ANTISENSE COMPOUNDS AND USES THEREOF
20190249175 ยท 2019-08-15
Assignee
Inventors
- Frank Rigo (Carlsbad, CA)
- C. Frank Bennett (Carlsbad, CA)
- Adrian R. Krainer (Huntington Station, NY, US)
- Zhenxun Wang (Singapore, SG)
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention provides compounds comprising oligonucleotides complementary to a pyruvate kinase M transcript. Certain such compounds are useful for hybridizing to a pyruvate kinase M transcript, including but not limited to a pyruvate kinase M transcript in a cell. In certain embodiments, such hybridization results in modulation of splicing of the pyruvate kinase M transcript. In certain embodiments, such compounds are used to treat one or more symptoms associated with cancer.
Claims
1-106. (canceled)
107. A method of modulating splicing of a PK-M transcript in a cell comprising contacting the cell with an antisense compound comprising a single-stranded modified oligonucleotide, wherein the single-stranded modified oligonucleotide consists of 15 to 25 linked nucleosides and has a nucleobase sequence comprising a complementary region, wherein the complementary region comprises at least 15 contiguous nucleobases and is 100% complementary to an equal-length portion of a target region of a PK-M transcript, wherein the target region of the PK-M transcript is within nucleobase 29153 and nucleobase 29281 of SEQ ID NO: 1, wherein each nucleoside of the single-stranded modified oligonucleotide comprises a modified sugar moiety, and wherein the amount of PK-M1 mRNA is increased following contacting the cell with the antisense compound.
108. The method of claim 107, wherein the nucleobase sequence of the single-stranded modified oligonucleotide is 100% complementary to an equal-length portion of the target region of the PK-M transcript.
109. The method of claim 107, wherein the single-stranded modified oligonucleotide consists of 15 to 18 linked nucleosides.
110. The method of claim 107, wherein at least one modified sugar moiety is a 2-O-methoxyethyl (2-MOE) modified sugar moiety.
111. The method of claim 107, wherein at least one modified sugar moiety is a bicyclic modified sugar moiety.
112. The method of claim 111, wherein the at least one bicyclic modified sugar moiety is a LNA or cEt sugar moiety.
113. The method of claim 107, wherein each modified sugar moiety comprises the same modification.
114. The method of claim 107, wherein each modified sugar moiety is independently selected from a 2-MOE modified sugar moiety and a bicyclic modified sugar moiety.
115. The method of claim 114, wherein the single-stranded modified oligonucleotide comprises a sugar motif of keekeekeekeek or kkeekeekeekeek, wherein each k represents a cEt bicyclic modified sugar moiety and each e represents a 2-MOE modified sugar moiety.
116. The method of claim 107, wherein the single-stranded modified oligonucleotide comprises at least one modified internucleoside linkage.
117. The method of claim 116, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
118. The method of claim 116, wherein each internucleoside linkage of the single-stranded modified oligonucleotide is a phosphorothioate internucleoside linkage.
119. The method of claim 107, wherein the nucleobase sequence of the single-stranded modified oligonucleotide comprises a sequence as set forth in any one of SEQ ID NOs: 4 to 36.
120. The method of claim 107, wherein the amount of PK-M2 mRNA is decreased following contacting the cell with the antisense compound.
121. The method of claim 107, wherein the cell is in an animal.
122. The method of claim 121, wherein the method comprises administering the antisense compound into the central nervous system of the animal.
123. The method of claim 121, wherein the animal has one or more symptoms associated with cancer.
124. The method of claim 123, wherein the cancer is glioblastoma.
125. The method of claim 121, wherein the animal is a human.
126. A method of modulating splicing of a PK-M transcript in a cell comprising contacting the cell with an antisense compound comprising a single-stranded modified oligonucleotide, wherein the single-stranded modified oligonucleotide consists of 15 to 25 linked nucleosides and has a nucleobase sequence comprising a complementary region, wherein the complementary region comprises at least 15 contiguous nucleobases and is 100% complementary to an equal-length portion of a target region of a PK-M transcript, wherein the target region of the PK-M transcript is within nucleobase 29153 and nucleobase 29281 of SEQ ID NO: 1, wherein the single-stranded modified oligonucleotide comprises a sugar motif of kddkddkddkddk or kkddkddkddkddk, each k represents a cEt bicyclic modified sugar moiety and each d represents a 2-deoxyribose unmodified sugar moiety, and wherein the amount of PK-M1 mRNA is increased following contacting the cell with the antisense compound.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
DETAILED DESCRIPTION
[0134] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in Carbohydrate Modifications in Antisense Research Edited by Sangvi and Cook, American Chemical Society, Washington D.C., 1994; Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 21.sup.st edition, 2005; and Antisense Drug Technology, Principles, Strategies, and Applications Edited by Stanley T. Crooke, CRC Press, Boca Raton, Fla.; and Sambrook et al., Molecular Cloning, A laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, 1989, which are hereby incorporated by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
[0135] Unless otherwise indicated, the following terms have the following meanings:
[0136] As used herein, nucleoside means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
[0137] As used herein, chemical modification means a chemical difference in a compound when compared to a naturally occurring counterpart. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications.
[0138] As used herein, furanosyl means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.
[0139] As used herein, naturally occurring sugar moiety means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.
[0140] As used herein, sugar moiety means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
[0141] As used herein, modified sugar moiety means a substituted sugar moiety, a bicyclic or tricyclic sugar moiety, or a sugar surrogate.
[0142] As used herein, substituted sugar moiety means a furanosyl comprising at least one substituent group that differs from that of a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2-position, the 3-position, the 5-position and/or the 4-position.
[0143] As used herein, 2-substituted sugar moiety means a furanosyl comprising a substituent at the 2-position other than H or OH. Unless otherwise indicated, a 2-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2-substituent of a 2-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.
[0144] As used herein, MOE means OCH.sub.2CH.sub.2OCH.sub.3.
[0145] As used herein, bicyclic sugar moiety means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2-carbon and the 4-carbon of the furanosyl.
[0146] As used herein the term sugar surrogate means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside is capable of (1) incorporation into an oligonucleotide and (2) hybridization to a complementary nucleoside. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholino, modified morpholinos, cyclohexenyls and cyclohexitols.
[0147] As used herein, nucleotide means a nucleoside further comprising a phosphate linking group. As used herein, linked nucleosides may or may not be linked by phosphate linkages and thus includes, but is not limited to linked nucleotides. As used herein, linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
[0148] As used herein, nucleobase means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
[0149] As used herein, heterocyclic base or heterocyclic nucleobase means a nucleobase comprising a heterocyclic structure.
[0150] As used herein the terms, unmodified nucleobase or naturally occurring nucleobase means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
[0151] As used herein, modified nucleobase means any nucleobase that is not a naturally occurring nucleobase.
[0152] As used herein, modified nucleoside means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.
[0153] As used herein, bicyclic nucleoside or BNA means a nucleoside comprising a bicyclic sugar moiety.
[0154] As used herein, constrained ethyl nucleoside or cEt means a nucleoside comprising a bicyclic sugar moiety comprising a 4-CH(CH.sub.3)O-2bridge.
[0155] As used herein, locked nucleic acid nucleoside or LNA means a nucleoside comprising a bicyclic sugar moiety comprising a 4-CH.sub.2O-2bridge.
[0156] As used herein, 2-substituted nucleoside means a nucleoside comprising a substituent at the 2-position other than H or OH. Unless otherwise indicated, a 2-substituted nucleoside is not a bicyclic nucleoside.
[0157] As used herein, 2-deoxynucleoside means a nucleoside comprising 2-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
[0158] As used herein, oligonucleotide means a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
[0159] As used herein oligonucleoside means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.
[0160] As used herein, modified oligonucleotide means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.
[0161] As used herein internucleoside linkage means a covalent linkage between adjacent nucleosides in an oligonucleotide.
[0162] As used herein naturally occurring internucleoside linkage means a 3 to 5 phosphodiester linkage.
[0163] As used herein, modified internucleoside linkage means any internucleoside linkage other than a naturally occurring internucleoside linkage.
[0164] As used herein, oligomeric compound means a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound comprises an oligonucleotide. In certain embodiments, an oligomeric compound comprises one or more conjugate groups and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide.
[0165] As used herein, terminal group means one or more atom attached to either, or both, the 3 end or the 5 end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
[0166] As used herein, conjugate means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
[0167] As used herein, conjugate linking group means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
[0168] As used herein, antisense compound means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
[0169] As used herein, antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
[0170] As used herein, detecting or measuring means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
[0171] As used herein, detectable and/or measureable activity means a statistically significant activity that is not zero.
[0172] As used herein, essentially unchanged means little or no change in a particular parameter, particularly relative to another parameter which changes much more. In certain embodiments, a parameter is essentially unchanged when it changes less than 5%. In certain embodiments, a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold. For example, in certain embodiments, an antisense activity is a change in the amount of a target nucleic acid. In certain such embodiments, the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.
[0173] As used herein, expression means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5-cap), and translation.
[0174] As used herein, target nucleic acid means a nucleic acid molecule to which an antisense compound hybridizes.
[0175] As used herein, mRNA means an RNA molecule that encodes a protein.
[0176] As used herein, pre-mRNA means an RNA transcript that has not been fully processed into mRNA. Pre-RNA includes one or more intron.
[0177] As used herein, transcript means an RNA molecule transcribed from DNA. Transcripts include, but are not limited to mRNA, pre-mRNA, and partially processed RNA.
[0178] As used herein, PK-M transcript means a transcript transcribed from a PK-M gene. In certain embodiments, a PK-M transcript comprises SEQ ID NO: 1: the complement of GENBANK Accession No. NT_010194.16 truncated from nucleotides 43281289 to 43314403.
[0179] As used herein, PK-M gene means a gene that encodes a pyruvate kinase M protein and any pyruvate kinase M protein isoforms. In certain embodiments, pyruvate kinase M protein isoforms include pyruvate kinase M1 and pyruvate kinase M2. In certain embodiments, a pyruvate kinase M gene is represented by GENBANK Accession No. NT_010194.16 truncated from nucleotides 43281289 to 43314403, or a variant thereof. In certain embodiments, a pyruvate kinase M gene is at least 95% identical to GENBANK Accession No. NT_010194.16 truncated from nucleotides 43281289 to 43314403. In certain embodiments, a pyruvate kinase M gene is at least 90% identical to GENBANK Accession No. NT_010194.16 truncated from nucleotides 43281289 to 43314403.
[0180] As used herein, PK-M1 means a pyruvate kinase M transcript that includes exon 9 but does not include exon 10.
[0181] As used herein, PK-M1 isoform means a pyruvate kinase M protein isoform that includes amino acids encoded from exon 9 but does not include amino acids encoded from exon 10.
[0182] As used herein, PK-M2 means a pyruvate kinase M transcript that includes exon 10 but does not include exon 9.
[0183] As used herein, PK-M2 isoform means a pyruvate kinase M protein isoform that includes amino acids encoded from exon 10 but does not include amino acids encoded from exon 9.
[0184] As used herein, targeting or targeted to means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
[0185] As used herein, nucleobase complementarity or complementarity when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
[0186] As used herein, non-complementary in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
[0187] As used herein, complementary in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary.
[0188] As used herein, hybridization means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
[0189] As used herein, specifically hybridizes means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.
[0190] As used herein, percent complementarity means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.
[0191] As used herein, percent identity means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
[0192] As used herein, modulation means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include a change in splice site selection of pre-mRNA processing, resulting in a change in the absolute or relative amount of a particular splice-variant compared to the amount in the absence of modulation.
[0193] As used herein, motif means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
[0194] As used herein, nucleoside motif means a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
[0195] As used herein, sugar motif means a pattern of sugar modifications in an oligomeric compound or a region thereof.
[0196] As used herein, linkage motif means a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
[0197] As used herein, nucleobase modification motif means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
[0198] As used herein, sequence motif means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.
[0199] As used herein, type of modification in reference to a nucleoside or a nucleoside of a type means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a nucleoside having a modification of a first type may be an unmodified nucleoside.
[0200] As used herein, differently modified mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are differently modified, even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are differently modified, even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
[0201] As used herein, the same type of modifications refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have the same type of modification, even though the DNA nucleoside is unmodified. Such nucleosides having the same type modification may comprise different nucleobases.
[0202] As used herein, pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.
[0203] As used herein, substituent and substituent group, means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2-substuent is any atom or group at the 2-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
[0204] Likewise, as used herein, substituent in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group. In certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (C(O)R.sub.aa), carboxyl (C(O)OR.sub.aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (OR.sub.aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (N(R.sub.bb)(R.sub.cc)), imino(NR.sub.bb), amido (C(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)R.sub.aa), azido (N.sub.3), nitro (NO.sub.2), cyano (CN), carbamido (OC(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)OR.sub.aa), ureido (N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido (N(R.sub.bb)C(S)N(R.sub.bb)(R.sub.cc)), guanidinyl (N(R.sub.bb)C(NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl (C(NR.sub.bb)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(NR.sub.bb)(R.sub.aa)), thiol (SR.sub.bb), sulfinyl (S(O)R.sub.bb), sulfonyl (S(O).sub.2R.sub.bb) and sulfonamidyl (S(O).sub.2N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)S(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb and R.sub.cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
[0205] As used herein, alkyl, as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon atoms being more preferred.
[0206] As used herein, alkenyl, means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.
[0207] As used herein, alkynyl, means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.
[0208] As used herein, acyl, means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula C(O)X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.
[0209] As used herein, alicyclic means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.
[0210] As used herein, aliphatic means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.
[0211] As used herein, alkoxy means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.
[0212] As used herein, aminoalkyl means an amino substituted C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.
[0213] As used herein, aralkyl and arylalkyl mean an aromatic group that is covalently linked to a C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.
[0214] As used herein, aryl and aromatic mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.
[0215] As used herein, halo and halogen, mean an atom selected from fluorine, chlorine, bromine and iodine.
[0216] As used herein, heteroaryl, and heteroaromatic, mean a radical comprising a mono- or polycyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.
Oligomeric Compounds
[0217] In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. In certain embodiments, oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage.
[0218] Certain Sugar Moieties
[0219] In certain embodiments, oligomeric compounds of the invention comprise one or more modified nucleosides comprising a modified sugar moiety. Such oligomeric compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to oligomeric compounds comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substituted sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
[0220] In certain embodiments, modified sugar moieties are substituted sugar moieties comprising one or more substituent, including but not limited to substituents at the 2 and/or 5 positions. Examples of sugar substituents suitable for the 2-position, include, but are not limited to: 2-F, 2-OCH.sub.3 (OMe or O-methyl), and 2-O(CH.sub.2).sub.2OCH.sub.3 (MOE). In certain embodiments, sugar substituents at the 2 position is selected from allyl, amino, azido, thio, O-allyl, OC.sub.1-C.sub.10 alkyl, OC.sub.1-C.sub.10 substituted alkyl; OC.sub.1-C.sub.10 alkoxy; OC.sub.1-C.sub.10 substituted alkoxy, OCF.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(Rm)(Rn), and OCH.sub.2C(O)N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. Examples of sugar substituents at the 5-position, include, but are not limited to: 5-methyl (R or S); 5-vinyl, and 5-methoxy. In certain embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, 2-F-5-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 5, 2-bis substituted sugar moieties and nucleosides).
[0221] Nucleosides comprising 2-substituted sugar moieties are referred to as 2-substituted nucleosides. In certain embodiments, a 2-substituted nucleoside comprises a 2-substituent group selected from halo, allyl, amino, azido, OC.sub.1-C.sub.10 alkoxy; OC.sub.1-C.sub.10 substituted alkoxy, SH, CN, OCN, CF.sub.3, OCF.sub.3, O-alkyl, S-alkyl, N(R.sub.m)-alkyl; O-alkenyl, S-alkenyl, or N(R.sub.m)-alkenyl; O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(O)N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These 2-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.
[0222] In certain embodiments, a 2-substituted nucleoside comprises a 2-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CHCH.sub.2, OCH.sub.2CHCH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(O)N(R.sub.m)(R.sub.n) where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0223] In certain embodiments, a 2-substituted nucleoside comprises a sugar moiety comprising a 2-substituent group selected from F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(O)N(H)CH.sub.3.
[0224] In certain embodiments, a 2-substituted nucleoside comprises a sugar moiety comprising a 2-substituent group selected from F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0225] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4 and the 2 furanose ring atoms. Examples of such 4 to 2 sugar substituents, include, but are not limited to: [C(R.sub.a)(R.sub.b)].sub.n, [C(R.sub.a)(R.sub.b)].sub.nO, C(R.sub.aR.sub.b)N(R)O or, C(R.sub.aR.sub.b)ON(R); 4-CH.sub.2-2, 4-(CH.sub.2).sub.2-2, 4-(CH.sub.2).sub.3-2, 4-(CH.sub.2)O-2 (LNA); 4-(CH.sub.2)S-2; 4-(CH.sub.2).sub.2O-2 (ENA); 4-CH(CH.sub.3)O-2 (cEt) and 4-CH(CH.sub.2OCH.sub.3)O-2, and analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4-C(CH.sub.3)(CH.sub.3)O-2 and analogs thereof, (see, e.g., WO2009/006478, published Jan. 8, 2009); 4-CH.sub.2N(OCH.sub.3)-2 and analogs thereof (see, e.g., WO2008/150729, published Dec. 11, 2008); 4-CH.sub.2ON(CH.sub.3)-2 (see, e.g., US2004/0171570, published Sep. 2, 2004); 4-CH.sub.2ON(R)-2, and 4-CH.sub.2N(R)O-2-, wherein each R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl; 4-CH.sub.2N(R)O-2, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4-CH.sub.2C(H)(CH.sub.3)-2 (see, e.g., Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and 4-CH.sub.2C(CH.sub.2)-2 and analogs thereof (see, published PCT International Application WO 2008/154401, published on Dec. 8, 2008).
[0226] In certain embodiments, such 4 to 2 bridges independently comprise from 1 to 4 linked groups independently selected from [C(R.sub.a)(R.sub.b)].sub.n, C(R.sub.a)C(R.sub.b), C(R.sub.a)N, C(NR.sub.a), C(O), C(S), O, Si(R.sub.a).sub.2, S(O).sub.x, and N(R.sub.a);
[0227] wherein:
[0228] x is 0, 1, or 2;
[0229] n is 1, 2, 3, or 4;
[0230] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(O)H), substituted acyl, CN, sulfonyl (S(O).sub.2-J.sub.1), or sulfoxyl (S(O)-J.sub.1); and
[0231] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(O)H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0232] Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) -L-Methyleneoxy (4-CH.sub.2O-2) BNA, (B) -D-Methyleneoxy (4-CH.sub.2O-2) BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4-(CH.sub.2).sub.2O-2) BNA, (D) Aminooxy (4-CH.sub.2ON(R)-2) BNA, (E) Oxyamino (4-CH.sub.2N(R)O-2) BNA, (F) Methyl(methyleneoxy) (4-CH(CH.sub.3)O-2) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4-CH.sub.2S-2) BNA, (H) methylene-amino (4-CH.sub.2N(R)-2) BNA, (I) methyl carbocyclic (4-CH.sub.2CH(CH.sub.3)-2) BNA, and (J) propylene carbocyclic (4-(CH.sub.2).sub.3-2) BNA as depicted below.
##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl.
[0233] Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO 1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Applications Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
[0234] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4-2 methylene-oxy bridge, may be in the -L configuration or in the -D configuration. Previously, -L-methyleneoxy (4-CH.sub.2O-2) bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
[0235] In certain embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5-substituted and 4-2 bridged sugars). (see, PCT International Application WO 2007/134181, published on Nov. 22, 2007, wherein LNA is substituted with, for example, a 5-methyl or a 5-vinyl group).
[0236] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In certain such embodiments, such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above. For example, certain sugar surogates comprise a 4-sulfer atom and a substitution at the 2-position (see, e.g., published U.S. Patent Application US2005/0130923, published on Jun. 16, 2005) and/or the 5 position. By way of additional example, carbocyclic bicyclic nucleosides having a 4-2 bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).
[0237] In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those compounds having Formula VII:
##STR00003##
wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:
[0238] Bx is a nucleobase moiety;
[0239] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5 or 3-terminal group;
q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and
[0240] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(X)J.sub.1, OC(X)NJ.sub.1J.sub.2, NJ.sub.3C(X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0241] In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.
[0242] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used to modify nucleosides (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).
[0243] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term morpholino means a sugar surrogate having the following structure:
##STR00004##
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as modified morpholinos.
[0244] Combinations of modifications are also provided without limitation, such as 2-F-5-methyl substituted nucleosides (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5, 2-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4-CH.sub.2O-2 bicyclic nucleoside is further substituted at the 5 position with a 5-methyl or a 5-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0245] Certain Nucleobases
[0246] In certain embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases.
[0247] In certain embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (CCCH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3,2:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0248] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
[0249] Certain Internucleoside Linkages
[0250] In certain embodiments, the present invention provides oligomeric compounds comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (PO), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (PS). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (CH.sub.2N(CH.sub.3)OCH.sub.2), thiodiester (OC(O)S), thionocarbamate (OC(O)(NH)S); siloxane (OSi(H).sub.2O); and N,N-dimethylhydrazine (CH.sub.2N(CH.sub.3)N(CH.sub.3)). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
[0251] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or 13 such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
[0252] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3-CH.sub.2N(CH.sub.3)O-5), amide-3 (3-CH.sub.2C(O)N(H)-5), amide-4 (3-CH.sub.2N(H)C(O)-5), formacetal (3-OCH.sub.2O-5), and thioformacetal (3-SCH.sub.2O-5). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0253] Certain Motifs
[0254] In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemically modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).
[0255] Certain Sugar Motifs
[0256] In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
[0257] In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or wings and an internal region or gap. The three regions of a gapmer motif (the 5-wing, the gap, and the 3-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3-most nucleoside of the 5-wing and the 5-most nucleoside of the 3-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar modification motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar modification motifs of the 5-wing differs from the sugar modification motif of the 3-wing (asymmetric gapmer). In certain embodiments, oligonucleotides comprise 2-MOE modified nucleosides in the wings and 2-F modified nucleosides in the gap.
[0258] In certain embodiments, oligonucleotides are fully modified. In certain such embodiments, oligonucleotides are uniformly modified. In certain embodiments, oligonucleotides are uniform 2-MOE. In certain embodiments, oligonucleotides are uniform 2-F. In certain embodiments, oligonucleotides are uniform morpholino. In certain embodiments, oligonucleotides are uniform BNA. In certain embodiments, oligonucleotides are uniform LNA. In certain embodiments, oligonucleotides are uniform cEt.
[0259] In certain embodiments, oligonucleotides comprise a uniformly modified region and additional nucleosides that are unmodified or differently modified. In certain embodiments, the uniformly modified region is at least 5, 10, 15, or 20 nucleosides in length. In certain embodiments, the uniform region is a 2-MOE region. In certain embodiments, the uniform region is a 2-F region. In certain embodiments, the uniform region is a morpholino region. In certain embodiments, the uniform region is a BNA region. In certain embodiments, the uniform region is a LNA region. In certain embodiments, the uniform region is a cEt region.
[0260] In certain embodiments, the oligonucleotide does not comprise more than 4 contiguous unmodified 2-deoxynucleosides. In certain circumstances, antisesense oligonucleotides comprising more than 4 contiguous 2-deoxynucleosides activate RNase H, resulting in cleavage of the target RNA. In certain embodiments, such cleavage is avoided by not having more than 4 contiguous 2-deoxynucleosides, for example, where alteration of splicing and not cleavage of a target RNA is desired.
[0261] Certain Internucleoside Linkage Motifs
[0262] In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif, as described above for sugar modification motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The sugar modification motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped sugar modification motif and if it does have a gapped sugar motif, the wing and gap lengths may or may not be the same.
[0263] In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
[0264] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3 end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3 end of the oligonucleotide.
[0265] Certain Nucleobase Modification Motifs
[0266] In certain embodiments, oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif. In certain such embodiments, nucleobase modifications are arranged in a gapped motif. In certain embodiments, nucleobase modifications are arranged in an alternating motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is chemically modified.
[0267] In certain embodiments, oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 3-end of the oligonucleotide. In certain such embodiments, the block is at the 5-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5-end of the oligonucleotide.
[0268] In certain embodiments, nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide. For example, in certain embodiments each purine or each pyrimidine in an oligonucleotide is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, each uracil is modified.
[0269] In certain embodiments, some, all, or none of the cytosine moieties in an oligonucleotide are 5-methyl cytosine moieties. Herein, 5-methyl cytosine is not a modified nucleobase. Accordingly, unless otherwise indicated, unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl. In certain embodiments, the methylation state of all or some cytosine nucleobases is specified.
[0270] Certain Overall Lengths
[0271] In certain embodiments, the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths. In certain embodiments, the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that XY. For example, in certain embodiments, the invention provides oligomeric compounds which comprise oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments where the number of nucleosides of an oligomeric compound or oligonucleotide is limited, whether to a range or to a specific number, the oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents. For example, an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents. In certain embodiments, a gapmer oligonucleotide has any of the above lengths.
[0272] One of skill in the art will appreciate that certain lengths may not be possible for certain motifs. For example: a gapmer having a 5-wing region consisting of four nucleotides, a gap consisting of at least six nucleotides, and a 3-wing region consisting of three nucleotides cannot have an overall length less than 13 nucleotides. Thus, one would understand that the lower length limit is 13 and that the limit of 10 in 10-20 has no effect in that embodiment.
[0273] Further, where an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range. For example, an oligonucleotide consisting of 20-25 linked nucleosides comprising a 5-wing consisting of 5 linked nucleosides; a 3-wing consisting of 5 linked nucleosides and a central gap consisting of 10 linked nucleosides (5+5+10=20) may have up to 5 nucleosides that are not part of the 5-wing, the 3-wing, or the gap (before reaching the overall length limitation of 25). Such additional nucleosides may be 5 of the 5-wing and/or 3 of the 3 wing.
[0274] Certain Oligonucleotides
[0275] In certain embodiments, oligonucleotides of the present invention are characterized by their sugar motif, internucleoside linkage motif, nucleobase modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Thus, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.
[0276] Certain Conjugate Groups
[0277] In certain embodiments, oligomeric compounds are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligomeric compound, such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0278] In certain embodiments, a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
[0279] In certain embodiments, conjugate groups are directly attached to oligonucleotides in oligomeric compounds. In certain embodiments, conjugate groups are attached to oligonucleotides by a conjugate linking group. In certain such embodiments, conjugate linking groups, including, but not limited to, bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In some embodiments, the conjugate linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
[0280] Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
[0281] Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.
[0282] In certain embodiments, conjugate groups are at the 3-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3-end. In certain embodiments, conjugates are attached at the 3end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.
[0283] In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, oligomeric compounds comprise an oligonucleotide. In certain embodiments, an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups. Such conjugate and/or terminal groups may be added to oligonucleotides having any of the chemical motifs discussed above. Thus, for example, an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group.
Antisense Compounds
[0284] In certain embodiments, oligomeric compounds of the present invention are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).
[0285] In certain embodiments, the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid.
[0286] In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.
[0287] In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.
[0288] In certain embodiments antisense compounds and antisense oligonucleotides comprise single-strand compounds. In certain embodiments antisense compounds and antisense oligonucleotides comprise double-strand compounds.
[0289] Certain Pathways and Mechanisms Associated with Cancer
[0290] Many cancer cells preferentially use the glycolytic pathway with lactate generation to produce energy, even under normal oxygen conditions. This metabolic feature of cancer is termed the Warburg effect. In certain embodiments, PK-M2 mediates the Warburg effect. In certain embodiments, expression of PK-M2 is crucial for tumor cell growth and proliferation.
[0291] In certain embodiments, reducing expression of PK-M2 inhibits cancer growth. In certain embodiments, reducing expression of PK-M2 induces apoptosis in a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell.
[0292] In certain embodiments, increasing inclusion of exon 9 of a PK-M transcript inhibits cancer growth. In certain embodiments, increasing exclusion of exon 10 of a PK-M transcript inhibits cancer growth. In certain embodiments, increasing inclusion of exon 9 of a PK-M transcript induces apoptosis in a cell. In certain embodiments, increasing exclusion of exon 10 of a PK-M transcript induces apoptosis in a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell. In certain embodiments, the downregulation of PK-M2 leads to apoptosis in certain cancer cells. In certain embodiments, the downregulation of PK-M2 leads to apoptosis in certain glioblastoma cell lines.
[0293] In certain embodiments, PK-M2 also functions as a co-activator of HIF-1 and/or -catenin. In certain embodiments, reducing expression of PK-M2, as opposed to inhibiting its kinase function, interferes with anti-apoptotic and pro-proliferative functions associated with cancer or tumor cells. In certain embodiments, one or more antisense compounds may be used to target a PK-M2.
[0294] In certain embodiments, the administration of a modified oligonucleotide causes a switch in the alternative splicing of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide causes increased inclusion of exon 9 mRNA of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide causes an increase in the exclusion of exon 10 mRNA of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide reduces expression of PK-M2 in a cell. In certain embodiments, the administration of a modified oligonucleotide reduces expression of PK-M2 in a cell and inhibits cancer growth. In certain embodiments, the administration of a modified oligonucleotide reduces expression of PK-M2 and induces apoptosis in a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell.
[0295] Certain Target Nucleic Acids and Mechanisms
[0296] In certain embodiments, antisense compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target nucleic acid is a PK-M transcript. In certain embodiments, the target RNA is a PK-M pre-mRNA.
[0297] In certain embodiments, an antisense compound is complementary to a region of PK-M pre-mRNA. In certain embodiments, an antisense compound is complementary within a region of PK-M pre-mRNA comprising an exon encoding PK-M2. In certain embodiments, an antisense compound is complementary to a region of PK-M pre-mRNA comprising an intron-exon splice junction. In certain embodiments, an antisense compound is complementary to a region of PK-M pre-mRNA comprising the intron-exon splice junction adjacent to exon 10. In certain embodiments, an antisense compound is complementary within a region of PK-M pre-mRNA consisting of exon 10. In certain embodiments, an antisense compound is complementary within a region of PK-M pre-mRNA comprising an exonic splicing silencer within an exon 10. In certain embodiments, an antisense compound is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within exon 10. In certain embodiments, an antisense compound is complementary within a region of PK-M pre-mRNA comprising an exonic splicing silencer within an exon 9. In certain embodiments, an antisense compound is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within exon 9.
[0298] In certain embodiments, an antisense compound comprises a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length of a PK-M transcript. In certain embodiments, the target region is within nucleobase 29153 and nucleobase 29281 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29158 and nucleobase 29262 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29164 and nucleobase 29188 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29261 and nucleobase 29279 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29168 and nucleobase 29183 of SEQ ID NO.: 1.
[0299] In certain embodiments, an antisense oligonucleotide modulates splicing of a pre-mRNA. In certain embodiments, an antisense oligonucleotide modulates splicing a PK-M pre-mRNA. In certain embodiments, an antisense oligonucleotide increases the amount of PK-M mRNA. In certain embodiments, an antisense oligonucleotide increases the inclusion of exon 9 in PK-M mRNA. In certain embodiments, an antisense oligonucleotide decreases the inclusion of exon 10 in PK-M mRNA. In certain embodiments, an antisense oligonucleotide increases the amount of PK-M1 mRNA. In certain embodiments, an antisense oligonucleotide decreases the amount of PK-M2 mRNA.
[0300] In certain embodiments it is desirable to alter the splicing of PK-M pre-mRNA to include exon 9 and exclude exon 10. By altering the splicing of PK-M pre-mRNA to include exon 9 and exclude exon 10, expression of PK-M1 will increase and expression of PK-M2 will decrease. In certain embodiments it is desirable to alter the splicing of PK-M pre-mRNA to decrease expression of PK-M2.
[0301] Certain Pharmaceutical Compositions
[0302] In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound. In certain embodiments, such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile water. In certain embodiments, the sterile saline is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.
[0303] In certain embodiments, antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0304] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0305] A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.
[0306] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
[0307] In certain embodiments, pharmaceutical compositions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
[0308] In certain embodiments, a pharmaceutical composition provided herein comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
[0309] In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
[0310] In certain embodiments, a pharmaceutical composition provided herein comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80 and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
[0311] In certain embodiments, a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.
[0312] In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
[0313] In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
[0314] In certain embodiments, a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
[0315] In certain embodiments, one or more modified oligonucleotide provided herein is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.
[0316] In certain embodiments, the present invention provides compositions and methods for reducing the amount or activity of a target nucleic acid in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a mammal. In certain embodiments, the animal is a rodent. In certain embodiments, the animal is a primate. In certain embodiments, the animal is a non-human primate. In certain embodiments, the animal is a human.
[0317] In certain embodiments, the present invention provides methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures. For example, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the eyes, ears).
[0318] In certain embodiments, a pharmaceutical composition is administered to an animal having at least one cancer cell. In certain embodiments, such administration results in apoptosis of at least cancer cell. In certain embodiments, a pharmaceutical composition is administered to an animal having at least one symptom associated with cancer. In certain embodiments, such administration results in amelioration of at least one symptom. In certain embodiments, administration of a pharmaceutical composition to an animal results in a decrease of PK-M2 mRNA in a cell of the animal. In certain embodiments, such administration results in an increase in PK-M1 mRNA. In certain embodiments, such administration results in a decrease in PK-M2 protein and an increase PK-M1 protein. In certain embodiments, a PK-M1 protein is preferred over a PK-M2 protein. In certain embodiments, the administration of certain antisense oligonucleotides delays the onset of cancer. In certain embodiments, the administration of certain antisense oligonucleotides slows the proliferation of cancer cells. In certain embodiments, the administration of certain antisense oligonucleotides slows the proliferation of tumor cells. In certain embodiments, the administration of certain antisense oligonucleotides prevents the growth of cancer. In certain embodiments, the administration of certain antisense oligonucleotides prevents the formation of tumors. In certain embodiments, the administration of certain antisense oligonucleotides causes tumor mass to decrease. In certain embodiments, the administration of certain antisense oligonucleotides rescues cellular phenotype.
Nonlimiting Disclosure and Incorporation by Reference
[0319] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
[0320] Although the sequence listing accompanying this filing identifies each sequence as either RNA or DNA as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as RNA or DNA to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2-OH for the natural 2-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).
[0321] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence ATCGATCG encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence AUCGAUCG and those having some DNA bases and some RNA bases such as AUCGATCG and oligomeric compounds having other modified or naturally occurring bases, such as AT.sup.meCGAUCG, wherein .sup.meC indicates a cytosine base comprising a methyl group at the 5-position.
EXAMPLES
[0322] The following examples illustrate certain embodiments of the present invention and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.
Example 1: Screening in HEK-293 Cells to Identify Antisense Oligonucleotides that Promote the Expression of the Pyruvate Kinase M1 Isoform via Alternative Splicing
[0323] Alternative splicing of the Pyruvate kinase M (PK-M) gene involves a choice between mutually exclusive exons 9 and 10. An antisense oligonucleotide (ASO) screen was carried out to identify potent ASOs that switch the splicing of endogenous PK-M transcripts to include exon 9, thereby promoting PK-M1 isoform expression and down-regulating PK-M2 isoform expression. A diagram of the PK-M genomic region is presented in
[0324] The ASOs were designed as uniform oligonucleotides, 15 nucleotides in length, with 2-O-methoxyethyl ribose sugar residues and a phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target exon 10 of the complement of GENBANK Accession No. NT_010194.16 truncated from nucleotides 43281289 to 43314403(designated herein as SEQ ID NO: 1), and cover the 167-nucleotide region of exon 10 in 5-nucleotide steps, as presented in Table 1.
[0325] To examine the effects of antisense oligonucleotide treatment of the cells on endogenous PK-M transcripts, HEK-293 cells were transfected with each ASO at a final concentration of 30 nM. HEK-293 cells were obtained from ATCC and grown at a density of 210.sup.6 cells in 6-cm dishes in DMEM supplemented with 10% (v/v) FBS, penicillin, and streptomycin, at 37 C. and 5% CO.sub.2. Transfections were performed using an ASO: LipofectAMINE2000 ratio of 20 pmoles: 1 L.
[0326] Splicing of the PK-M transcripts by radioactive RT-PCR was analyzed 48 hrs after transfection. Two micrograms of total RNA was extracted from the cells using Trizol reagent (Life Technologies, Carlsbad, Calif.). Contaminating DNA was removed with DNase I (Promega). Reverse transcription was carried out using ImPromp-II reverse transcriptase (Promega). Semiquantitative PCR using Amplitaq polymerase (Applied Biosystems) was performed by including [-.sup.32P]-dCTP in the reactions. The human-specific primer sets used to amplify endogenous transcripts anneal to PK-M exons 8 and 11, and their sequences are: hPKMF: 5-AGAAACAGCCAAAGGGGACT-3 (designated herein as SEQ ID NO: 2) and hPKMR: 5-CATTCATGGCAAAGTTCACC-3 (designated herein as SEQ ID NO: 3). The primers are represented by arrows at the top portion of
[0327] The products were analyzed on a 5% native polyacrylamide gel, visualized by autoradiography, and quantified on a Typhoon 9410 phosphorimager (GE Healthcare) using Multi Gauge software Version 2.3. The results are presented in
[0328] Some of the ASOs strongly increased the proportion of PK-M1 mRNA, with a concurrent increase in the amount of double-skipped mRNA, and a decrease in PK-M2 mRNA. The results indicate that these ASOs target functional enhancer splice elements (ESEs) in exon 10.
[0329] The two most potent ASOs were ISIS 461456 and ISIS 461472. ISIS 461472 targets the previously characterized exon 10 SRSF3 motif (Wang, Z. et al., J. Mol. Cell Biol. 4: 79-87, 2012), whereas ISIS 461456 targets a non-overlapping 15-nucleotide region in the middle of exon 10.
TABLE-US-00001 TABLE1 RT-PCRscreeningofASOstargetingexon10inHEK- 293cells Target Target SEQ Start Stop ID IsisNo Site Site Sequence %M1 %M2 NO n/a n/a n/a n/a 2 98 n/a 461453 29153 29167 AATAATTGCAAGTGG 29 69 4 461454 29158 29172 CCTCAAATAATTGCA 26 73 5 461455 29163 29177 GAGTTCCTCAAATAA 27 70 6 461456 29168 29182 CGGCGGAGTTCCTCA 33 64 7 461457 29173 29187 CCAGGCGGCGGAGTT 25 69 8 461458 29178 29192 GGGCGCCAGGCGGCG 21 72 9 461459 29183 29197 GTAATGGGCGCCAGG 17 81 10 461460 29188 29202 CGCTGGTAATGGGCG 23 70 11 461469 29248 29262 CCCCACTGCAGCACT 13 82 12 461470 29253 29267 TATGGCCCCACTGCA 9 90 13 461471 29258 29272 ACGATTATGGCCCCA 6 94 14 461472 29263 29277 TGAGGACGATTATGG 23 74 15 461473 29268 29282 CTTGGTGAGGACGAT 4 95 16 461474 29273 29287 CCAGACTTGGTGAGG 12 88 17
Example 2: ASO Microwalk Centered on the 10W ESE Region
[0330] An ASO microwalk was performed to find the most potent ASOs that target the exon 10 regions defined by ISIS 461456 and ISIS 461472.
[0331] Overlapping 15-nucleotide ASOs were designed in 1-nucleotide steps. The ASOs were designed as uniform oligonucleotides, 15 nucleotides in length, with 2-O-methoxyethyl ribose sugar residues and a phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target exon 10 of SEQ ID NO: 1.
[0332] To examine the effects of antisense oligonucleotide treatment of the cells on endogenous PK-M transcripts, HEK-293 cells were transfected with each ASO at a final concentration of 60 nM. Cell culture, transfection and RNA analysis was conducted in a similar manner to that described in Example 1. The results of the microwalks are presented in
[0333] The results indicate that ISIS 549197 was the most potent in increasing endogenous PK-M1 mRNA and decreasing PK-M2 mRNA levels. The results also indicate that ISIS 555158 optimally abrogated the SRSF3-dependent ESE in exon 10.
TABLE-US-00002 TABLE2 ASOmicrowalkaroundISIS461456inHEK-293cells Target Target SEQ ISIS Start Stop ID No Site Site Sequence %M1 %M2 NO n/a n/a n/a n/a 2 98 n/a 549191 29161 29175 GTTCCTCAAATAATT 11 89 18 549192 29162 29176 AGTTCCTCAAATAAT 17 83 19 549193 29164 29178 GGAGTTCCTCAAATA 28 69 20 549194 29165 29179 CGGAGTTCCTCAAAT 29 69 21 549195 29166 29180 GCGGAGTTCCTCAAA 4 95 22 549196 29167 29181 GGCGGAGTTCCTCAA 39 57 23 549197 29169 29183 GCGGCGGAGTTCCTC 41 39 24 549198 29170 29184 GGCGGCGGAGTTCCT 38 51 25 549199 29171 29185 AGGCGGCGGAGTTCC 38 53 26 549200 29172 29186 CAGGCGGCGGAGTTC 25 69 27 549201 29174 29188 GCCAGGCGGCGGAGT 25 67 28
TABLE-US-00003 TABLE3 ASOmicrowalkaroundISIS461472inHEK-293cells Target Target SEQ ISIS Start Stop ID No Site Site Sequence %M1 %M2 NO 555155 29259 29273 GACGATTATGGCCCC 13 88 29 555156 29260 29274 GGACGATTATGGCCC 16 84 30 555157 29261 29275 AGGACGATTATGGCC 26 61 31 555158 29262 29276 GAGGACGATTATGGC 29 60 32 555159 29264 29278 GTGAGGACGATTATG 25 70 33 555160 29265 29279 GGTGAGGACGATTAT 26 68 34 555161 29266 29280 TGGTGAGGACGATTA 18 79 35 555162 29267 29281 TTGGTGAGGACGATT 14 83 36
Example 3: Characterization of the Activation Region of PK-M Exon 10
[0334] The target region of ISIS 461456 and ISIS 549197, the most potent ASOs, was characterized in detail.
[0335] To map the enhancer elements present in the target region of ISIS 461456, the high sequence identity between exons 9 and 10 was taken advantage of. The PK-M2 minigene was constructed by amplifying a 6.4 kb PK-M exon 8-11 fragment from human genomic DNA (Promega), using Phusion High-Fidelity DNA polymerase and primers PKMinigeneF (5-GGGGAAGATATCAATTCCCCATTCTGTCTTCCCATGT-3; designated SEQ ID NO: 37) and PKMinigeneR (5-GGGGAACTCGAGCTAGACATTCATGGCAAAGTTCACC-3; designated SEQ ID NO: 38). The product was then digested and cloned between the BamHI and XhoI sites of pcDNA3.1+(Invitrogen). For exon-duplication and intron-deletion constructs, the upstream KpnI site 1552 nt downstream of exon 8 was removed by a 1-nt deletion, and an EcoRV restriction site was generated 90 nt upstream of exon 9 by a 2-nt insertion to create a modified wild-type minigene. To generate the 10W, 10B7 and 10F7 constructs, modified exon 9 fragments were generated by annealing the following oligonucleotides: 10W F (5-CCCTAAACCTTACAGATAGCTCGTGAGGCTGAGGCAGCCATGTTCCACCGCAAGCTGTTTGAGG AACTCCGCCGAGCCTCAAGTCACTCCACAGACCTCATGGAAGCCAT-3; designated SEQ ID NO: 39), 10F7F (5-CCCTAAACCTTACAGATAGCTCGTGAGGCTGAGGCAGCCATGTTCCACCGCAAGCTGTTTGAGG AACTTGTGCGAGCCTCAAGTCACTCCACAGACCTCATGGAAGCCAT-3; designated SEQ ID NO: 40), 10B7F (5-CCCTAAACCTTACAGATAGCTCGTGAGGCTGAGGCAGCCATGTTCCACCGCAAGCTGTTTGAAG AACTCCGCCGAGCCTCAAGTCACTCCACAGACCTCATGGAAGCCAT-3; designated SEQ ID NO: 41) with Exon 9Rev oligo (5-CCCTTAGGGCCCTACCTGCCAGACTCCGTCAGAACTATCAAAGCTGCTGCTAAACACTTATAAG AAGCCTCCACGCTGCCCATGGCCATGGCTTCCATGAGGTCTG-3; designated SEQ ID NO: 42) and amplifying using Ex10ADupF (5-TTCCCCATTCTGTCTTCCCATGTGTTGTGTCTCGTTTTTTTCCTCCTCCTTCCCTCTTCCTTGCCCC CTCTTCCCCTAAACCTTACAG-3; designated SEQ ID NO: 43) and Ex10ADupR (5-AGTGTTACCTGCCCTTAGGGCCCTAC-3; designated SEQ ID NO: 44). The 106-nt oligonucleotide carries mutations that duplicate specific stretches of exon 10 over the corresponding region of exon 9. Another fragment was amplified from the wild-type minigene using the following primer pairs: Ex10BF: 5-GTAGGGCCCTAAGGGCAGGTAACAC-3 (designated SEQ ID NO: 45) and RKpnI: 5-GGGGAAGGTACCACTGAGCAGGGCATT-3 (designated SEQ ID NO: 46). Both fragments were then gel-purified, subjected to a second overlap-extension (OE) PCR using the end primers FEcoRV (5-GGGGAAGATATCAATTCCCCATTCTGTCTTCCCATGT-3; designated SEQ ID NO: 47) and RKpnI (5-GGGGAGGTACCACTGAGCAGGGCATT-3; designated SEQ ID NO: 48).
[0336] As shown in
[0337] The results are presented in
TABLE-US-00004 TABLE 4 Analysis of minigenes 10W, 10F and 10B Minigene % M1 10W 2 10F <1 10B 29
Example 4: Characterization of the Mechanism of Action of the ASOs
[0338] To characterize the mechanism of action of ISIS 461456 and ISIS 549197 on the inclusion of exon 9 and skipping of exon 10, these ASOs were co-transfected with the PK-M wild-type or duplicated exon 10 minigenes. The wild-type minigene comprises the flanking exons 8 and 11, and the complete genomic region between both exons, whereas the duplication construct has exon 10 replaced completely with exon 9.
[0339] HEK-293 cells were cultured, as described above. Five g of minigene plasmid per 10-cm dish or one g per 6-cm dish was transiently transfected using LipofectAMINE2000 (Life Technologies, Carlsbad, Calif.). ASOs were transfected, as described above, at a final concentration of 60 nM. A control ASO (5-TCATTTGCTTCATACAGG-3, designated as SEQ ID NO: 49) was also used. The results are presented in
[0340] As expected, both ISIS 461456 and ISIS 549197 switched the splicing of the minigene transcript by simultaneously increasing the amount of the M1 mRNA and decreasing the amount of the M2 mRNA expressed from the wild-type minigene (
[0341] Co-transfection of ISIS 461456 or ISIS 549197 with the exon 10 duplication minigene interfered with the inclusion of exon 10, leading to a large increase in double skipped species (
[0342] These results suggest that both ISIS 461456 and ISIS 549197 interfere with the activation of exon 10.
TABLE-US-00005 TABLE 5 Minigene transcript level as a result of ASO co-transfection in HEK-293 cells ASO Minigene treatment % M1 % Skp % M2 Wild-type Control 1 6 93 ISIS 461456 26 63 11 ISIS 5491597 8 85 7 Exon 10 Control n/a 1 99 duplication ISIS 461456 n/a 60 40 ISIS 5491597 n/a 82 18
[0343] Alignment of the 10W region with the PK-M exons 8-11 genomic region revealed a highly homologous region in intron 9 (
[0344] Three mutants were generated (
[0345] A 15-nucleotide deletion was introduced in intron 9 that removed the homologous target region and this was termed the dInt9 construct. To generate the dInt9 mutant, two fragments were generated from the wild-type minigene construct, using the following primer pairs: FEcoRV and PKMdelB12R (5 TGCCCTGCCATGACCTCCCAGACGAGAAGAGGCTCTGTGCCCAG-3; designated SEQ ID NO: 55) and PKMdelB125 (5-ACAGAGCCTCTTCTCGTCTGGGAGGTCATGGCAGGGCAG-3; designated SEQ ID NO: 56).
[0346] To generate the dM double mutant, the same two fragments were generated from the d10W minigene. Both fragments were then gel-purified and subjected to a second OE PCR using FEcoRV and RKpnI. All generated fragments were then cloned between the EcoRV and KpnI sites of the modified wild-type minigene plasmid.
[0347] There was a slight decrease in baseline minigene PK-M2 mRNA expressed from the d10W minigenes (
[0348] The loss of the 10W binding site largely abrogated the exon 9 inclusion and exon 10 skipping promoted by ISIS 461456 and ISIS 549197 (
TABLE-US-00006 TABLE 6 Mutant minigene transcript level as a result of ASO co-transfection in HEK-293 cells ASO Minigene treatment % M1 % Skp % M2 D10W Control 5 9 86 ISIS 461456 11 20 68 ISIS 5491597 10 34 56 dInt9 Control 1 7 92 ISIS 461456 19 74 7 ISIS 5491597 12 80 9 dM Control 2 5 93 ISIS 461456 1 6 93 ISIS 5491597 1 5 94
Example 5: Antisense Inhibition of PK-M in Glioblastoma Cells
[0349] A characteristic splicing switch from PK-M1 to PK-M2 occurs during gliomagenesis (Clower, C. V. et al., Proc. Natl. Acad. Sci. USA 107: 1894-1899, 2010; Bluemlein, K. et al., Oncotarget. 2: 393-400, 2011). Glioblastoma cells also have a higher basal level of PK-M1 mRNA, which is expected to facilitate the ASO-mediated PK-M splicing switch (Clower, C. V. et al., Proc. Natl. Acad. Sci. USA 107: 1894-1899, 2010).
[0350] To compare the effect of ASOs targeting the 10W region versus those targeting the SRSF3 region, side-by-side ASO transfections at final concentrations of 30 nM, 60 nM, and 90 nM in the glioblastoma cell lines A172 and U87-MG were conducted. ISIS 555158 was the ASO targeting the SRSF3 region that was chosen and was transfected at final concentrations of 60 or 90 nM. The control oligonucleotide was transfected at a final concentration of 90 nM. The experiment was run in triplicates.
[0351] U87-MG and A172 cells were obtained from ATCC and grown in DMEM supplemented with 10% (v/v) FBS, penicillin, and streptomycin, at 37 C. and 5% CO.sub.2. ASO transfections were conducted as described above. Radioactive RT-PCR and restriction digest of endogenous PK-M transcripts were performed 36 hrs after transfection. The results are presented in
[0352] As expected, there was a dose-dependent increase in exon 9 inclusion and exon 10 skipping in these cell lines, with ISIS 461456 and ISIS 549197 performing better than ISIS 555158. Consistent with the minigene experiments, treatment with ISIS 461456 resulted in greater increase in PK-M1 mRNA levels than treatment with other ASOs, whereas treatment with ISIS 549197 resulted in more double-skipped mRNA and a larger decrease in PK-M2 mRNA levels than treatment with other ASOs.
TABLE-US-00007 TABLE 7 Effect of ASO treatment on PK-M mRNA levels in A172 glioblastoma cells Treatment Dose (nM) % M1 % Skp % M2 Control 90 15 85 ISIS 30 52 48 461456 60 63 37 90 73 27 ISIS 30 49 8 42 549197 60 49 12 38 90 56 23 21 ISIS 60 39 10 51 555158 90 44 15 41
TABLE-US-00008 TABLE 8 Effect of ASO treatment on PK-M mRNA levels in U87-MG glioblastoma cells Treatment Dose (nM) % M1 % Skp % M2 Control 90 4 96 ISIS 30 43 2 55 461456 60 50 3 46 90 54 5 41 ISIS 30 36 12 52 549197 60 38 17 44 90 45 22 33 ISIS 60 24 11 65 555158 90 29 14 57
[0353] To estimate the amount of PK-M1 and PK-M2 proteins in the cell lysates, isoform-specific antibodies were used. Cells were lysed in SDS, and total protein concentration was measured by the Bradford assay. Total protein of 5-30 g was separated by SDS-PAGE and transferred onto nitrocellulose. This was followed by blocking with 5% (w/v) milk in Tris-buffered saline with Tween-20, probing with antibodies and visualization by enhanced chemiluminescence (Roche). The primary antibodies used were -actin (Genscript mAb, 1:10,000); PK-M2 (Cell Signaling Technology, rAb, 1:2,000); and PK-M1 (ProteinTech, rAb, 1:1,000). Secondary antibodies were goat anti-mouse or anti-rabbit HRP conjugates (Bio-Rad, 1:20,000). The results are presented in
[0354] As expected, PK-M1 and PK-M2 protein isoform levels closely mirrored their mRNA levels. There was detectable PK-M1 protein after transfection of each of the three ASOs, but ISIS 549197 resulted in the greatest decrease in PK-M2 levels.
[0355] The data was also confirmed by immunofluorescence technique. Cells were first transfected with ASOs as described above and then plated on 4-well culture slides (BD Biosciences) 24-hrs post transfection. At 36 hrs post-transfection, the cells were washed with PBS and fixed with 3.7% formaldehyde in PBS for 20 min. Cells were then permeabilized in 0.1% Triton X-100 in PBS for 10 min after washing in PBS, and then blocked for 20 min in blocking buffer (1% goat serum in PBS). The cells were then incubated overnight with rabbit monoclonal anti-PK-M2 antibody (Cell Signaling Technology). After washing 3 times with PBS, the cells were then incubated for 1 hr in blocking buffer containing Alexa Fluor 594-conjugated goat anti-rabbit secondary antibody (Molecular Probes/Invitrogen). Cells were analyzed using a Zeiss Axiopian.Z1 upright fluorescent microscope. Downregulation of PK-M2 protein was also observed when either ISIS 461456 or ISIS 549197, but not the control ASO, was transfected into A172 or U87-MG cells (
Example 6: Effect of Antisense Inhibition of PK-M on Apoptosis in Glioblastoma Cells
[0356] The effect of treatment with ASOs targeting PK-M on apoptosis of the glioblastoma cells was studied.
[0357] Treatment with ISIS 549197 resulted in cleaved PARP as early as 24 hrs post-transfection in A172 cells, indicating that the cells were undergoing apoptosis. Cells were harvested 24 or 48 hrs after transfection, whereas the control cells were harvested after 48 hrs. The cells were lysed in SDS and total protein concentration was measured by the Bradford assay. Total protein (5-30 g) was separated by SDS-PAGE and transferred onto nitrocellulose. The membrane was blocked with 5% (w/v) milk in Tris-buffered saline with Tween-20 and probed with PARP primary antibody (Cell Signaling Technology, rAb, 1:1,000). The bands were visualized by enhanced chemiluminescence (Roche). The results are presented in
[0358] To confirm this observation, Annexin V staining assays were performed with A172 and U87-MG cells transfected with ISIS 460456, ISIS 549197, or ISIS 555158 at a final concentration of 90 nM. Cells (110.sup.6 in number) were collected 36 hrs after transfection, washed twice with PBS and resuspended in 1 Binding Buffer (10 mM HEPES, pH 7.4; 140 mM NaCl; 2.5 mM CaCl.sub.2). The cells were then stained with 5 l each of Annexin V-APC antibody and 7-AAD (Becton Dickinson) in the dark for 15 min, and analyzed for apoptosis for flow cytometry using an LSRII Cell Analyzer (Becton Dickinson). Both early apoptotic (7AAD.sup./Annexin V.sup.+) and late apoptotic (7AAD.sup.+/Annexin V.sup.+) cells were included in the quantification. The results are presented in
TABLE-US-00009 TABLE 9 Effect of ASO treatment on apoptosis in A172 glioblastoma cells ASO: Control ISIS 555158 ISIS 461456 ISIS 549197 A172 3 23 34 48 U87-MG 4 18 32 44
[0359] To confirm this finding, cells were transfected with ISIS 461456 or ISIS 549197 at 30 nM, 60 nM, or 90 nM or with ISIS 555158 at 60 nM or 90 nM. The control ASO was transfected at 90 nM. The data is presented in
TABLE-US-00010 TABLE 10 Effect of ASO multi-dose treatment on apoptosis in A172 glioblastoma cells Treatment Dose (nM) % apoptosis Control 90 3 ISIS 30 10 461456 60 20 90 34 ISIS 30 20 549197 60 44 90 48 ISIS 60 16 555158 90 23
TABLE-US-00011 TABLE 11 Effect of ASO multi-dose treatment on apoptosis in U87-MG glioblastoma cells Treatment Dose (nM) % apoptosis Control 90 4 ISIS 30 8 461456 60 27 90 32 ISIS 30 13 549197 60 30 90 44 ISIS 60 10 555158 90 18
Example 7: Effect of Antisense Inhibition of PK-M on Apoptosis in PK-M1 Inducible Cells
[0360] To investigate the mechanism of action by which treatment with ASOs elicits apoptosis in glioblastoma cells, stable cell lines that express human PK-M1 cDNA in a doxycycline-inducible manner or PK-M2 cDNA in a constitutive manner were generated.
[0361] To generate cell lines that over-express human PK-M1 isoform in a doxycycline-dependent manner, A172 cells were first infected with MSCV-rtTA-hygro virus, and selected in hygromycin for 2 weeks. Human PK-M1 cDNA was amplified from A172 cells transfected with ISIS 549197 using the following primer pair: hPKT7cDNAF (5-GGGGAACTCGAGATGGCTTCTAGGATGGCATCGATGACAGGTGGCCAACAGATGGGCATGTCG AAGCCCCATAGTGAAGCCG-3; designated SEQ ID NO: 57) and hPKT7cDNAR (5-GGGGAAGAATTCTCACGGCACAGGAACAACACGCATG-3; designated SEQ ID NO: 58) with Phusion High-Fidelity DNA Polymerase (Finnzymes). The resulting amplicon containing the T7 tag was gel-purified and cloned between the EcoRI and XhoI sites of the retroviral TtiGP plasmid.A172-rTA cells were then infected with TtiGP-PKM1 virus. To make cells lines constitutively over-express human PK-M2, PK-M2 cDNA from A172 cells were amplified using the same primers and cloned between the EcoRI and XhoI sites of the retroviral PIG plasmid. A172 and U87-MG cells were then infected with the PIG-PKM2 virus. All infected cells were then selected with 100 g/ml puromycin for 3 days. All plasmids were sequenced to confirm their identities.
[0362]
[0363] To investigate the role of PK-M1 in ASO-mediated apoptosis, doxycycline was added to the PK-M1-inducible cells for three days, after which the cells were treated with ISIS 461456, ISIS 549197, or control ASO at 60 nM final concentrations. After 36 hrs, the cells were stained for Annexin V and analyzed by flow cytometry. The results are presented in
[0364] To investigate the role of PK-M2 downregulation in apoptosis, U87-MG and A172 cells overexpressing PK-M2 were treated with ISIS 461456, ISIS 549197, ISIS 555158, or control ASO at a final concentration of 90 nM. The cells were analyzed by immunoblotting as well as by Annexin V flow cytometry. The results are presented in
TABLE-US-00012 TABLE 12 Fold change of apoptosis compared to control ASO in PK-M1-inducible cells Treatment Doxycycline Fold-change ISIS No 3.0 461456 Yes 3.3 ISIS No 8.4 549197 Yes 7.5
TABLE-US-00013 TABLE 13 Fold change of apoptosis compared to control ASO in PK-M2-overexpressing cells Cell line Treatment % apoptosis A172 ISIS 555158 7.3 ISIS 461456 10.8 ISIS 549197 15.0 0.9A172 M2 ISIS 555158 0.9 ISIS 461456 0.9 ISIS 549197 1.0 U87-MG ISIS 555158 4.6 ISIS 461456 8.2 ISIS 549197 11.3 U87-MG M2 ISIS 555158 1.0 ISIS 461456 1.4 ISIS 549197 1.1
Example 8: siRNA Knockdown of PK-M2 in A172 Cells
[0365] To confirm the effect on apoptosis in glioblastoma cells by antisense inhibition, siRNA knockdown of PK-M2 in A172 cells was employed.
[0366] Four siRNAs targeting exon 10 of human PKM2 were obtained from Sigma Genosys, and have sense-strand sequences 5-CCAUAAUCGUCCGCACCAA-3 (M2si1; designated SEQ ID NO: 59), 5-CAUCUACCACUUGCAAUUA-3 (M2si2; designated SEQ ID NO: 60), 5-CCGUGGAGGCCUCCUUCAA-3 (M2si3; designated SEQ ID NO: 61) and 5-CUUGCAAUUAUUUGAGGAA-3 (M2si4; designated SEQ ID NO: 62). A172 cells (410.sup.6) in 6-well plates were transfected with 400 pmol of siRNA duplex using LipofectAMINE2000. Cells were harvested 48 hr later.
[0367] The results are presented in
Example 9: Effect of 2-O-Methoxyethyl Antisense Oligonucleotides on PK-M Splicing In Vivo
[0368] The ASOs listed in Table 14 below were designed to target exon 10 of the mouse PK-M transcript comprising GENBANK Accession No. NT_039474.8 truncated from nucleotides 5923000 to 5949000 (designated herein as SEQ ID NO: 63). (Note that the human ASOs described herein target the complement of the human genomic PK-M sequence NT_010194.16 truncated from nucleotides 43281289 to 43314403, whereas the mouse ASOs target the mouse genomic sequence NT_039474.8 truncated from nucleotides 5923000 to 5949000 because the mouse sequence, SEQ ID: 63, corresponds to the non-coding strand of the mouse genomic DNA. In each case, the ASOs are complementary to the RNA transcript.) Each of the ASOs in Table 14 is also complementary to the human PK-M transcript with 0-3 mismatches. Each of the ASOs is 15 nucleotides in length, with uniform 2-O-methoxyethyl ribose sugar residues, and uniform phosphorothioate internucleoside linkages. All the cytosine nucleobases are 5-methylcytosines.
[0369] To examine the effects of antisense oligonucleotide treatment on endogenous PK-M transcripts in vivo, C57Bl/6 wild-type (WT) mice were injected subcutaneously once per week for three weeks with one of the ASOs listed in Table 14 at 100 mg/kg or with PBS as a control. Each treatment group consisted of 4 animals. Four days after the administration of the last dose, the mice were sacrificed and tissues were collected.
[0370] PK-M1 and PK-M2 mRNA levels in each of the mice's livers were determined using real-time PCR and RIBOGREEN RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.) according to standard protocols. Two mouse-specific primer probe sets were used to amplify endogenous PK-M1. The first primer set anneals to PK-M exons 8 and 9 (mPKMF: 5-TGTCTGGAGAAACAGCCAAGG-3, designated herein as SEQ ID NO: 64; mPKMR: 5-CAAGCTCTTCAAACAGCAGACG-3, designated herein as SEQ ID NO:65; probe sequence: 5-AGCACCTGATAGCTCGGGAGGC-3, designated herein as SED ID NO: 66). The second PK-M1 primer set anneals to exons 9 and 11 (mPKMF: 5-AAGATGCCACGGTACAGATGG-3, designated herein as SEQ ID NO: 67; mPKMR 5-CAGACCTCATGGAGGCCATG-3, designated herein as SEQ ID NO: 68; probe sequence: 5-TGGCAGGAGTGCTCACCAAGT-3, designated herein as SED ID NO: 69). Two mouse-specific primer probe sets were used to amplify endogenous PK-M2. The first PK-M2 primer set anneals to PK-M exons 8 and 10 (mPKMF: 5-GGAGTTCCTCGAATAGCTGCAAG-3, designated herein as SEQ ID NO:70; and mPKMR: 5-AGTCCTGGATGGAGCAGACT-3, designated herein as SEQ ID NO:71; probe sequence: 5-GCTGTTCGCATGCAGCACCT-3, designated herein as SED ID NO:72). The second PK-M2 primer set anneals to exons 10 and 11 (mPKMF: 5-GCGAGCAGTCTGGGGATTTC-3, designated herein as SEQ ID NO: 73; mPKMR: 5-ACCCCACAGAAGCTGCC-3, designated herein as SEQ ID NO:74; probe sequence: 5-ACCAAGTCTGGCAGGAGTGCTC-3, designated herein as SED ID NO:75). mRNA levels were determined relative to GAPDH prior to normalization to PBS-treated controls. The results in Table 15 are presented as the average percent of PK-M1 and PK-M2 mRNA levels for each treatment group, relative to the PK-M1 and PK-M2 mRNA levels of the PBS-treated control group, respectively, and are denoted as % PBS. The standard error for all PK-M1 results was 34%, and the standard error for all PK-M2 results was 6%. The results for each primer probe set are listed. ND indicates no data because the ASO targets a portion of the amplicon, thereby preventing primer binding and amplification. All of the ASOs were well tolerated, as assessed by liver weight and ALT and AST levels.
TABLE-US-00014 TABLE14 ASOstargetingmousePK-Mexon10 Mouse Mouse Target Target SEQ Start Stop ID IsisNo. Site Site Sequence(5 to3) NO. 606601 20994 21011 GTTCCTCGAATAGCTGCA 76 606602 20995 21012 AGTTCCTCGAATAGCTGC 77 606604 20997 21014 GGAGTTCCTCGAATAGCT 78 606651 21096 21113 TGAGCACGATAATGGCCC 79 606653 21098 21115 GGTGAGCACGATAATGGC 80 606661 21106 21123 CCAGACTTGGTGAGCACG 81
TABLE-US-00015 TABLE 15 Effect of ASOs targeting mouse PK-M exon 10 on PK-M splicing in vivo PK-M1, PK-M1, PK-M2, PK-M2, exons 8, exons 9, exons 8, exons 10, 9 primer 11 primer 10 primer 11 primer Isis probe set probe set probe set probe set No. (% PBS) (% PBS) (% PBS) (% PBS) n/a 100 100 100 100 606601 260 250 ND 50 606602 290 270 ND 50 606604 210 200 ND 60 606651 440 400 50 ND 606653 270 270 50 ND 606661 320 200 40 ND
Example 10: Effect of Deoxy, MOE, and cEt Antisense Oligonucleotides on PK-M Splicing In Vivo
[0371] The ASOs listed in Table 16 below were designed to target exon 10 of SEQ ID NO: 63. Each of the ASOs in Table 16 is also complementary to the human PK-M transcript with 0-3 mismatches. The ASOs are either 16 or 18 nucleotides in length, with deoxy sugar residues, 2-MOE modified sugar residues, or cEt modified sugar residues, and uniform phosphorothioate internucleoside linkages. The Chemistry column presents the positions of the sugar residues; d signifies a deoxy sugar, e signifies 2-MOE modified sugar residue, and k signifies a cEt modified sugar residue. All the cytosine nucleobases are 5-methylcytosines.
[0372] To examine the effects of antisense oligonucleotide treatment on endogenous PK-M transcripts in vivo, C57Bl/6 WT mice were injected subcutaneously once per week for four weeks with one of the ASOs listed in Table 16 at 100 mg/kg or with PBS as a control. Each treatment group consisted of 4 animals. Two days after the administration of the last dose, the mice were sacrificed and tissues were collected.
[0373] PK-M1 and PK-M2 mRNA levels in each of the mice's livers were determined using real-time PCR according to standard protocols. Mouse-specific primer probe sets, described in Example 9, were used to amplify endogenous PK-M1 and PK-M2. mRNA levels were determined relative to GAPDH prior to normalization to PBS-treated controls. The results in Table 17 are presented as the average percent of PK-M1 and PK-M2 mRNA levels for each treatment group, relative to the PK-M1 and PK-M2 mRNA levels of the PBS-treated control group, respectively, and are denoted as % PBS. ND indicates no data because the ASO targets a portion of the amplicon, thereby preventing primer binding and amplification. All of the ASOs were well tolerated, as assessed by liver weight and ALT and AST levels, except for ISIS 607034 which resulted in elevation in all three or those measures of tolerability.
TABLE-US-00016 TABLE16 ASOstargetingmousePK-Mexon10 Mouse Mouse Target Target SEQID IsisNo. StartSite StopSite Chemistry Sequence(5 to3) NO. 606989 20980 20995 kddkddkddkddkddk CAAGTGGTAGATGGCA 82 606996 21008 21023 kddkddkddkddkddk CCAGGCGGCGGAGTTC 83 607001 21044 21059 kddkddkddkddkddk CGGCGGCAGCTTCTGT 84 607003 21052 21067 kddkddkddkddkddk GGCACCCACGGCGGCA 85 607016 21104 21119 kddkddkddkddkddk ACTTGGTGAGCACGAT 86 607034 21000 21017 kkddkddkddkddkddkk GGCGGAGTTCCTCGAATA 87 607041 21044 21061 kkddkddkddkddkddkk CACGGCGGCAGCTTCTGT 88 607042 21048 21065 kkddkddkddkddkddkk CACCCACGGCGGCAGCTT 89 607055 21100 21117 kkddkddkddkddkddkk TTGGTGAGCACGATAATG 90 607057 21108 21125 kkddkddkddkddkddkk TGCCAGACTTGGTGAGCA 91 607095 21100 21115 keekeekeekeekeek GGTGAGCACGATAATG 92 607135 21100 21117 kkeekeekeekeekeeke TTGGTGAGCACGATAATG 93 607136 21104 21121 kkeekeekeekeekeeke AGACTTGGTGAGCACGAT 94
TABLE-US-00017 TABLE 17 Effect of ASOs targeting mouse PK-M exon 10 on PK-M splicing in vivo PK-M1, PK-M1, PK-M2, PK-M2, exons 8, exons 9, exons 8, exons 10, 9 primer 11 primer 10 primer 11 primer Isis probe set probe set probe set probe set No. (% PBS) (% PBS) (% PBS) (% PBS) n/a 100 100 100 100 606989 421 476 ND 86 606996 326 315 ND 25 607001 398 429 65 ND 607003 365 353 69 ND 607016 435 389 56 ND 607034 525 626 ND 148 607041 335 381 78 ND 607042 240 306 92 ND 607055 987 859 73 ND 607057 327 126 34 ND 607095 428 171 51 ND 607135 475 39 54 ND 607136 389 265 71 ND