4.5% and 2% for control, Con-IFN/pp65 and Smyle/pp65 respectively) (
Discussion
[0267] DC are pivotal for organizing the development of LN, which are the most effective site for stimulation of adaptive T and B cell immune responses. Using a modality of iDC (IDLV-SmyleDC/pp65) described above, we evaluated the effects of DC vaccination in an immunodeficient mouse strain transplanted with human HSC. Lymphopenic mouse models making use of transplanted human hematopoieitic stem cell precursors/stem cells (such as CD34.sup.+ cells) have been developed worldwide in order to reconstitute the human immune system in mice (Lepus C M et al. Comparison of Human Fetal Liver, Umbilical Cord Blood, and Adult Blood Hematopoietic Stem Cell Engraftment in NOD-scid/c/, Balb/c-Rag1.sup./c.sup./, and C.B-17-scid/bg Immunodeficient Mice. Human immunology. October 2009; 70(10):790-802). These models have been explored to follow several steps of hematologic reconstitution such as HSC engraftment in bone marrow niches, mobilization, self-renewal, differentiation in several lineages. Long-term (16-20 weeks) follow-up of these mice after HSCT showed a generally impaired CD8.sup.+ T cell maintenance (Andre M C et al. Long-term human CD34+ stem cell-engrafted nonobese diabetic/SCID/IL-2R gamma(null) mice show impaired CD8+ T cell maintenance and a functional arrest of immature NK cells. J Immunol. Sep. 1 2010; 185(5):2710-2720). Mice transplanted with human HSC did not develop regenerated LN containing viable and functional T cells. Lymph nodes are the specialized tissues where the drained lymph is filtered for immune surveillance of pathogenic conditions (such as infections, cancer). Due to its specialized architecture, lymph nodes allow optimization of antigen presentation to T cells for priming and amplification of adaptive immune responses. Demonstration of antigen-specific CTL responses generated from LN in humanized mice have not been described with the previously available approaches such as exploring transgenic expression of human cytokines that are critical for adaptive immune responses (for example IL-7, IL-15, GMCSF) or by transgenic approaches of single human MHC class I or II molecules. On the other hand, the iDC immunization approach described here brings together into the immune deficient host a highly viable human professional antigen presenting cell perfectly matched with all the MHC molecules expressed by human stem cell graft that expresses a combination of several human cytokines and a highly immunogenic antigen (known to stimulate several different MHC-restricted immune responses). Thus, based on these properties, SmyleDC/pp65 immunization produced a dramatic increase in the absolute frequency of human T cells circulating in the peripheral blood, CTL responses against the pp65 CMV viral antigen and high levels of human IgG in the plasma demonstrating that adaptive human immune responses in the mice have been regenerated.
[0268] Moreover, the ability of the iDC to promote regeneration of lymph nodes concomitantly with stimulation of adaptive T and B cell immune responses in immunodeficient mice reconstituted with human HSC indicates that iDC have properties that support a general regeneration of a functional immune system from transplanted human HSC. Thus, iDC may be used in human patients who were transplanted with HSC in order to accelerate the development of a fully functional immune system, thus decreasing the susceptibility to infectious diseases or relapse of the malignancy after HSC transplantation.
Example 2
(Based on Example 1 but Comprising Additional Data and Partially Expanded Analysis of the Results)
Material and Methods
Lentiviral Vector Construction and Integrase-Defective Lentivirus Production
[0269] The self-inactivating (SIN) lentiviral backbone vector and the monocistronic vectors expressing the CMV-pp65 were previously described (Sato, Caux et al. 1993; Salguero, Sundarasetty et al. 2011). Construction of the bicistronic lentiviral vector expressing the human granulocyte-macrophage colony stimulating factor (huGM-CSF) and of the human interferon alpha (huIFN-) (LV-G2) interspaced with a P2A element (RRL-cPPT-CMV-hGMCSF-P2A-hIL4) was constructed and extensively characterized as previously described (Daenthanasanmak, Salguero et al. 2012). The structural integrity of all constructs was reconfirmed by restriction digestion and sequencing analysis of the promoters and transgenes. Large scale lentivirus production was performed by transient co-transfection of human embryonic kidney 293T cells as formerly described (Stripecke 2009). To generate integrase-defective lentivirus, four packaging plasmids were used in the co-transfection: the plasmid containing the lentiviral vector expressing the cytokines, the plasmid expressing gag/pol containing a D64V point mutation in the integrase gene (pcDNA3g/pD64V.4CTE), the plasmid expressing rev (pRSV-REV) and the plasmid encoding the VSV-G envelope (pMD.G). Virus supernatants were collected and concentrated by ultracentrifugation and the titers were evaluated by assessing p24 antigen concentration with enzyme-linked immunoabsorbent assay (ELISA) (Cell Biolabs, Inc. San Diego, USA). One g of p24 equivalent/ml corresponds to approximately 110.sup.7 infective viral particles/ml.
Human CD34 Positive Peripheral Blood Stem Cell Isolation
[0270] Peripheral blood mononuclear cells (PBMCs) were obtained from leukapheresis of hematopoietic adult stem cell transplantation adult donors subjected to haematopoietic stem cell mobilization regimen with G-CSF (Granocyte, Chugai Pharma). All studies were performed in accordance with protocols approved by the Hannover Medical School Ethics Review Board. Hematopoietic stem cells (HSC) CD34.sup.+ cells were positively selected by MACS using a CD34 magnetic cell isolation kit (Miltenyi Biotech, Bergisch-Gladbach, Germany). After two rounds of positive magnetic selection, cell purity obtained was above 99% with a contamination of CD3.sup.+ T cells below 0.2%, as evaluated by flow cytometry.
Generation of Human Conventional and SmyleDCs,
[0271] The autologous CD34 negative PBMC fraction was used for further positive selection of CD14.sup.+ monocytes using CD14 isolation beads (Miltenyi Biotech). For lentiviral gene transfer, monocytes were kept in culture with serum-free Cellgro medium in the presence of recombinant human GM-CSF and IL-4 (50 ng/ml each, Cellgenix, Freiburg, Germany) for 8 h prior to transduction. For generation of SmyleDC, 510.sup.6 CD14.sup.+ monocytes were transduced with 2.5 g/mL p24 equivalent (multiplicity of infection, M.O.I. of 5) of both ID-LV-G2 and ID-LV-pp65 in the presence of 5 g/ml protamine sulfate (Valeant, Dusseldorf, Germany). After 16 h transduction, SmyleDC were washed twice with phosphate-buffered saline (PBS) and further maintained in culture with serum-free Cellgro medium. For production of conventional (Cony) DC, monocytes were incubated with ID-LV-pp65 as described above. Following 16 h transduction, LV was removed and cells were further maintained in culture for 7 days in the presence of recombinant human GM-CSF (50 ng/ml), and IFN- (1000 U/ml, PBL InterferonSource, New Jersey, USA). Cytokines were replenished every 3 days. For mouse immunizations, SmyleDC directly after transduction or ConvDC at day 7 of culture were resuspended in PBS and used for mice injection. Viability, DC immunophenotype and cytokine release were assessed in Smyle or ConvDCs after 7, 14 and 21 days of culture. The number of viable counts was determined by trypan blue exclusion.
Mouse Transplantation with Human HSC
[0272] NOD.Cg-Rag1.sup.tmlMomIl2rg.sup.tmlWjl (NOD;Rag1.sup./;IL-2r.sup./, NRG) mice were bred and maintained under pathogen free conditions in an IVC system (BioZone, United Kingdom). All procedures involving mice were reviewed and approved by the Lower Saxony and followed the guidelines provided by the Animal Facility at Hannover Medical School. For HSC transplantation, 4-week old mice were sublethally irradiated (450 cGy) using a .sup.137Cs column irradiator (Gammacell 3000 Elan, Canada). Mouse recipients were intravenously injected with 510.sup.5 human CD34.sup.+ cells into the tail vein. Mice were bled at different time points (6, 10 and 13) after human HSC transplantation to monitor the status of human hematopoietic cell engraftment and were sacrificed at week 20 for final analyses. DC injections were performed at 10 weeks after HSC transplantation followed by a boost on the week 11. Briefly, Smyle or ConvDC were collected from culture plates, resuspended at a concentration of 510.sup.5 cells in 100 L of PBS and subcutaneously injected into the mouse right hind limb using a 27-gauge needle.
Flow Cytometry Analysis
[0273] Engraftment of human hematopoietic cells in human HSC-reconstituted mice was evaluated in peripheral blood, spleens and LN using the following mouse anti-human antibodies: PerCP anti-CD45, Alexa700 anti-CD19, Pacific blue (PB) anti-CD4, APC anti-CD3, PE-Cy7 anti-CD8, FITC anti-CD45RA, PE anti-CD62L (Biolegend), PE anti-CD14, FITC anti-Lineage positive, APC anti-CD11c, PE anti-CD123 (Becton Dickinson). For characterization of human B cells subpopulations, the next fluorochrome-conjugated antibodies were used: PB anti-CD45, Brilliant Violet 605 anti-CD19, PE anti-CD27, PE-Cy7 anti-CD38, FITC anti-IgD, Alexa700 anti-IgG, APC anti-IgM, PerCP-Cy5.5 anti-CD24 and APC-C7 anti-CD3. Follicular T helper cells were characterized by staining with PB anti-CD45, Alexa700 anti-CD14/CD19, FITC anti-CD3, APC-C7 anti-CD4, PerCP-Cy5.5 anti-CXCR5, APC anti-PD1 and PE-Cy7 anti-ICOS. For peripheral blood analyses, blood was lysed by two rounds of incubation with erythrocyte lysis buffer (0.83% ammonium chloride/20mMHepes, pH 7.2) for 5 min at room temperature followed by stabilization with cold phosphate buffered saline (PBS) and centrifugation for 5 min at 300 g. Cells were incubated with antibodies for 30 min at 4 C. Harvested spleen cells were treated with erythrocyte lysis buffer (0.83% ammonium chloride/20mMHepes, pH 7.2) for 5 min, washed with phosphate buffered saline (PBS) and incubated with antibodies for 30 min on ice. After a washing step, cells were resuspended in PBS and acquired in LSR-II or LSR Fortessa flow cytometers (Becton Dickinson). For DC phenotypic characterization the following anti-human antibodies were used: APC anti-CD11c, PE anti-CD14, APC anti-CD3, PE anti-CD80, PerCP anti-HLA-DR, APC anti-CD86, APC anti-CD83 (Becton Dickinson) and FITC anti-CMVpp65 (Pierce Biotechnology, Rockford, Ill.). For DC staining, cells were collected, washed once with PBS and incubated with mouse IgG (50 g/mL) on ice for 15 min followed by incubation with antibodies. Cells were washed, resuspended in cell fix solution (Becton Dickinson) and further analyzed using a FACSCalibur cytometer. All analyses were performed using FloJo (Tree Star Inc., Ashland, Oreg.) software.
Lymph Node Drainage Analyses
[0274] Evaluation of the hind limb lymphatic drainage was adapted from a methodology previously described (Harrell, Iritani et al. 2008). Briefly, mice were subcutaneously injected with 20-30 L of 5% Evans blue into the right hind limb. After injection dye was allowed to be taken up by lymphatic vessels for 30 min. Mice were euthanized and dissected to locate the inguinal and axillary draining LN and the lymphatic vessels.
Functional Analyses of Pp65-CTLs Recovered from Mouse LNs and Spleen
[0275] For evaluation of T cell immune responses against CMV-pp65, splenocytes were harvested, stained with APC-conjugated anti-human CD3 and sorted using a XDP cell sorter (Beckman Coulter). Human CD3.sup.+ cells were activated by human anti-CD2/CD3/CD28-conjugated magnetic beads (Myltenyi Biotec) in a bead-to-cell ratio of 1:2 and cultured in X-Vivo medium in the presence of 200 ng/mL of human (IL)-2, 5 ng/mL of human IL-7 and 5 ng/mL of IL-15. T cells were further expanded by co-culture with SmyleDC in a DC-T cell ratio of 1:10 for additional 7 days. LN cells were also harvested and directly incubated with SmyleDC as described above. For CMV-specific IFN- production, expanded T cells isolated from spleen, LN or PBMC from CMV-reactive healthy donors (20.000 cells) were seeded on an anti-human IFN--coated 96-well ELISPOT plate and incubated overnight in the presence of 10 g/mL of pp65 overlapping peptide pool (Miltenyi Biotec) or no peptide. Next day, cells were washed and plates were further incubated with biotin-conjugated anti-human IFN- antibodies followed by alkaline phosphatase-conjugated streptavidine. Plates were developed using NBT/BCIP liquid substrate and analyzed in an AELVIS ELISPOT reader (AELVIS GmbH, Hannover, Germany).
Histology and Immunohistochemistry Analysis of Human Hematopoietic Cell Engraftment
[0276] LN from human HSC-reconstituted NRG or C57BL/6 wild type mice were harvested and embedded in optimal cutting temperature compound (O.C.T. Sakura Finetek, Torrance, Calif., USA) for cryopreservation. Frozen sections (5 m) were fixed by acetone and stained with monoclonal anti-human CD3 (eBioscience, San Diego, Calif., USA), anti-human Pe-Texas Red-conjugated CD8, anti human CD11c (eBioscience), APC anti-human CD19 (eBioscience), anti-mouse LYVE-1 (Dako), anti-mouse CD31 (BD Bioscience). Immunofluorescence analyses were performed in an Axiocam fluorescence microscope (Zeiss) and images created using Axiowert software (Zeiss).
Immunoglobulin Production in HSC-NRG Mice
[0277] Plasma was harvested from HSC-NRG mice 20 weeks after reconstitution and screened by ELISA for the presence of total human IgM an total human IgG as described elsewhere (Becker, Legrand et al. 2010). Total IgM and IgG determination was performed by coating 96-well plates either with AffiniPure F(ab)2 fragment goat anti-human IgM (Fc5-specific, Jackson ImmunoResearch) or AffiniPure goat anti-human IgG (Fc fragment-specific; Jackson ImmunoResearch). Control human serum protein calibrator (Dako) with known IgM (0.8 mg/ml) and IgG (10.4 mg/ml) concentrations was used as a standard to be compared to the samples. After coating, the plates were washed in ELISA wash buffer (PBS, 0.5% Tween-20), blocked with 4% of milk and further incubated with serial dilution of mouse plasma (starting at a dilution of 1:5). Enzyme-conjugated detection antibodies were added at a dilution of 1:2500 for HRP-conjugated anti-IgG and a dilution of 1:5000 for HRP-conjugated anti-IgM (both from Jackson ImmunoResearch). TMB substrate/stop solution (Biosource) was used for the development of the ELISA assay.
Analyses of Human Cytokines:
[0278] Detection of human Th1/Th2 cytokines in DC culture supernatants and mouse plasma was performed by fluorescent bead-based 14-plex Luminex assay according to the manufacturer's protocol (Millipore). The 14-plex assay measured the following cytokines GM-CSF, IL-4, TNF-, IL-6, IL-8, MCP-1, IL-10, IL-1, IL-5, IL-13, IFN-, IL-7, IL-2 and IL-12(p70). Detection of IFN- in DC supernatants and mouse plasma was performed by commercially available ELISA kit (Mabtech, Minneapolis, USA).
In Vivo Bio-Luminescence Imaging Analyses
[0279] Mice were anesthetized with ketamine (100 mg/kg intraperitoneally) and xylazine (10 mg/kg intraperitoneally), and an aqueous solution of d-luciferin (150 mg/kg intraperitoneally) was injected 5 minutes before imaging. Mice were placed into a dark chamber of the charge-coupled device camera (IVIS 200, Xenogen, Cranbury, N.J., USA), and grayscale body surface reference images (digital photograph) were taken under weak illumination. After the light source was switched off, photons emitted from luciferase-expressing cells within the animal body and transmitted through the tissue were quantified over a defined time of up to 5 minutes using the software program Living Image (Xenogen) as an overlay on Igor (Wavemetrics, Seattle, Wash., USA). For anatomical localization, a pseudocolor image representing light intensity (blue, least intense; red, most intense) was generated in Living Image and superimposed over the grayscale reference image. Quantified luminescence consists in averaged photon radiance on the surface of the animal and is expressed as photons/sec/cm.sup.2/sr where sr=steradian.
Real-Time PCR for Analyses of Lentiviral Copies in Tissues
[0280] Total genomic DNA was extracted from the spleen and lymph nodes (left and right flanks) using the QiaAmp DNA blood mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Vector derived copy numbers were determined by Quantitative real-time PCR as previously described (Maetzig T et al., 2010 and Rothe M, et al., 2012). 100 ng/2 L, of genomic DNA prepared from the above step was added to 13 L of RQ-PCR mix containing 7.5 L of SYBRTaq mix with 1 L of primer mix for wPRE (Woodchuck Hepatitis Virus post transcriptional regulatory element; wPRE forward: 5-GAGGAGTTGTGGCCCGTTGT (SEQ ID NO: 9), wPRE reverse: 5-TGACAGGTGGTGGCAATGCC (SEQ ID NO: 10) or PTBP2 (polypyrimidine tract binding protein 2); PTBP2 forward: 5-TCTCCATTCCCTATGTTCATGC (SEQ ID NO: 11), PTBP2 reverse: 5-GTTCCCGCAGAATGGTGAGGTG (SEQ ID NO: 12) adjusting the volume to 13 L with PCR grade, nuclease free water. A plasmid vector (pCR4-TOPO, kindly provided by Michael Rothe, Department of Experimental Hematology, Hannover Medical School) containing these two amplicons was used for standard curves, with known dilutions covering 4-logs. All samples were analyzed with StepOnePlus Real time PCR system (Applied Biosystems). The cycling conditions were 10 min at 95 C., 40 cycles of 15 s at 95 C., 20 s at 56 C. and 30 s at 65 C. Results were quantified by making use of primer pair-specific real-time PCR efficiencies and by comparing sample CT values to a standard curve generated with the plasmid vector (pCR4-TOPO). Data were analyzed by StepOnePlus software (Applied Biosystems).
Histological Analyses of GVHD
[0281] Representative samples from skin and intestine were harvested and routinely formalin fixed and paraffin embedded. 2 m sections were cut from the blocks and stained for HE. An experienced hematopathologist reviewed the slides blinded to the treatment group of the animals. A semiquantitative score (modified after Lerner K G et al. Transplant Proc 1974 6:367-371) was used to score the histological changes. GVHD Grade 1 is defined by single or multiple apoptotic figures without architectural changes. Grade 2 shows multiple apoptotic figures and drop out of crypts or skin appendages. Grade 3 shows additionally surface necrosis and severe loss of crypts or skin appendages.
Statistical Analysis
[0282] Parametric (t test) and non-parametric (Kruskall-Wallis) statistical analyses were performed to compare the differences among groups for engraftment of human hematopoietic lineages in NRG mice. Analyses were performed in Graph prism 5.sup.th version software. All tests were two-sided, and P<0.05 was considered significant.
Results
SmyleDC Generation and Characterization In Vitro
[0283] Gene transfer of huGM-CSF, huIFN- and the CMV-pp65 viral antigen into human monocytes using ID-LV generated long-lasting SmyleDC in vitro and in vivo (Daenthanasanmak, Salguero et al. 2012). Under these conditions, using the green fluorescent protein (GFP) as a quantitative gene reporter, we observed between 10-50% transduction efficiency. We adapted our protocol to generate DC from the CD34.sup. fraction recovered from PBMC obtained from G-CSF-mobilized HSC donors (
NRG Mice Immunization with SmyleDC/fLuc and Analyzed by Optical Imaging Show High Viability In Vivo
[0284] Day 2 SmyleDC labelled with a lentiviral vector expressing firefly luciferase were injected s.c. into NRG mice (n=7) and the bioluminescence signal was measured non-invasively on days 14, 30 and 45 post-injection. All mice showed detectable bioluminescence signals on the injection site until 45 days (
Transplantation of Human CD34.sup.+ Cells into NRG Followed by SmyleDC Immunization Results in Increased T Cell Expansion
[0285] We transferred adult human CD34.sup.+ HSC that were positively selected twice and highly pure (>99%) into sublethally irradiated four-week-old NRG mice. Ten weeks after CD34.sup.+ cell transplantation, human hematopoietic reconstitution reached plateau and became stable (2-5% of PBMC corresponding to human CD45.sup.+ cells). We did not observe statistically significant differences in the frequency human CD45.sup.+ in PBL in the different study arms prior to DC immunization (data not shown). Thus, the mice were allocated to the different immunization groups at random after HCT, receiving prime-boost immunizations of DC produced with monocytes of the same HCT donor (510.sup.5 cells) by s.c. injections into the right hind flank (
Regeneration of Lymph Nodes and Lymphatic Flow after SmyleDC Immunization
[0286] One of the most striking findings upon post-mortem analysis came from the examination of the peripheral lymph nodes in mice immunized with SmyleDC: LN were clearly visible at the inguinal, and axillary regions (
Regenerated Lymph Nodes Contain Human T and B Cells at Different Stages of Differentiation
[0287] Immunohistological analyses of LN explanted from SmyleDC-immunized mice revealed a massive infiltration of lymphocytes but only a few regions resembling the anatomy of germinal centers observed in normally developed LN obtained from wild type C57BL/6 mice (data not shown). Immunofluorescence analyses showed a predominant repopulation with human CD3.sup.+ T cells (data not shown). Human CD11c.sup.+ DCs were detected in the cortex or co-localizing with mouse lymphatic endothelial cells (LYVE-1). We also detected vessel structures positive for mouse endothelial CD31 marker (most likely high endothelial venules). Flow cytometry analyses of LN revealed human CD45.sup.+ cells (77%), CD3.sup.+ T lymphocytes (73%) and only 3.8% CD19.sup.+ B cells (
SmyleDC migrate to adjacent and distal LN
[0288] Non-invasive optical imaging analyses of the injection site from SmyleDC-immunized mice subsequently injected with SmyleDC marked with the luciferase gene revealed migration of the bioluminescence emitting cells to the region of the adjacent inguinal LN (
Increased Absolute Numbers of Human Mature T and B Cells can be Detected in Spleen of SmyleDC Immunized Mice
[0289] Twenty weeks post-HCT, SmyleDC-immunized mice showed more than 100-fold increase in the absolute numbers of human CD3.sup.+ T cells (858,487) in the spleen in comparison with non-immunized mice (p=0.0028) (
SmyleDC Immunization Induces Anti-Pp65 T Cell Immune Responses
[0290] We showed previously that immunization of NRG mice with SmyleDC prior adoptive huPBL/T cell transfer enhanced anti-pp65 specific T responses in vivo (Daenthanasanmak, Salguero et al. 2012). Here, we evaluated whether SmyleDC could stimulate endogenously developed human T cells post-HCT reactive against pp65. Human CD3.sup.+ cells were FACS-sorted from spleen or LN 20 weeks after HCT. In order to obtain enough T cell numbers for conducting the immune assays, T cells from spleens were expanded for 3 days in the presence of anti CD2/CD3/CD28-conjugated beads and further co-cultured for 7 days with SmyleDC plus cytokines (IL-2, IL-7, IL-15) (
SmyleDC Immunization Induces Immunoglobulin and Pp65-Specific Humoral Responses
[0291] We observed significant increase in the frequency of IgG memory B cells in spleens as well as generation of plasma IgM and IgG upon SmyleDC immunization in comparison with control groups, where immunoglobulin levels were close to limit of detection (
Detection of SmyleDC in Tissues of Mice by PCR.
[0292] A quantitative real time PCR method for detection of the WPRE element in the lentiviral vector was used using as a standard control a 293T cells line containing 3 copies of integrated LV sequences. Analyses of SmyleDC resulted in 7.5 copies of vector per cell. Analyses of spleen collected from NRG mice (n=4) transplanted with human CD34.sup.+ cells and immunized with SmyleDC showed 0.58+/0.49 copies per cell. Analyses of LN collected from NRG mice (n=4) transplanted with human CD34.sup.+ cells and immunized with SmyleDC showed 0.78+/0.43 copies per cell for the adjacent LN and 0.052+/0.041 copies per cell for the contralateral LN. The data confirms the migratory capacity of SmyleDC injected on the skin to local and distal LN and to the spleen (Table 2).
Discussion
[0293] This preclinical validation study to demonstrate efficacy of SmyleDC in the human HCT setting using the HIS-NRG model exceeded our expectations, as a full range of T and B cell terminal adaptive immune reconstitution effects including the development of peripheral lymph nodes were observed. Both ConvDC and SmyleDC could be produced with monocytes isolated from the G-CSF mobilized HCT donors. SmyleDC showed higher viability in vitro and persistent autocrine activation for expression of relevant immunologic cell surface markers and cytokines than ConvDC. Subcutaneous administration of SmyleDC ten weeks post-HCT and plasma analyses another 10 weeks later revealed substantially higher levels of several human cytokines (GM-CSF, IL-5, MCP-1, IFN-, IL-13, TNF-, IL-8, IL-4) than in ConvDC-immunized or control mice. This was associated with significantly higher frequencies of human T cells, higher absolute numbers of effector memory T cells and detection of terminally differentiated plasma B cells in blood, spleen and LN. Immune monitoring 20 weeks after HCT showed that these cellular effects were accompanied with pp65-specific T cell and antibody responses. Taken the data together, although immunization with ConvDC expressing pp65 showed some degree of immune modulation in comparison to non-immunized mice, the effects of SmyleDC were clearly more profound. These differences highlight the requirement of cell therapies involving post-mitotic and non-replicating antigen presenting cells to persist long enough after administration in order to efficiently signal, produce cytokines and chemokines, migrate, attract and interact with other cells of the immune system for robust antigen presentation.
[0294] These new in vivo findings in NRG mice also can lead to novel advances to improve the generation of humanized mice with a functional immune system. Although several transgenic and vaccination approaches to induce immune reconstitution in immunodeficient mice have been evaluated over the past decade, suitable in vivo experimental models to address human hematopoietic development to terminally and functionally differentiated T and B cells were lacking. In order to experimentally recapitulate human immune reconstitution after HCT in vivo, Schultz, Ishikawa and colleagues pioneered the transplantation of CD34.sup.+ HSC into different types of immunodeficient mouse strains lacking the common interleukin-2 receptor gamma chain (IL2R) (NOD/Rag1null/IL2R.sup.null-NRG, NOD/LtSz-scid/IL2R.sup.null-NSG, or NOD/SCID/IL2R.sup.null-NOG) resulting in reconstitution of human hematopoietic lineages 8 to 10 weeks after CD34.sup.+ cell transfer (Ishikawa, Yasukawa et al. 2005; Shultz, Brehm et al. 2012). However, regardless of the source of HSC and the method for cell transplantation, humanized mice displayed suboptimal levels of lymphocyte reconstitution, lack or low levels of antigen specific cellular and humoral responses and overall anergy (Lepus, Gibson et al. 2009; Andre, Erbacher et al. 2010). Factors that may impact in the inefficient lymphatic development in HIS mice include the absence of human histocompatibility molecules and a poor humanized cytokine environment. To overcome this deficiency, approaches including delivery of recombinant cytokines (Chen, Khoury et al. 2009; O'Connell, Balazs et al. 2010), transplantation of fetal lymphatic tissue along with HPCs (Biswas, Chang et al. 2011; Hu and Yang 2012) or the use of transgenic strains constitutively expressing the major histocompatibility molecules (MHC) class I (Shultz, Saito et al. 2010) and II (Danner, Chaudhari et al. 2011) or critical hematopoietic cytokines (Willinger, Rongvaux et al. 2011) have been recently described. Despite some improvement, these strategies allowed a limited improvement in B and T cell responses against human viral challenges. As consistent with previous reports regarding HCT transplantation with G-CSF-mobilized adult hematopoietic stem cells, we observed low relative frequencies of T lymphocytes in non-immunized control mice (i.e., lower than 20%) which reflected also the results obtained with ConvDC-immunization. Conversely, as also reported, the relative frequency of circulating human B cells (here defined as CD19.sup.+ cells) was commonly higher than 80% in control mice. SmyleDC/pp65 immunization resulted into a decrease of the relative B cell frequency in PBL, but was associated with an increase of the absolute B cell content in spleens and lymph nodes. Notably, the higher repopulation rate of T and B cells in these tissues, was correlated with matured phenotypes associated with immune activation. Importantly, few reports have described the presence of reconstituted lymphatic structures in HSC-transplanted mice (Sun, Denton et al. 2007; Marodon, Desjardins et al. 2009; Singh, et al. 2012).
[0295] Although human CD34.sup.+ HCT can be improved by using human cord blood or fetal liver, thereby reaching higher rates of human cell engraftment (>60%) than in our studies (using G-CSF-mobilized adult blood), reported LN structures were anecdotal or required very long periods for observation (Lang, Kelly et al. 2013). These data implicates that functional and long-lasting DC may be required after HCT for regeneration of peripheral lymph node and lymphatic flow in order to activate, mobilize, and finally mature lymphocytes towards full immune function in humanized mice. Thus, accelerating the presence of functional DC concomitantly with LN and lymphatic development in humanized mouse models may be a conditio sine qua non for using these models for predictive studies of adaptive immunity. Although early T cell development was not the focus of our efficacy studies, we predict that the higher absolute nave and memory/effector T cell counts found in spleen reflect a bona fide higher thymopoiesis in these humanized mice. Ultimately, this novel modality of human endogenously regenerated systemic lymph node (HERS-LN) will allow in the future more detailed mechanistic in vivo studies of the development of the human immune system, antigenic presentation, T and B cell terminal activation and useful interpretation of preclinical testing of HCT protocols, vaccines and immunomodulatory molecules.
[0296] Safety evaluation, up-scaling and clinical development of lentivirus-induced DC generated with single tricistronic lentiviral vectors for cancer immunotherapy is an ongoing task in our group (Pincha, Sundarasetty et al. 2012; Sundarasetty, Singh et al. 2013). Production of SmyleDC co-expressing pp65 with a single tricistronic lentiviral vector is ongoing for translation into clinical trials to immunize transplanted patients receiving stem cell grafts from CMV-seronegative donors or cord blood (Daenthasanmak, Salguero et al, in Example 3). In addition, SmyleDC/pp65 could be also explored in the future as an autologous cellular immuno therapeutic product against glioma and breast cancer, as HCMV has been recently implicated as viral target for these types of cancer.
Example 3
Aim of the Experiment
[0297] In this current study, we validated SmyleDC/pp65 generated with a preclinical single tricistronic integrase-defective lentiviral vector in vivo using two fully humanized mouse HCT models. We tested several efficacy and safety parameters and established proof of potency in irradiated NRG mice transplanted with human CD34.sup.+ stem cells (G-CSF mobilized adult HSC in comparison with neonatal UCB). We demonstrated in these predictive humanized HCT mouse models the adaptive immune effects of SmyleDC/pp65 to promote expansion of endogenously developed cytotoxic T cells and humoral immune reactivity against the HCMV pp65 antigen.
Results
Effects of Tricistronic Vector on Dendritic Cell Recovery, Viability and Identity
[0298] The tricistronic self-inactivating lentiviral vector ID-LV-G2pp65 (
Production of SmyleDC/Pp65 from Cord Blood Monocytes
[0299] A cord blood bank was set up with samples derived from human cord blood donated upon informed consent by term mothers giving birth at the Obstetrics Clinic at the Hannover Medical School. Mononuclear cells were isolated by Ficoll separation and then either frozen down and stored or preceded to CD34.sup.+ hematopoietic stem cell enrichment. Both CD34 positive and negative fractions were cryopreserved for each donor sample. CD14.sup.+ monocytes were enriched from the CD34 negative fraction by MACS. Those monocytes were transduced with virus encoding human GM-CSF-IFNa-pp65 using our previously described protocol and administered to the mice transplanted with CD34.sup.+ cells from the same donor. A fraction of the SmyleDC/pp65 cells were maintained in culture for seven days for analyses of the DC differentiation immunophenotype and expression of the pp65 antigen.
Integration Pattern of ID-LV-G2Pp65 in SmyleDC/Pp65
[0300] Although integration pattern of ID-LV sequences was previously shown in hepatocytes of mice infused with vectors (Matrai et al., 2011) and ID-LV have been explored for transduction of mouse and human DCs in vitro (Negri et al., 2012), the integration pattern of ID-LVs was not previously characterized for transduced monocytes or DCs. Although DCs are post-mitotic and non-replicating cells, a biased integration in a potentially oncogenic locus could predispose to genotoxic effects. In order to evaluate the integration pattern of the backbone LV-G2pp65 vector, SmyleDC/pp65 generated with integrase competent (IC-LV) or integrase defective (ID-LV) vectors were kept in culture for 10, 20 and 30 days and the integrated vector copies were compared. Day 10 SmyleDC/pp65 generated with IC-LV showed fourfold higher numbers of integrated copies per cell (1.2 copies per cell) than SmyleDC/pp65 generated with ID-LV (0.3 copies per cell). For both cultures, the number of integrated copies/cell continuously decreased upon further culture (day 20) and when cells reached senescence (around 30 days; IC-LV: 0.3 copies per cell; ID-LV: 0.1 copies per cell) (
HCMV Infection of SmyleDC/Pp65 does not Allow Virus Replication In Vitro
[0301] Monocyte-derived DCs are known to be susceptible to HCMV infection and, upon their differentiation into activated DCs, virus replication was observed (Riegler et al., 2000). Therefore, one important safety aspect of SmyleDC/pp65 was whether this cell product would still allow HCMV spread, for example, if produced from a HCMV sero-positive donor. To address this, different types of lentivirus-vectored DCs were compared: SmyleDC expressing GM-CSF and IFN- with SmartDC co-expressing GM-CSF and IL-4 (Daenthanasanmak et al., 2012). Dendritic cells were infected with the genetically modified viral strain HCMV-TB40/E expressing GFP at MOI of 2. Infected human fibroblasts (HF) were used as positive controls as previously described (Sinzger et al., 2008). Unstained cells are observed using fluorescence microscopy. A green fluorescent signal indicates infection of the cell. In this experiment fluorescent signals were only observed on day 10 in the SmartDCs not expressing IFN- (
Stimulation and Expansion of CTL with Autologous SmyleDC/Pp65 In Vitro
[0302] Both CD4.sup.+ T helper cells and CD8.sup.+ CTLs are required to protect individuals in controlling virus replication in primary HCMV infection (Gamadia et al., 2003) and in HCMV reactivation after HCT (Einsele et al., 2002). A 16 h IFN- catch assay based on flow cytometry analyses was used to evaluate whether SmyleDC/pp65 (harvested on day 7 after transduction) could activate both types of T cells obtained from HCMV sero-positive HD (n=3) (
[0303] In order to further define the effects of pp65 expression on the activation of antigen-specific CD8.sup.+ effector cells, we performed two sequential microculture of DCs and T cells obtained from A*02; B*07 donors (n=3, HCMV sero-positive) in order to expand CTLs in enough numbers for further functional assays (
Hematopoietic Reconstitution of NRG Mice Transplanted with Human Adult CD34.sup.+ Cells and Immunized with SmyleDC Vs. SmyleDC/Pp65
[0304] In order to demonstrate also the in vivo effects of SmyleDC/pp65 on CD8.sup.+ expansion and evaluate possible adaptive effects on B cells and humoral responses, 4 weeks-old irradiated NRG mice were transplanted with CD34.sup.+ cells that were obtained from G-CSF mobilized stem cell donors after 2 rounds of selection with magnetic beads (
Functional Human Homeostatic, T and B Cell Effects of SmyleDC/Pp65 after HCT
[0305] Besides the effects on the reconstitution of the different hematopoietic lineages, we characterized several properties of the HIS mice immunized with SmyleDC/pp65 regarding functional immune responses. Mice transplanted with PBL-CD34+ HSC and immunized with SmyleDC/pp65 showed a dramatic increase in the levels of several human cytokines that were detectable in the mice plasma (
[0306] To evaluate anti-pp65 specific T cell responses, splenocytes of mice immunized with SmyleDC/pp65 were pooled and sorted human Th cell and CTLs were non-specifically activated with CD2/CD3/CD28 beads and further expanded in vitro with SmyleDC/pp65 to allow further analyses. ELISPOT assay was used to assess anti-pp65 responses after one week stimulation. After pulsing the T cells with pp65, we observed both CD8.sup.+ and CD4.sup.+ T cell reactivity, measured as quantified IFN- positive spots, although only the CD8.sup.+ T reactivity was shown specific to pp65 as CD4.sup.+ that were not pulsed with pp65 peptide were also activated (
[0307] Another relevant immune monitoring parameter was sero-conversion in mice after HCT and immunization. Notably, several types of human immunoglobulins were detectable (IgA, IgG1, IgG2, IgG3, IgG4 and IgGM) after SmyleDC/pp65 immunization (
Hematopoietic Reconstitution of NRG Mice Transplanted with Human Cord Blood CD34.sup.+ Cells and Immunized with Different Doses of SmyleDC/Pp65
[0308] UCB is a rich source of HSC and progenitor cells at very immature stages of differentiation. Therefore, as a more stringent model to address the effects of lentivirus vectored DCs in the hematopoietic reconstitution in vivo, we used CD34.sup.+ cells isolated from UCB as a source of HSC. Generation of SmyleDC/pp65 from UCB monocytes was feasible using our standard protocol. CD34.sup.+ UCBT into NRG mice could be reproducibly established with a dose of 1.510.sup.5 cells injected i.v. into irradiated 4-weeks-old mice (
SmyleDC/Pp65 Immunization Enhances the Thymic T Cell Development
[0309] We evaluated if the expansion of mature T cells derived from the cord blood stem cell reconstitution was a peripheral extrathymic event or could have been also a consequence of SmyleDC/pp65 immunization enhancing the development of T cells in the thymus. We observed significantly higher frequencies of double positive CD4.sup.+/CD8.sup.+ and CD3.sup.+lo; TCR.sup. T cell precursors in thymus of mice immunized with SmyleDC/pp65 (2) (
SmyleDC/Pp65 Immunization Enhances the Thymic T Cell Development
[0310] To evaluate the impact of SmyleDC/pp65 in the T cell lineages implicated with tolerance, we examined the frequencies of CD4.sup.+FoxP3.sup.+CD25.sup.+CD127.sup. regulatory T cells (Tregs). Although SmyleDC/pp65 immunization improved reconstitution of mature and functional human CTL and humoral responses after UCBT, a modest but noticeable expansion of regulatory CD4.sup.+FoxP3.sup.+CD25.sup.+CD127.sup. T cells was also observed. Notably, 4 SmyleDC/pp65 immunization augmented their frequency in blood (6.7%; 4 SmyleDC/pp65 vs. control, p=0.06,
No Signs or Mild, Grade 1 GVHD in NRG Mice Reconstituted with Functional Human Immune System
[0311] When reconstituting a fully functional human immune system in a mouse after xenogeneic transplantation of hematopoietic stem cells, graft-versus-host disease of the mouse is a concern. After all, the HLA molecules of the recipient are not matched to those of the donor at all. For this reason, animals which were used in the examples described above were assessed for signs and symptoms of GVHD. Assessment was based on anatomic features such as inflammation of the gut and/or the frequency of regulatory immune cells. The anatomic assessment was done by an experienced pathologist. The results of the assessment are summarized in the Table 3.
[0312] The results indicate that the reconstituted human immune system did not cause moderate or severe signs of GVHD in mice even though it was in other respects functional. Thus, the use of the iDCs of the present invention for assisting the reconstitution of a functional immune system in a recipient after hematopoietic stem cell transplantation has the potential to induce tolerance of the transplanted immune system for the tissue of the recipient. Given the fact that leukocyte antigens between mice and humans differ more that the HLA molecules of different humans, the use of the iDCs of the present invention, thus, has the potential to allow allogeneic HSC transplantation using donors which do not meet the matching criteria which are presently applied to minimize GVDH after transplantation. This use of iDCs has the potential to significantly widen the range of potential donors for a given patient and, thus, find donors for recipients with rare combinations of HLA-molecules.
Discussion
[0313] Transplant of allogeneic HSC is a validated therapeutic option for patients with high-risk hematological malignancies, but HCMV infections pose a significant risk on survival. Our results show that the tricistronic ID-LV encoding GM-CSF, IFN- and the HCMV pp65 antigen under the control of the early CMV promoter can reprogram at high efficiency human CD14.sup.+ monocytes from peripheral blood from G-CSF mobilized donors and cord blood. A single overnight exposure of monocytes to the ID-LV vector drives their self-differentiation into DCs that are maintained autonomously for seven days with high viability, immunologic properties (expression of MHC II, co-stimulatory molecules and inflammatory of cytokines) and constitutive expressing of GM-CSF, IFN- and pp65. Although it has been previously reported that ectopic expression of pp65 could inhibit IFN signaling (Browne and Shenk, 2003), we did not observe a detrimental effect of pp65 expressed in cis in the tricistronic vector, supporting our previous studies where pp65 was co-expresses in trans, using two vectors for DC reprogramming (Daenthanasanmak et al., 2012; Salguero et al., 2011).
[0314] Transduction of monocytes with ID-LV at MOI of 5 resulted into less than 0.3 copies of vector per cells and analyses of the integration pattern showed high polyclonality and no bias for previously described proto-oncogenic clusters. Integration of ID-LV into the GOLGA7 cluster region seemed to be the most frequent hot spot, which may reflect an active transcriptional region in activated monocytes in their process to differentiate into activated dendritic cells. GOLGA7 is an ubiquitously expressed protein and functions as a palmitoylation enzyme for shuttling proteins from the Golgi to the plasma membrane (Ohta et al., 2003). GOLGA7 gene expression is increased in activated DCs (Cuiffo and Ren, 2010; Li et al., 2000). During DC and B cell activation, MHCII is actively externalized from internal vesicles to the plasma membrane and GOLGA7 may have an important role in the protein shuttling through the Golgi apparatus. GOLGA7 is located in chromosome 8 in a region associated with trisomy mosaicism in myelomonocytic leukemia (Ripperger et al., 2011) but is not known to be proto-oncogenic. However, it remains to be elucidated mechanistically why the IC-LV did not show the same preferential integration site, indicating that recombination and eventual integration of the ID-LV in the genome of activated monocytes may be more biased than IC-LV for highly transcribed open genomic regions. Nevertheless, both types of lentivirus-vectored DCs did not show integrations in the most known hot spots characterized in preclinical studies of lentiviral vectors used to genetically modify hematopoietic stem cells (KDM2A, PACS1 and TNRC6C) (Aiuti et al., 2013). This reflects the behavior of HIV-1 to integrate into chromatin regions actively being transcribed, which will depend on the cell type and activation stimulus.
[0315] As a potential safety concern, we examined if SmyleDC/pp65 could spread HCMV, because it was reported that dendritic cells derived in vitro from CD34.sup.+ and CD14.sup.+ progenitors were highly susceptible and permissive to the complete replicative cycle of HCMV (Hertel et al., 2003; Riegler et al., 2000). Our in vitro infection studies with the endotheliotropic strain TB40/E-GFP indicated that high expression of IFN- by SmyleDC may inhibit viral replication, as SmartDC expressing IL-4 was more susceptible for HCMV infection and caused HCMV spread. Notably, exposure of SmyleDC and SmyleDC/pp65 to HCMV in vitro resulted in up-regulation of CD80, which is a critical co-stimulatory molecule to co-activate T cells, suggesting that constitutive IFN- also precluded potential HCMV immune suppressive effects on these DCs.
[0316] Clinically, pp65-specific CD4.sup.+ and CD8.sup.+ T cells were demonstrated to play a critical role in HCMV clearance. From our results, we observed a clear effect of endogenously expressed pp65 in the vectored DC for stimulation of CD4.sup.+ and CD8.sup.+ T cell responses in vitro, which was detected by up-regulation of IFN- intracellular staining and expansion of T cells with TCRs reactive against pp65 immune dominant epitopes. Moreover, expanded pp65-specific CD8.sup.+ T cells exhibited superior cytolytic activity against target cells expressing pp65 antigen.
[0317] In addition to strong antigenic stimulations in vitro, SmyleDC/pp65 accelerated the hematopoietic reconstitution in HCT and UCBT humanized mouse models. Similar to our results in vitro, expression of the pp65 antigen by the DCs used for immunization produced quantitative and/or qualitative higher frequencies of human effector CTLs in blood and spleen. After SmyleDC/pp65 immunization, T cells that developed de novo in thymus and bio-distributed to several tissues became predominantly memory T cells, whereas in the absence of antigen (SmyleDC immunization after HCT), we observed predominantly expansion of the nave CTL subset in the blood. It is not clear what drove the differentiation of the populations of effector memory CTLs observed in spleen and bone marrow of SmyleDC vaccinated mice. They could represent T cells reactive to mouse xeno-antigens, as were also observed in non-immunized mice after PBL-HCT (see example 2). One of the limitations in immune reconstitution of humanized models after HCT is the poor reconstitution of mature B cells and lack of Ig class switching. Remarkably, IgM, IgG and IgA were detected at high levels in mice immunized with SmyleDC/pp65 after HCT (but not with SmyleDC), supporting the concept that pp65 antigen may influence the maturation of B cells for Ig class switching. Studies in humanized mice demonstrated that B cell maturation was correlated with development of effector T cells (Lang et al., 2013). Thus, expansion of pp65-specific CD4.sup.+ T cells driven by SmyleDC/pp65 group may provide critical maturation factors such as CD40L that are required for B cell maturation, Ig class switch and secretion of antigen-specific specific antibodies. Several efforts have been made to improve adaptive immune responses in HIS mice, such as delivering of recombinant cytokines as GM-CSF and IL-4 (Chen et al., 2012) or transgenic expression of HLA class I or II (Jaiswal et al., 2012; Suzuki et al., 2012). SmyleDC/pp65 may fulfill several of these requirements as it is fully HLA-matched with the transplanted HSC, expresses a wide array of cytokines and provides a potent antigenic signal.
[0318] For human young patients, T cell immune reconstitution following lymphodepletion can occur through active thymopoiesis, but for elder adults, it primarily occurs through homeostatic proliferation of peripherally expanded clones (Williams et al., 2007). Homeostatic proliferation results is a rapid and significant expansion of the peripheral T cell pool, and is dependent upon both homeostatic cytokines and antigen-driven responses in the period following lymphopenia (Williams et al., 2007). Although several vaccine candidates against HCMV are currently being evaluated in clinical trials, a personalized vectored dendritic cell vaccine that is highly viable, can be potentially produced in large scale and provides both antigenic and homeostatic immune reconstitution is a promising clinical innovation to lower mortality and morbidity after HCT and UCBT.
[0319] Increasing pathological and clinical evidences indicated that HCMV may be an etiologic agent in malignancies such as glioma and breast cancer (Soderberg-Naucler et al., 2013; Taher et al., 2013). Although infection of malignant hematopoietic cells with HCMV has not been reported, HCMV positive serostatus of the HCT recipient or donor negatively impacts on survival of acute leukemia patients (particularly acute lymphoblastic leukemia) (Schmidt-Hieber et al., 2013b). Moreover, acute myeloid leukemia patients with HCMV reactivation early after HCT showed lower relapse risk, suggesting either a putative virus-versus-leukemia effect (Elmaagacli, 2013; Green et al., 2013) or that HCMV maybe also an etiologic agent increasing leukemia relapse. Thus, immunization to control HCMV after HCT might be also explored with the rationale to improve graft-versus-leukemia and lower leukemia relapse rates. Therefore, up-scaling the virus production and validation of SmyleDC/pp65 production under good manufacturing practices (GMP) are undergoing developments for future immunotherapy clinical trials against high risk acute leukemia.
Materials and Methods
Plasmid Construction and Integrase-Defective Lentiviral Vector (ID-LV) Production
[0320] The lentiviral backbone vector RRL was kindly provided by Prof. Luigi Naldini (Univ. Milan). The construction of vectors RRL-cPPT-CMVp-GM-CSF-P2A-IFN- (LV-G2) and RRL-cPPT-CMVp-pp65 (65 kDa) was previously described (Daenthanasanmak et al., 2012). For the generation of LV-GM-CSF-P2A-IFN--F2A-pp65 (LV-G2-pp65), overlapping-PCR was performed using cDNAs of human GM-CSF-IFN- and pp65 as templates interspaced with a 2A element of foot and mouth disease virus (F2A). The strategy of LV construction with F2A element was previously described (Szymczak and Vignali, 2005). Primers used to generate the interspacing F2A element between IFN- and pp65 were:
TABLE-US-00001 F2A/pp65Forward5- (SEQIDNO:7) CCGGTGAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCGGGAGACGT GGAGTCCAACCCAGGGCCCATGGAGTCGCGCGGTCGCCGTTG-3 and F2A/IFN- Reverse:5- (SEQIDNO:8) TGGGTTGGACTCCACGTCTCCCGCCAACTTGAGAAGGTCAAAATTCAAAG TCTGTTTCACCGGTTCCTTACTTCTTAAACTTTCTTGCA-3.
The PCR products were digested with restriction enzymes XbaI and ClaI and inserted into the multiple cloning site of RRL-cPPT-CMVp-MCS vector. The structural integrity of all constructs was confirmed by restriction digestion and sequencing analyses. Large scale lentivirus production was performed by transient co-transfection of human embryonic kidney 293T cells as formerly described (Stripecke, 2009). Generation of ID-LVs was performed by using the combination of the backbone vector with the following packaging plasmids in the co-transfection: a plasmid expressing gag/pol containing a D64V point mutation (kindly provided by Prof. Axel Schambach, Hannover Medical School) and a plasmid expressing rev and a plasmid encoding the VSV-G envelope.
Generation of Lentivirus Vectored DCs with ID-LVs
[0321] Peripheral blood mononuclear cells (PBMCs) obtained from HLA-A*02.01/HLA-B*07.02 positive HCMV-reactive adult healthy volunteers, leukapheresis obtained form G-CSF mobilized donors and umbilical cord blood were obtained in accordance with study protocols approved by the Hannover Medical School Ethics Review Board. Generation of lentivirus-induced DCs from CD14.sup.+ monocytes was previously described (Daenthanasanmak et al., 2012). Briefly, CD14.sup.+ was isolated from PBMCs using CD14 isolation beads (Miltenyi Biotech, Bergisch-Gladbach, Germany). The monocytes were pre-conditioned with recombinant human GM-CSF and IL-4 (50 ng/ml each, Cellgenix, Freiburg, Germany) for 8 h prior to transduction. 2.5 g/mL p24 equivalent of ID-LV-G2/pp65 was used to transduced 510.sup.6 monocytes at the multiplicity of infection (MOI) of 5 in the presence of 5 g/ml protamine sulfate (Valeant, Dusseldorf, Germany) for 16 h. After transduction, the cells were washed twice with phosphate-buffered saline (PBS) and further maintained in culture with serum-free X-vivo medium (Lonza) or used directly for mice immunizations.
Analyses of Cytokines and Transgene Expression
[0322] The detection of HCMV pp65 protein in 293T cell lysates and supernatants was determined by Western blot analysis (Bio-Rad, Munich, Germany). For intracellular pp65 expression in SmyleDC/pp65 was performed by intracellular staining and flow cytometry, previously described (Daenthanasanmak et al., 2012). SmyleDCs were first stained for DC surface antigens with the combination of monoclonal antibodies anti-human CD14, HLA-DR, HLA-ABC, CD80, CD86, CD83, CD11c and CD123 followed by fixing and permeabilization with BD cytofix/cytoperm solution (Becton Dickinson GmbH, Heidelberg, Germany) and incubated with FITC conjugated mouse monoclonal antibody against HCMV-pp65 (Pierce Biotechnology, Rockford, USA). The analysis was performed with FACS Calibur apparatus (Becton Dickinson) using CellQuest software. Detection of cytokines in cell supernatants of SmyleDC cultures was performed by multiplex luminex bead kit used according to the manufacturer's instructions (Milliplex Milipore, Billerica, USA).
Integration Analysis
[0323] SmyleDC/pp65 generated from IC-LV and ID-LV kept in culture for 10, 20 and 30 days were evaluated for virus copy number and integration site analysis with LAM-PCR method as previously describes (Schmidt et al., 2007). Number of integrated LV copy was quantified by qPCR.
HCMV-TB40/E GFP Infection and Plaque Assay
[0324] The HCMV TB40/E GFP strain was propagated as previously described (Sinzger et al., 2008) and the viral titer was 1.7510.sup.7 pfu/ml. Each type of target DCs was seeded at 510.sup.5 cells well in six wells for each time point (0, 2, 4, 6, 8 and 10 days post infection, d.p.i.). Human fibroblasts (HF) were used as a positive control. DCs and HF cells were infected with HCMV (at MOI of 2 and 1) for 24 h. After infection, cells were washed with PBS and kept in cultures with DMEM supplemented with 10% FBS and 1% Penicillin and Streptomycin. Infected cells were harvested at each time point for GFP analyses and PE-conjugated anti-human CD80 was used for surface staining of DCs. After washing, cells were fixed in 1% paraformaldehyde and analyzed by flow cytometry. For plaque forming assays, cell supernatants were collected at each time point and 100 l of undiluted and diluted (20 l in 10 fold serial dilutions) of DC supernatants were added to monolayer HF cells seeded in 48 well plates. Two duplicate wells were set up for each supernatant and each time point. After 2 hours incubation, 500 l of carboxymethylcellulose was added to ensure that infection will only be possible from cell to cell. Number of plaques was analyzed after 4 to 10 days post infection. Giemsa staining was used to stain plaques on day 10 for confirmation of plaques numbers. Titers (pfu/ml) were calculated from mean value of plaque numbers counted from duplicate wells x dilution factor/volume of dilution (0.1 ml).
Analyses of Pp65-Reactive T Cells Stimulated In Vitro
[0325] Autologous CD3.sup.+ and CD8.sup.+ T cells were isolated from PBMC using the MACS system following the manufacturer's protocol (Miltenyi Biotec). For IFN- intracellular staining analysis of T cells stimulated for 16 h with 10 g/ml PepTivator CMV-pp65 overlapping peptide pool (Miltenyi Biotec) or with DCs by T cells were harvested, stained with APC-conjugated anti-human CD3, PB-conjugated anti-human CD4 and PCy7-conjugated anti-human CD8 antibodies. After fixation/permeabilization with Cyofix/perm (BD) for 20 min at 4 C. and washing, anti-human IFN (ebioscience) was used for staining for 30 min. The cells were acquired and analyzed by flow cytometry using LSRII (Beckman Coulter). For the microculture expansion system, SmyleDC or SmyleDC/pp65 (day 7) were co-cultured with autologous isolated CD8.sup.+ T cells in 96-well-plates at ratio of 1:10 (APC: T-cell) in X-vivo medium supplemented with 5% human AB serum. Gamma-irradiated autologous CD8.sup. feeder cells (210.sup.5) were added per microculture. After 3 days, the cells were replenished on alternate days with IL-2 (20 IU/ml) (Novartis Pharma GmbH, Germany) IL-7 and IL-15 (5 ng/ml each, Cellgenix, Gladbach, Germany). For re-stimulation after 7 days, cryopreserved DCs were thawed and added to T cells at 1:10 ratio. Re-stimulated T cells were harvested, counted and analyzed for pp65-reactivity by tetramer staining. PE-conjugated tetramers (HLA-A*0201-NLVPMVATV, pp65 amino acids (aa) 495-503; HLA-B*0702-TPRVTGGGAM, pp65 aa 417-426; Beckman Coulter), APC-conjugated anti-human CD3, PB-conjugated anti-human CD4 and PCy7-conjugated anti-human CD8 were used.
Hematopoietic Stem Cell Transplantation into Immune Deficient NRG Mice
[0326] Breeding pairs of NOD.Cg-Rag1.sup.tmlMomIl2rg.sup.tmlWjl (NOD;Rag1.sup./;IL-2r.sup./, NRG) mice were bred and maintained under pathogen free conditions in an IVC system (BioZone, United Kingdom). All procedures involving mice were reviewed and approved by the Lower Saxony and followed the guidelines provided by the Animal Facility at the Hannover Medical School. 510.sup.5 human CD34.sup.+ stem cells isolated with MACS system from G-CSF mobilized donor or 1.510.sup.5CD34.sup.+ cells from cord blood were transplanted into 4 weeks-old irradiated NRG mice via tail vein. At weeks 6/7 and 10/11 after transplantation, mice were vaccinated as prime/boost with 510.sup.5 autologous SmyleDC or SmyleDC/pp65 by subcutaneous injection on the hind flanks. Peripheral blood was collected form each mouse at week 10, before immunization, for baseline flow cytometry analyses. Mice were sacrificed at week 20 for collection of blood, plasma, spleen and bone marrow. PBL samples were treated twice with erythrocyte lysis buffer (0.83% ammonium chloride/20mMHepes, pH 7.2) for 5 min, washed with PBS and stained with human antibodies PB-conjugated anti-CD45, APC-conjugated anti-CD3, Alexa700-conjugated anti-CD19, APHCy7-conjugated anti-CD4, PCy7-conjugated anti-CD8, FITC-conjugated anti-CD45RA, PCy5-conjugated anti-CD62L. T cell subpopulations were defined by cells positive for CD45RA.sup.+CD62L.sup.+ are nave cells (N), T Central Memory (TCM, CD45RA.sup.CD62L.sup.) and T Effector Memory (TEM, CD45RA.sup. CD62L.sup.+). Analyses were performed in a FACS LSRII flow cytometer (Becton Dickinson) using Flowjo software. For T cell effector function assays, human CD4.sup.+ and CD8.sup.+ T cells were sorted from splenocytes with a Moflo apparatus (Becton Dickinson); sorted CD4.sup.+ or CD8.sup.+ splenocytes obtained from mice (n=3) were pooled and stimulated with CD2/CD3/CD28 beads (T cell activation kit, Miltenyi Biotec) for 48 h prior to 7-day in vitro stimulation with SmyleDC/pp65. 50,000 T cells were harvested and seeded per well on IFN- antibody-coated ELISPOT plate and pulsed with pp65 peptide pool overnight. The plates were developed as described by the manufacturer (Mabtech, Germany). Cells not pulsed with peptides were used as controls. Level of cytokines and immunoglobulins (IgA, IgM, IgG1, IG2, IgG3 and IgG4) in mice plasma were quantified with bead array according to the manufacturer's protocol (Milliplex Milipore, Billerica, USA). For analyses of Treg frequency, mononuclear cells were initially stained for surface markers with PB-conjugated anti-CD45, FITC-conjugated anti-CD3, Alexa700-conjugated anti-CD4, APC-conjugated anti-CD127, PCy7-conjugated anti-CD25. After fixation/permeabilization with Foxp3 fix/perm buffer (ebioscience) for 30 min at 4 C. followed by washing, PE-conjugated anti-Foxp3 was used for 30 min staining followed by washing and further proceeded for cell acquisitions.
Analyses of Thymus
[0327] Thymuses were harvested and single cell suspensions were subsequently stained with PB-conjugated anti-CD45, FITC-conjugated anti-CD3, A700-conjugated anti-CD4, APC-conjugated anti-CD3, FITC-conjugated anti-TCR and FITC-conjugated anti-TCR followed by washing and analyzed by LSRII flow cytometry. Analyses of T cells at different stages of development in thymus. DP: CD45.sup.+/CD4.sup.+/CD8.sup.+, CD4SP: CD45.sup.+/CD4.sup.+/CD8.sup., CD8SP: CD45.sup.+/CD4.sup./CD8.sup.+ CD3.sup.lo: CD45.sup.+/TCR.sup./TCR.sup. CD3.sup.hi: CD45.sup.+/TCR.sup.+, CD3.sup.hi: CD45.sup.+/TCR.sup.+ analyses were performed using FloJo (Tree Star Inc., Ashland, Oreg.) software.
Statistical Analysis
[0328] Non-parametric Man Whitney T test statistical analysis was used for determining statistical significance. All tests were one-sided, and P<0.05 was considered significant. Data was analyzed with GraphPad Prism 5 software (San Diego, Calif., USA).
REFERENCES
[0329] Aiuti, A., Biasco, L., Scaramuzza, S., Ferrua, F., Cicalese, M. P., Baricordi, C., Dionisio, F., Calabria, A., Giannelli, S., Castiello, M. C., et al. (2013). Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science 341, 1233151. [0330] Boeckh, M., and Geballe, A. P. (2011). Cytomegalovirus: pathogen, paradigm, and puzzle. The Journal of clinical investigation 121, 1673-1680. [0331] Boeckh, M., and Nichols, W. G. (2004). The impact of cytomegalovirus serostatus of donor and recipient before hematopoietic stem cell transplantation in the era of antiviral prophylaxis and preemptive therapy. Blood 103, 2003-2008. [0332] Browne, E. P., and Shenk, T. (2003). Human cytomegalovirus UL83-coded pp65 virion protein inhibits antiviral gene expression in infected cells. Proceedings of the National Academy of Sciences of the United States of America 100, 11439-11444. [0333] Chen, Q., He, F., Kwang, J., Chan, J. K., and Chen, J. (2012). GM-CSF and IL-4 stimulate antibody responses in humanized mice by promoting T, B, and dendritic cell maturation. J Immunol 189, 5223-5229. [0334] Cuiffo, B., and Ren, R. (2010). Palmitoylation of oncogenic NRAS is essential for leukemogenesis. Blood 115, 3598-3605. [0335] Daenthanasanmak, A., Salguero, G., Borchers, S., Figueiredo, C., Jacobs, R., Sundarasetty, B. S., Schneider, A., Schambach, A., Eiz-Vesper, B., Blasczyk, R., et al. (2012). Integrase-defective lentiviral vectors encoding cytokines induce differentiation of human dendritic cells and stimulate multivalent immune responses in vitro and in vivo. Vaccine 30, 5118-5131. [0336] Einsele, H., Roosnek, E., Rufer, N., Sinzger, C., Riegler, S., Loffler, J., Grigoleit, U., Moris, A., Rammensee, H. G., Kanz, L., et al. (2002). Infusion of cytomegalovirus (CMV)-specific T cells for the treatment of CMV infection not responding to antiviral chemotherapy. Blood 99, 3916-3922. [0337] Elmaagacli, A. H. (2013). CMV and relapseWhat has conditioning to do with it? Biology of blood and marrow transplantation: journal of the American Society for Blood and Marrow Transplantation. [0338] Feuchtinger, T., Opherk, K., Bicanic, O., Schumm, M., Grigoleit, G. U., Hamprecht, K., Jahn, G., Handgretinger, R., and Lang, P. (2010). Dendritic cell vaccination in an allogeneic stem cell recipient receiving a transplant from a human cytomegalovirus (HCMV)-seronegative donor: induction of a HCMV-specific T(helper) cell response. Cytotherapy 12, 945-950. [0339] Gamadia, L. E., Remmerswaal, E. B., Weel, J. F., Bemelman, F., van Lier, R. A., and Ten Berge, I. J. (2003). Primary immune responses to human CMV: a critical role for IFN-gamma-producing CD4+ T cells in protection against CMV disease. Blood 101, 2686-2692. [0340] Gluckman, E., Broxmeyer, H. A., Auerbach, A. D., Friedman, H. S., Douglas, G. W., Devergie, A., Esperou, H., Thierry, D., Socie, G., Lehn, P., et al. (1989). Hematopoietic reconstitution in a patient with Fanconi's anemia by means of umbilical-cord blood from an HLA-identical sibling. The New England journal of medicine 321, 1174-1178. [0341] Green, M. L., Leisenring, W. M., Xie, H., Walter, R. B., Mielcarek, M., Sandmaier, B. M., Riddell, S. R., and Boeckh, M. (2013). CMV reactivation after allogeneic HCT and relapse risk: evidence for early protection in acute myeloid leukemia. Blood 122, 1316-1324. [0342] Griffiths, P. D., Stanton, A., McCarrell, E., Smith, C., Osman, M., Harber, M., Davenport, A., Jones, G., Wheeler, D. C., O'Beirne, J., et al. (2011). Cytomegalovirus glycoprotein-B vaccine with MF59 adjuvant in transplant recipients: a phase 2 randomised placebo-controlled trial. Lancet 377, 1256-1263. [0343] Grigoleit, G. U., Kapp, M., Hebart, H., Fick, K., Beck, R., Jahn, G., and Einsele, H. (2007). Dendritic cell vaccination in allogeneic stem cell recipients: induction of human cytomegalovirus (HCMV)-specific cytotoxic T lymphocyte responses even in patients receiving a transplant from an HCMV-seronegative donor. The Journal of infectious diseases 196, 699-704. [0344] Hertel, L., Lacaille, V. G., Strobl, H., Mellins, E. D., and Mocarski, E. S. (2003). Susceptibility of immature and mature Langerhans cell-type dendritic cells to infection and immunomodulation by human cytomegalovirus. Journal of virology 77, 7563-7574. [0345] Hervas-Stubbs, S., Perez-Gracia, J. L., Rouzaut, A., Sanmamed, M. F., Le Bon, A., and Melero, I. (2011). Direct effects of type I interferons on cells of the immune system. Clinical cancer research: an official journal of the American Association for Cancer Research 17, 2619-2627. [0346] Jaiswal, S., Pazoles, P., Woda, M., Shultz, L. D., Greiner, D. L., Brehm, M. A., and Mathew, A. (2012). Enhanced humoral and HLA-A2-restricted dengue virus-specific T-cell responses in humanized BLT NSG mice. Immunology 136, 334-343. [0347] Kharfan-Dabaj a, M. A., Boeckh, M., Wilck, M. B., Langston, A. A., Chu, A. H., Wloch, M. K., Guterwill, D. F., Smith, L. R., Rolland, A. P., and Kenney, R. T. (2012). A novel therapeutic cytomegalovirus DNA vaccine in allogeneic haemopoietic stem-cell transplantation: a randomised, double-blind, placebo-controlled, phase 2 trial. The Lancet infectious diseases 12, 290-299. [0348] Lang, J., Kelly, M., Freed, B. M., McCarter, M. D., Kedl, R. M., Torres, R. M., and Pelanda, R. (2013). Studies of lymphocyte reconstitution in a humanized mouse model reveal a requirement of T cells for human B cell maturation. J Immunol 190, 2090-2101. [0349] Li, N., Huang, X., Zhao, Z., Chen, G., Zhang, W., and Cao, X. (2000). Identification and characterization of a novel gene KE04 differentially expressed by activated human dendritic cells. Biochemical and biophysical research communications 279, 487-493. [0350] Lilja, A. E., and Mason, P. W. (2012). The next generation recombinant human cytomegalovirus vaccine candidates-beyond gB. Vaccine 30, 6980-6990. [0351] Matrai, J., Cantore, A., Bartholomae, C. C., Annoni, A., Wang, W., Acosta-Sanchez, A., Samara-Kuko, E., De Waele, L., Ma, L., Genovese, P., et al. (2011). Hepatocyte-targeted expression by integrase-defective lentiviral vectors induces antigen-specific tolerance in mice with low genotoxic risk. Hepatology 53, 1696-1707. [0352] McGoldrick, S. M., Bleakley, M. E., Guerrero, A., Turtle, C. J., Yamamoto, T. N., Pereira, S. E., Delaney, C. S., and Riddell, S. R. (2013). Cytomegalovirus-specific T cells are primed early after cord blood transplant but fail to control virus in vivo. Blood 121, 2796-2803. [0353] Milano, F., Pergam, S. A., Xie, H., Leisenring, W. M., Gutman, J. A., Riffkin, I., Chow, V., Boeckh, M. J., and Delaney, C. (2011). Intensive strategy to prevent CMV disease in seropositive umbilical cord blood transplant recipients. Blood 118, 5689-5696. [0354] Moutaftsi, M., Mehl, A. M., Borysiewicz, L. K., and Tabi, Z. (2002). Human cytomegalovirus inhibits maturation and impairs function of monocyte-derived dendritic cells. Blood 99, 2913-2921. [0355] Negri, D. R., Rossi, A., Blasi, M., Michelini, Z., Leone, P., Chiantore, M. V., Baroncelli, S., Perretta, G., Cimarelli, A., Klotman, M. E., et al. (2012). Simian immunodeficiency virus-Vpx for improving integrase defective lentiviral vector-based vaccines. Retrovirology 9, 69. [0356] Ohta, E., Misumi, Y., Sohda, M., Fujiwara, T., Yano, A., and Ikehara, Y. (2003). Identification and characterization of GCP16, a novel acylated Golgi protein that interacts with GCP170. The Journal of biological chemistry 278, 51957-51967. [0357] Riegler, S., Hebart, H., Einsele, H., Brossart, P., Jahn, G., and Sinzger, C. (2000). Monocyte-derived dendritic cells are permissive to the complete replicative cycle of human cytomegalovirus. The Journal of general virology 81, 393-399. [0358] Ripperger, T., Tauscher, M., Praulich, I., Pabst, B., Teigler-Schlegel, A., Yeoh, A., Gohring, G., Schlegelberger, B., Flotho, C., Niemeyer, C. M., et al. (2011). Constitutional trisomy 8p11.21-q11.21 mosaicism: a germline alteration predisposing to myeloid leukaemia. British journal of haematology 155, 209-217. [0359] Salguero, G., Sundarasetty, B. S., Borchers, S., Wedekind, D., Eiz-Vesper, B., Velaga, S., Jirmo, A. C., Behrens, G., Warnecke, G., Knofel, A. K., et al. (2011). Preconditioning therapy with lentiviral vector-programmed dendritic cells accelerates the homeostatic expansion of antigen-reactive human T cells in NOD.Rag1/.IL-2rgammac/ mice. Human gene therapy 22, 1209-1224. [0360] Sanchez, V., Greis, K. D., Sztul, E., and Britt, W. J. (2000). Accumulation of virion tegument and envelope proteins in a stable cytoplasmic compartment during human cytomegalovirus replication: characterization of a potential site of virus assembly. Journal of virology 74, 975-986. [0361] Schmidt-Hieber, M., Labopin, M., Beelen, D., Volin, L., Ehninger, G., Finke, J., Socie, G., Schwerdtfeger, R., Kroger, N., Ganser, A., et al. (2013a). CMV serostatus has still an important prognostic impact in de novo acute leukemia patients after allogeneic stem cell transplantation: a report from the acute leukemia working party of EBMT. Blood. [0362] Schmidt-Hieber, M., Labopin, M., Beelen, D., Volin, L., Ehninger, G., Finke, J., Socie, G., Schwerdtfeger, R., Kroger, N., Ganser, A., et al. (2013b). CMV serostatus still has an important prognostic impact in de novo acute leukemia patients after allogeneic stem cell transplantation: a report from the Acute Leukemia Working Party of EBMT. Blood 122, 3359-3364. [0363] Schmidt, M., Schwarzwaelder, K., Bartholomae, C., Zaoui, K., Ball, C., Pilz, I., Braun, S., Glimm, H., and von Kalle, C. (2007). High-resolution insertion-site analysis by linear amplification-mediated PCR (LAM-PCR). Nature methods 4, 1051-1057. [0364] Sinzger, C., Hahn, G., Digel, M., Katona, R., Sampaio, K. L., Messerle, M., Hengel, H., Koszinowski, U., Brune, W., and Adler, B. (2008). Cloning and sequencing of a highly productive, endotheliotropic virus strain derived from human cytomegalovirus TB40/E. The Journal of general virology 89, 359-368. [0365] Soderberg-Naucler, C., Rahbar, A., and Stragliotto, G. (2013). Survival in patients with glioblastoma receiving valganciclovir. The New England journal of medicine 369, 985-986. [0366] Steinman, R. M. (2012). Decisions about dendritic cells: past, present, and future. Annual review of immunology 30, 1-22. [0367] Stripecke, R. (2009). Lentiviral vector-mediated genetic programming of mouse and human dendritic cells. Methods Mol Biol 506, 139-158. [0368] Sung, H., and Schleiss, M. R. (2010). Update on the current status of cytomegalovirus vaccines. Expert review of vaccines 9, 1303-1314. [0369] Suzuki, M., Takahashi, T., Katano, I., Ito, R., Ito, M., Harigae, H., Ishii, N., and Sugamura, K. (2012). Induction of human humoral immune responses in a novel HLA-DR-expressing transgenic NOD/Shi-scid/gammacnull mouse. International immunology 24, 243-252. [0370] Szymczak, A. L., and Vignali, D. A. (2005). Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert opinion on biological therapy 5, 627-638. [0371] Taher, C., de Boniface, J., Mohammad, A. A., Religa, P., Hartman, J., Yaiw, K. C., Fri sell, J., Rahbar, A., and Soderberg-Naucler, C. (2013). High prevalence of human cytomegalovirus proteins and nucleic acids in primary breast cancer and metastatic sentinel lymph nodes. PloS one 8, e56795. [0372] Verdijk, P., Aarntzen, E. H., Lesterhuis, W. J., Boullart, A. C., Kok, E., van Rossum, M. M., Strijk, S., Eijckeler, F., Bonenkamp, J. J., Jacobs, J. F., et al. (2009). Limited amounts of dendritic cells migrate into the T-cell area of lymph nodes but have high immune activating potential in melanoma patients. Clinical cancer research: an official journal of the American Association for Cancer Research 15, 2531-2540. [0373] Wendland, M., Willenzon, S., Kocks, J., Davalos-Misslitz, A. C., Hammerschmidt, S. I., Schumann, K., Kremmer, E., Sixt, M., Hoffmeyer, A., Pabst, O., et al. (2011). Lymph node T cell homeostasis relies on steady state homing of dendritic cells. Immunity 35, 945-957. [0374] Williams, K. M., Hakim, F. T., and Gress, R. E. (2007). T cell immune reconstitution following lymphodepletion. Seminars in immunology 19, 318-330.
TABLE-US-00002 TABLE 2 PCR detection of lentiviral sequences, copies/cell Right lymphnode, draining injection Left lymph node, Spleen site contralateral side Mouse 1 0 0.036 0.003 Mouse 2 0.226 1.58 0.178 Mouse 3 0.035 1.48 0.009 Mouse 4 2.06 0.03 0.02 Mean SEM 0.58025 + 0.49 0.7815 + 0.432 0.0525 + 0.041
TABLE-US-00003 TABLE 3 Summary of GVHD analyses for examples 2 and 3 Histology or Human frequency of Immune tolerogenic T Experiment Mice reconstitution GVHD cells Adult CD34 + HCT 22 Effector No Histology: 2/4 SmyleDC/pp65 2 vectors CD4, CD8 T clinical GVHD grade co-transduction cells and signs of 1 in skin; immunization on weeks pp65-specific GVHD; Histology: 10, 11 response no GVHD grade analyses 20 weeks Mature B change 1 in colon; after HCT cells and in (example 2) pp65-specific weight response Several cytokines in plasma Adult CD34 + HCT 10 Number of T No n.d. SmyleDC/pp65 2 and B cells clinical vectors co-transduction reduced signs immunization on weeks 10, 11 analyses 45 weeks after HCT (example 2) Adult CD34 + HCT 5 Effector 4 mice n.d. SmyleDC/pp65 1 vector CD4, CD8 T without transduction cells and signs of immunization on weeks pp65-specific GVHD, 10, 11 response 1 mouse analyses 20 pp65- with weeks after HCT specific GVHD (example 3) antibody responses Several cytokines in plasma (pp65 dependent) Cord blood CD34 + HCT 12 Effector No Frequency of SmyleDC/pp65 1 vector CD4, CD8 T clinical Tregs in normal transduction cells and signs range = 3.45% immunization on weeks pp65-specific Frequency of 10, 11 analyses 16 response T cells in weeks after HCT pp65- normal (example 3) specific range = 2.08% antibody responses Cord blood CD34 + HCT 9 Effector No Frequency of SmyleDC/pp65 1 CD4, CD8 T clinical Tregs in normal vector transduction cells and signs range = 4.64% immunization on weeks pp65-specific Frequency of 6, 7, 10, 11 response T cells in analyses 16 weeks after Humoral normal HCT pp65-specific range = 2.0% (example 3) response
[0375] All together, the data describe above demonstrated:
[0376] 1. The fundamental difference between conventional human DC vaccines (which are not highly viable or immunologically stable in vitro or in vivo) with our iDC (viable and potent in vitro and in vivo for several weeks).
[0377] 2. The capacity of iDC once injected subcutaneously to trafficking to the LN-Anlage, resulting in recruitment of CD4+ and CD8+ cells (particularly represented by effector memory and central memory cells), follicular T helper cells and mature B cells.
[0378] 3. That iDC administration resulted in adaptive CTL responses measurable as antigen-specific responses against a protein expressed in CMV (pp65).
[0379] 4. The effects of iDC immunization to stimulate high levels of human IgG production in mice and reactivity against pp65 demonstrating that during the development of human B cells in NRG immunoglobulin class switch occurred.
[0380] 5. Applicability of safety enhanced integrase-defective lentivirus in iDC reprogramming, which enhances the safety of the genetic programming by lowering the risks of insertional mutagenesis.
[0381] 6. Realistic perspectives for clinical development and use of iDC, since: 1. Lentiviral vectors are already being used for ex vivo gene transfer in clinical gene therapy protocols, 2. The HSC source we employed is routinely used for clinical HSCT, 3. The pp65 CMV antigen employed is of clinical relevance for stimulation of potent anti-CMV responses in lymphopenic hosts after HSCT.
[0382] 7. Comparisons between SmyleDCs expressing only GM-CSF and IFN- and SmyleDC/pp65 iDCs additionally expressing the pp65 antigen of HCMV indicate that the latter type of iDCs is significantly correlated with higher levels of human cytokines and different types of human immunoglobulins in the recipient and causes a faster expansion of B as well as T-cells.
[0383] 8. In addition to observed expansion of mature T cells in blood and spleen, SmyleDC/pp65 immunizations after UCBT demonstrated higher frequencies of T cell precursors in the thymus. This reflects the capacity of SmyleDC/pp65 to provide homeostatic and/or antigenic signals to enhance thymopoiesis. It is also possible that SmyleDC/pp65 immunization enhances the mobilization of nave T cells to the periphery, allowing a more constant production of T cell precursors in the thymus.
[0384] 9. Despite the effective reconstitution of a functioning adaptive human immune system in mice, severe graft-versus-host disease has only been observed in a single mouse out of 58 mice that were similarly transplanted with xenogeneic human stem cells and immunized with donor-derived SmyleDCs loaded with the pp65 immunogen. No clinical GVHD signs were observed in the remaining mice. A cohort of 4 mice analyzed hystopathologically by an experienced pathologist showed in a subset of mice only mild grade 1 GVHD. Immunization with SmyleDC/pp65 administered 4 times modestly increased the frequency of Tregs. Thus, the use of iDCs may potentially improve the outcome in hematopoietic stem cell transplantation using donors who are not fully matched with the recipient as required by current clinical protocols.