Sol-gel chip using porous substrate for entrapping small molecules and screening method of small molecules specific material using thereof
10378054 ยท 2019-08-13
Assignee
Inventors
Cpc classification
C12Q1/6876
CHEMISTRY; METALLURGY
International classification
G01N33/543
PHYSICS
Abstract
There is provided a sol-gel chip using a porous substrate for entrapping small molecules and a method for screening a small molecule-specific material using the same, and more particularly, a porous substrate sol-gel chip characterized in that a sol-gel composition for entrapping small molecules is spotted on a surface of the porous substrate, a method for manufacturing the porous substrate sol-gel chip for entrapping small molecules, and a method for screening a material specifically binding to the small molecules using the porous substrate sol-gel chip for entrapping small molecules. According to the present invention, the small molecules can be effectively entrapped in the chip and the inflow of aptamers can be maintained as compared with the existing methods and thus aptamers specific to an extensive range of small molecules can be more easily selected.
Claims
1. A method for manufacturing a porous substrate-sol-gel chip for selecting aptamers targeting small molecules, wherein said small molecules are selected from the group consisting of metabolites, toxins, and insecticidal compounds, the method comprising: (a) forming, in a porous substrate having pores with a depth of 3000 nm or more and a diameter of 1000 nm or more, a surface layer having pores with a depth of 100 to less than 3000 nm and a diameter of 445 nm to less than 1000 nm; and (b) spotting a sol-gel composition on said surface layer of the porous substrate, to immobilize the sol-gel composition thereon, wherein the sol-gel composition contains small molecules for which said aptamers are to be selected, so that specific aptamers targeting the small molecules will bind to the small molecules in the sol-gel spotted on the surface layer and non-specific aptamers will be prevented at a boundary of the spotted sol-gel composition from being trapped by voids and pores of the porous substrate, wherein the sol-gel composition comprises 27.5% of SolB I; 10% of SolB II; 12.5% of SolB H; 12.5% of SolB S(buffer) and 25% of DW, wherein SolB I is at least one first silicate monomer selected from a group consisting of methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS) and tetramethoxysilicate (TMS) methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS), and tetramethoxysilicate (TMS), SolB II is at least one second silicate monomer selected from a group consisting of methyltrimethoxysilicate (MTMS), 3-aminotrimethoxysilane (3-ATMS), polyglycerylsilicate (PGS), diglycerylsilane (DGS), polyvinylacetate, polyvinylpyrrolidone, glyceryl metaacrylate, hydroxyethyl acrylate, N,N-dicusinimidilcarbonate (DSC), 1,3,5-trimethylbenzene, cetyltrimethylammonium chloride, cetyltrimethylammonium bromide, 3-(triethoxysily) propyl sucinic unhydride, N-(3-triethoxysily propyl)-4-hydroxy butylamide (SIT8189.5), N-(triethoxysilyl propyl) gluconamide (SIT8189.0) 50%, pluronic L121 (polyoxypropylene-polyoxyethylene block copolymer), and tetramethyl ammonium hydroxide, and SolB H is a solution selected from a group consisting of HCl, H.sub.2SO.sub.4, HNO.sub.3 and CH.sub.3COOH.
2. The method of claim 1, wherein the porous substrate is selected from a group consisting of silicon, glass, and plastic.
3. The method of claim 1, wherein the porous surface of the porous substrate is fabricated by anodic etching, chemical etching, patterning, carbon nanotube forming, or polyvinyl acetate (PVAc) coating.
4. The method of claim 2, wherein the porous substrate is fabricated by subjecting monocrystalline silicon to anodic etching at a current of 0.510 mA/Cm.sup.2 for 520 minutes.
5. The method of claim 1, wherein the small molecules are metabolites.
6. The method of claim 1, wherein the small molecules are toxins.
7. The method of claim 1, wherein the small molecules are insecticidal compounds.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(8) In one aspect, the present invention is directed to a method for manufacturing a porous silicon sol-gel chip for entrapping small molecules, the method comprising: (a) preparing a porous substrate having pores with a depth of 1003000 nm and a diameter of 1001000 nm; and (b) spotting a sol-gel composition containing small molecules on a surface of the porous substrate.
(9) The porous silicon sol-gel chip (PS-SG chip) according to the present invention may be used as a flatform finding an aptamer specifically binding to a small molecule compound (
(10) In the present invention, the porous substrate may be selected from a group consisting of silicon, glass, and plastic. A porous surface of the porous substrate may be fabricated by anodic etching, chemical etching, patterning, carbon nanotube forming, or polyvinyl acetate (PVAc) coating, but is not limited thereto. Any method that can form pores having a depth of 1003000 nm and a diameter of 1001000 nm in the surface of the substrate may be employed without limitation.
(11) In one embodiment of the present invention, the porous silicon substrate may be fabricated by subjecting monocrystalline silicon to anodic etching at a current of 0.510 mA/Cm.sup.2 for 520 minutes.
(12) If the amount of current for anodic etching is less than 0.5 mA/Cm.sup.2, depths and sizes of pores formed in the silicon surface are too small, resulting in degrading the immobilizing ability of the sol-gel spot. If more than 10 mA/Cm.sup.2, depths and sizes of the pores are large, and thus, at the time of assaying using the chip, compounds such as aptamers and the like are trapped between the pores, resulting in decreasing efficiency in selecting an aptamer specific to a small molecule compound.
(13) In addition, if the time for anodic etching is 5 minutes or less, depths and sizes of pores formed are too small, resulting in degrading the immobilizing ability of the sol-gel spot. If 20 minutes or more, depths and sizes of the pores are large, and thus, at the time of assaying using the chip, compounds such as aptamers and the like are trapped between the pores, resulting in decreasing efficiency in selecting an aptamer specific to a small molecule compound.
(14) In another aspect of the present invention, glass as the support is subjected to chemical etching using a hydrofluoric acid (HF) solution, to fabricate the porous surface. In the case of glass etching using hydrofluoric acid (HF), the same hydrofluoric acid solution that is used in fabricating the porous silicon substrate is used. The change in porosity property of the surface according to the exposure time of glass to the hydrofluoric acid solution (1 minute, 3 minutes, 5 minutes, 10 minutes, 20 minutes, 30 minutes, and 1 hour) is measured, and as a result, at the time of etching for 1020 minutes, pores having a depth of 1003000 nm and a diameter of 1001000 nm may be fabricated in the surface of the glass substrate.
(15) In still another aspect of the present invention, in order to fabricate a carbon nanotube (CNT) coating porous glass surface, a glass piece is immersed in a CNT solution so that CNTs are adsorbed onto the glass. In order to fabricate CNT coating glass, a glass sample is treated with a mixture solution of sulfuric acid/peroxide (3:1, V:V) for 10 minutes, and then the glass piece is immersed in a CNT solution of 0.1 mg/m using ortho-dichlorobenzene as a solvent for 10 seconds. As a result, it may be confirmed that nanotubes having a depth of 1003000 nm are formed on the surface of the glass substrate.
(16) In still another aspect of the present invention, in order to form a surface of plastic (polymethyl methacrylate, PMMA) by using polyvinyl acetate (PVAc), a mixture of benzene as a solvent and 110% of PVAc is coated on the plastic PMMA substrate by a spin coating method. The porous surface having pores with a depth of 1003000 nm and a diameter of 1001000 nm may be fabricated under conditions of RPM: 20006000, REM: 010 seconds, and spin time: 320 seconds.
(17) In one embodiment of the present invention, the pores are formed in the silicon surface by using an anodic etching method. Any conventional method that can form pores each having an average depth of 663.45 nm and an average diameter of 445.52 nm, such as a patterning method or the like, may be employed.
(18) In the present invention, if the depth of the pore formed in the silicon wafer is 100 nm or smaller, the immobilizing ability of the sol-gel spot may be degraded. If 3000 nm or greater, compounds such as aptamers and the like may be trapped between the pores, resulting in increasing a background signal, at the time of assaying using the chip.
(19) Similarly, in the present invention, if the diameter of the pore formed in the silicon wafer is 100 nm or smaller, the immobilizing ability of the sol-gel spot may be deteriorated. If 1000 nm or greater, compounds such as aptamers and the like may be trapped between the pores, resulting in decreasing the selecting ability of an aptamer specific to a small molecule compound, at the time of assaying the chip.
(20) In the present invention, the porous silicon (Si) surface may be fabricated by anodic dissolution of monocrystalline silicon dissolved in hydrofluoric acid (HF) (
(21) In the present invention, the super-porousified silicon wafer used as a comparative example has a pore depth of 30004000 nm and a pore diameter of 10002000 nm.
(22) A surface of the super-porousified chip having micro- and nano-morphology has good property in increasing the probe concentration in the application of a microarray, but is not in an optimized state for immobilizing the sol-gel chip entrapping small molecule compounds.
(23) Voids between the condensed sol-gel and the surfaces of micropores of porous silicon were uniformly observed on the super-porousified surface (
(24) As shown in
(25) Therefore, the porous substrate of the present invention is characterized by having micro or nano-sized pores.
(26) An upper left image of
(27) In the present invention, the small molecules may be selected from a group consisting of metabolites, toxins, and insecticidal compounds, and the sol-gel composition may include one or a combination of two or more selected from a group consisting of methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS), tetramethoxysilicate (TMS) methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS) and tetramethoxysilicate (TMS), methyltrimethoxysilicate (MTMS), 3-aminotrimethoxysilane (3-ATMS), polyglycerylsilicate (PGS), diglycerylsilane (DGS), polyvinylacetate, polyvinylpyrrolidone, glyceryl metaacrylate, hydroxyethyl acrylate, N,N-dicusinimidilcarbonate (DSC), 1,3,5-trimethylbenzene, cetyltrimethylammonium chloride, cetyltrimethylammonium bromide, 3-(triethoxysily) propyl sucinic unhydride, N-(3-triethoxysily propyl)-4-hydroxy butylamide (SIT8189.5), N-(triethoxysilyl propyl) gluconamide (SIT8189.0), pluronic L121, tetramethyl ammonium hydroxide, SolB III (aminopropyltriethoxysilane (APTES)), 3-glycidoxypropyltrimethoxysilane (GPTMOS), N-triethoxysilylpropyl-O-polyethylene oxide urethane (PEOU), glycerol, PEG200, PEG400, PEG600, PEG1350, and PEG8000.
(28) The small molecule used in the example of the present invention was bisphenol A (BPA), and was first entrapped in the porous silicon sol-gel chip. The sol-gel composition was immobilized to the porous substrate in a microarray type.
(29) In the present invention, the porous silicon sol-gel chip entrapping the small molecules may be characterized by being used for selecting aptamers specific to the small molecules.
(30) In another aspect, the present invention is directed to a porous silicon sol-gel chip for entrapping small molecules, characterized in which a sol-gel spot entrapping the small molecule compound is immobilized on a surface of a porous substrate having pores having a depth of 1003000 nm and a diameter of 1001000 nm.
(31) The technology of entrapping proteins and antibodies in the specific sol-gel composition was established in recent protein chip studies. The present invention confirmed a method of entrapping small molecules in sol-gel. In one embodiment of the present invention, fluorescent indicators (fluorescein sodium salt, 376.27 Da)) with two kinds of sol-gel formulations, Formula A (SolB 127.5%; SolB II 10%; SolB H 12.5%; SolB S 12.5%; DW 25%) and Formula B (SolB 125%; SolB II 7.5%; SolB III 5%; SolB H 12.5%; SolB S 12.5%; DW 25%) of SolB Complete Kit (PCL Company, Korea, Homepage: pcichip.com) were spotted, and after washing with phosphate buffered saline (PBS), it was confirmed whether or not the fluorescence of fluorescein was maintained. As a result, it was confirmed that the entrapping of small molecules was successfully maintained in the sol-gel Formula A (Table 1).
(32) Here, SolB I is at least one first silicate monomer selected from a group consisting of methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS) and tetramethoxysilicate (TMS) methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS), and tetramethoxysilicate (TMS).
(33) SolB II is at least one second silicate monomer selected from a group consisting of methyltrimethoxysilicate (MTMS), 3-aminotrimethoxysilane (3-ATMS), polyglycerylsilicate (PGS), diglycerylsilane (DGS), polyvinylacetate, polyvinylpyrrolidone, glyceryl metaacrylate, hydroxyethyl acrylate, N,N-dicusinimidilcarbonate (DSC), 1,3,5-trimethylbenzene, cetyltrimethylammonium chloride, cetyltrimethylammonium bromide, 3-(triethoxysily) propyl sucinic unhydride, N-(3-triethoxysily propyl)-4-hydroxy butylamide (SIT8189.5), N-(triethoxysily)propyl)gluconamide (SIT8189.0) 50%, pluronic L121, and tetramethyl ammonium hydroxide. SolB III is at least one additive selected from a group consisting of aminopropyltriethoxysilane (APTES), 3-glycidoxypropyltrimethoxysilane (GPTMOS), N-triethoxysilylpropyl-O-polyethylene oxide urethane (PEOU), glycerol, PEG200, PEG400, PEG600, PEG1350, and PEG8000.
(34) SolB H is composed of a solution selected from a group consisting of HCl, H.sub.2SO.sub.4, HNO.sub.3 and CH.sub.3COOH, SolB S (buffer), and distilled water (DW). As the SolB kit used in the present invention, the SolB complete kit purchased from the PCL Company (Korea) was used.
(35) Meanwhile, the sol-gel spot containing small molecules, which was spotted on a surface of the poly(methyl methacrylate) (PMMA) micro well, exhibited low adhesive ability with the plastic surface. At the first stage of the assay, when washing with the PBS buffer, all spots were washed out. Even the use of Sol-Gel Composition A optimized in Example 2 of the present invention came to the same results.
(36) TABLE-US-00001 TABLE 1 Yield of spots after washing and scratching on the porous Si and PMMA surface Spotting Washing Scratching Porous Si 64 (8 8) 64 (100%) 63 (98.4%) PMMA 64 (8 8) 0 (0%) 0 (0%)
(37) Table 1 shows the number of spots maintained after washing and scratching sol-gel spots (64 spots) spotted on the porous silicon (Si) surface and sol-gel spots (64 spots) spotted on the poly(methyl methacrylate) (PMMA) surface.
(38) It may be seen that, for the PMMA surface, all the spots were washed out during a washing procedure, and 64 spots on the porous silicon surface used in the present invention were maintained even during the washing procedure and the scratching procedure.
(39) In the example of the present invention, a chip immobilizing a sol-gel spot entrapping bisphenol A (BPA) as a small molecule on the porous silicon surface (PS-SG chip) was manufactured, and the BPA aptamer fluorescent-labeled on the chip was treated and washed. As a result, it was confirmed that the aptamer successfully permeated into the sol-gel chip and bound to the BPA, and thus exhibited fluorescence.
(40) In still another aspect, the present invention is directed to a method for screening a small molecule-specific aptamer, the method comprising: (a) treating aptamer candidate groups on the porous silicon sol-gel chip for entrapping small molecules; and (b) selecting an aptamer specifically binding to a small molecule compound in a sol-gel spot. The aptamer screening method is characterized by using a porous silicon sol-gel chip in which the sol-gel spot entrapping a small molecule compound is immobilized on a surface of the porous substrate.
(41) The PS-SG chip of the present invention may be used in selecting an aptamer to a small molecule target material in vitro by using a systematic evolution of ligands by exponential enrichment (SELEX) protocol. The SELEX is a screening technology of intensively screening very specific ligands or aptamers by repeating selection and amplification in a nucleic acid library having huge combinations (10.sup.1310.sup.15). In the existing SELEX procedure, a small molecule target needed to chemically bind to a substrate by a linker molecule or a mass carrier at a first stage. In this case, suitability in physical/chemical properties of a substrate with respect to a target material needed to be considered, and the binding efficiency of the target material and the substrate needed to be considered in a screening procedure for each stage of the SELEX. Some aptamers were successfully isolated by the existing method, but many compounds were not efficiently immobilized during the SELEX procedure.
(42) In the present invention, the PS-SG chip of the present invention entrapping small molecules and maintaining the inflow of aptamers can open the road to develop aptamers specific to a wide range of small molecules.
(43) In the present invention, the method for screening a small molecule-specific aptamer may further include: c) heat-treating the porous substrate sol-gel chip to which an aptamer binds, to collect an eluted aptamer.
(44) In the SELEX technology in the related art, methods of collecting aptamers from the aptamer-target complexes have been reported (Sevilimedu, A. et al., Nucleic Acids Res 36:3118, 2008, Ahn, J. Y. et al., Mol. Cell. Toxicol., 4:100, 2008, Park, S. et al., Lab Chip, 9:1206, 2009). The aptamers binding to the target material are completely collected, so that the number of cycles necessary for the SELEX procedure can be decreased and the resources can be saved. The means for releasing the bound aptamer may be determined depending on the property of the target material binding to the aptamer. In the present invention, a method of heat-eluting the aptamer from the target material was established. Since the structure of the aptamer is determined by hydrogen bonds between bases constituting the aptamer, the structure is deformed by heat to lose the binding force with the target.
(45) In the present invention, the aptamer binding to the target material of the sol-gel chip is eluted by heat treatment, followed by collection and PCR amplification, to thereby confirm the collection of aptamers. This confirmed that the aptamer may be efficiently collected without excessive denaturation of an aptamer sequence in the PS-SG chip.
(46) In another aspect, the present invention is directed to a method for screening a material specifically binding to a small molecule by using a porous silicon sol-gel chip in which a sol-gel spot entrapping a small molecule compound is immobilized on a surface of a porous substrate, the method comprising: (a) treating material candidate groups capable of binding to the small molecule compound on a porous silicon sol-gel chip for entrapping small molecules; (b) selecting and isolating a material specifically binding to the small molecule compound in a sol-gel spot; and (c) identifying the isolated material specifically binding to the small molecule compound.
(47) In the present invention, as the material specifically binding to the small molecule compound, any material that can be combined with the small molecule compound immobilized in the sol-gel spot, such as protein, aptamer, antibody, enzyme, and the like, may be screened. The bound material may be identified by a general method, and for example, methods such as MASS, MALDI-TOFF, NMR, and the like may be employed.
(48) Hereinafter, the present invention will be described in detail with reference to the examples. These examples are only for exemplifying the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not construed to be limited to these examples.
Example 1: Fabrication of Porous Silicon Surface
(49) Porous silicon (PS) has an anisotropic and nanocrystal silicon structure having a high surface area, and may be fabricated from monocrystalline silicon by a galvanostatic electrochemical or photochemical etching in the presence of hydrofluoric acid (HF). The above procedure is controlled by several factors, such as density, etching time, crystal direction, silicon dopant type, doping level, illumination, electrode constitution, temperature, surface roughness, and the like.
(50) The fabrication of the porous silicon was described in several documents (Steinhauer, C et al., Anal Biochem, 341: 204, 2005; Finnskog, D. et al., J Proteome Res, 3: 988, 2004). Shortly, a two-compartment electrochemical cell having sapphire glass (Melees Griot BV) formed on one-sided surface was used for illumination at the time of anodizing, and the wafer was etched at a constant current of 2 mA/Cm.sup.2 for 10 minutes.
(51) The pores formed in the surface of the silicon substrate fabricated in the present example were confirmed by SEM, and as a result, had an average depth of 663.45 nm and an average diameter of 445.52 nm.
Example 2: Establishment of Sol-Gel Composition for Immobilizing Small Molecule Compound
(52) Sol-gel was spotted on a surface of a porous silicon chip, and the sol-gel material for immobilizing the small molecule compound was prepared by the method recommended from the manufacture company (SolB complete kit, PCL Company, Korea, website: pcichip.com). The fluorescent indicator was prepared with two different sol-gel formulations to investigate the immobilization performance. That is, the two sol-gel formulations (Formula-A: SolB I 27.5%; SolB II 10%; SolB H 12.5%; SolB S 12.5%; DW 25%, Formula-B: SolB 125%; SolB II 7.5%; SolB III 5%; SolB H 12.5%; SolB S 12.5%; DW 25%) and the fluorescent indicator were uniformly mixed with the SoIB agent to prepare sol-gel microarrays.
(53) SolB I is at least one first silicate monomer selected from a group consisting of methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS) and tetramethoxysilicate (TMS) methyltriethoxysilane (MTES), ethyltriethoxysilane (ETrEOS), sodium silicate, tetramethyl orthosilicate (TMOS), tetraethyl orthosilicate (TEOS), and tetramethoxysilicate (TMS).
(54) SolB II is at least one second silicate monomer selected from a group consisting of methyltrimethoxysilicate (MTMS), 3-aminotrimethoxysilane (3-ATMS), polyglycerylsilicate (PGS), diglycerylsilane (DGS), polyvinylacetate, polyvinylpyrrolidone, glyceryl metaacrylate, hydroxyethyl acrylate, N,N-dicusinimidilcarbonate (DSC), 1,3,5-trimethylbenzene, cetyltrimethylammonium chloride, cetyltrimethylammonium bromide, 3-(triethoxysily) propyl sucinic unhydride, N-(3-triethoxysily propyl)-4-hydroxy butylamide (SIT8189.5), N-(triethoxysily)propyl)gluconamide (SIT8189.0) 50%, pluronic L121, and tetramethyl ammonium hydroxide. SolB III is at least one additive selected from a group consisting of aminopropyltriethoxysilane (APTES), 3-glycidoxypropyltrimethoxysilane (GPTMOS), N-triethoxysilylpropyl-O-polyethylene oxide urethane (PEOU), glycerol, PEG200, PEG400, PEG600, PEG1350, and PEG8000.
(55) SolB H is composed of a solution selected from a group consisting of HCl, H.sub.2SO.sub.4, HNO.sub.3 and CH.sub.3COOH, SolB S (buffer), and distilled water (DW).
(56) The fluorescent indicator was diluted into 1525 nM, 781 nM, 391 nM, and 195 nM for each single spot, and then spotted in a 96-well type micro-plate, followed by gelation for 16 hours. After that, 100 l of a PBS solution was added thereto, and then while the reaction is allowed to proceed for 0 hour, 1 hour, 3 hours, and 5 hours, the light intensity of fluorescent indicator was measured and the results thereof were tabulated in
(57) The fluorescent intensity was maintained for the overall time for Sol-Gel Formula A, and the fluorescent intensity was rapidly reduced for elapse of one hour for Sol-Gel Formula B. This shows that Formula A well entraps the fluorescent indicator and thus release of the fluorescent indicator does not occur, but Formula B allows the release of fluorescence due to weak entrapment force thereof.
(58) Therefore, Sol-Gel Formula A had superior ability to entrap the small molecule compound in an inner pore, and thus Sol-Gel Formula A was used to sol-gel-entrap small molecules for aptamer binding.
Example 3: BPA and BPA Aptamer Microarray
(59) As a target analyte of a sol-gel microarray for detecting small molecules, BPA (bisphenol A; 4,4-dihydroxy-2,2-diphenylpropane, Sigma-Aldrich, USA) was used. BPA was dissolved in 50% dimethyl formamide (DMF) to have a final concentration of 100 mM.
(60) The sol-gel mixture containing the target material, together with a negative control not entrapping a target material and a positive control entrapping Cy3 fluorescent indicator, was spotted by using a non-contact type dispenser, sciFLEXARRAYER S11 (Scieninon AG, Germany), and the volume of a single spot was measured by using an automatic volume confirmation (sciDROPVOLUME) software.
(61) The sol-gel material entrapping BPA (100 mM) was spotted on the surface of the porous silicon by using the non-contact type dispenser, and the volume of a single droplet was about 4 nL. The distance between spots was set 400 m, and each chip included 64 spots in an array of 88. The sol-gel entrapping BPA was spotted in an alphabet shape of L, U, N, and D, and the negative control sol-gel composition not containing BPA was spotted in the rest of the spaces other than the alphabet.
(62) In order to confirm the binding of BPA and the specific aptamer thereof, the BPA aptamer was labeled with Cy3-UTP (GeneChem Inc., Korea) by using terminal deoxynucleotidyl transferase.
(63) The anti-BPA aptamer sequence is as follows.
(64) TABLE-US-00002 Anti-BPAaptamersequence (SEQ.ID.No.1) 5-GGGCCGTTCGAACACGAGCATGCCGGTGGGTGG TCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCA TCACGGGTTCGCACCAGGACAGTACTCAGGTCATCC TAG-3
(65) A reaction mixture solution where 5 reaction buffer 4 l, ssDNA aptamer 0.5 nmol, Cy3-dUTP 1 nmole, and 30U TdT enzyme were contained in a 20 l reaction solution was prepared, and then the reaction was allowed to proceed at 37 C. for 4 hours. The fluorescent-labeled DNA aptamer was precipitated with ethanol at 70 C. In order to allow the aptamer to form a structure, 100 pmole BPA aptamer was dissolved in 50 l of 1PBS, and heated at 95 C. for 10 minutes, and then cooled at room temperature for 3 hours. The PS-SG chip entrapping BPA was treated with a blocking buffer (containing 20 g/mL tRNA, in 1PBS) for 2 hours, and was reacted by using 2 M of Cy3-labeled BPA aptamer for 1 hour. The chip after the reaction was washed with a washing solution (0.2% Tween-20 in 1PBS) for 15 minutes three times, and then dried for 10 minutes. The sol-gal array results were scanned and analyzed by using a fluorescent scanner (Typhoon FLA9000, GE Healthcare).
(66)
(67) As a result, as shown in
(68) For this reason, it may be seen that the sol-gel entrapping the small molecule compound such as BPA is successfully immobilized onto the porous silicon surface, and the entrapped small molecule compound can specifically bind to the aptamer.
Example 4: Collection of Aptamer by Heat Treatment
(69) The sol-gel composition entrapping BPA was spotted in an alphabet shape of H, and was subjected to binding reaction with the specific aptamer, and then washed with 300 l of PBS. One chip was heat-treated at 95 C. for 1 minute, and the other chip was heat-treated for 5 minutes. After the heat treatment, the released aptamer was collected by ethanol precipitation, and PCR-amplified by 15 cycles.
(70) PCR conditions were as follows: initial heat treatment at 94 C. for 5 minutes, 15 cycles of 94 C., 55 C., and 72 C. for 30 seconds for each temperature, and then final elongation for 7 minutes. PCR products (86 bp) were confirmed by electrophoresis using 2% agaros gel.
(71) In the present invention, after the heat treatment, the fluorescent signal of the aptamer combined with the sol-gel spot was monitored. As shown in
(72) The present invention has been described in detail based on particular features thereof, and it is obvious to those skilled in the art that these specific technologies are merely preferable embodiments and thus the scope of the present invention is not limited to the embodiments. Therefore, the substantial scope of the present invention is defined by the accompanying claims and equivalent thereof.