Fungal endophytes for improved crop yields and protection from pests
10375966 ยท 2019-08-13
Assignee
Inventors
Cpc classification
International classification
Abstract
The invention provides a synthetic combination of a crop and at least one fungal endophyte, wherein the crop is a host plant of the endophyte. Provided are also methods and compositions for producing such synthetic combinations. The endophyte reproduces and enhances the agronomic characteristics of the crop. Methods for inoculating the host plant with the endophyte, for propagating the host-endophyte combination, and for detecting the presence of the endophyte and of its metabolites within a host plant are also described.
Claims
1. A method for improving drought resistance in a cotton plant, the method comprising: contacting a cotton seed with a fluid seed coating comprising purified filamentous, spore-forming, facultative fungal endophytes of at least one Chaetomium species wherein the contacted seed contains at least 10 CFU up to 10,000 CFU of the facultative fungal endophyte coated onto the surface of the seed, wherein the facultative fungal endophytes are present in the fluid seed coating in an amount effective to improve drought resistance of a cotton plant grown from the contacted seed compared to a reference cotton plant grown from a reference seed.
2. The method of claim 1, wherein the fluid seed coating contains at least 100 (10^2) spores/ml or 100,000 (10^4) spores/g dry weight of the facultative fungal endophytes.
3. The method of claim 1, wherein the facultative fungal endophytes are present in the fluid seed coating in an amount effective to increase biomass.
4. The method of claim 1, wherein the facultative fungal endophytes are species Chaetomium globosum.
5. The method of claim 4, wherein the cotton plant is variety LA122.
6. The method of claim 1, wherein the cotton plant is variety LA122.
7. The method of claim 1, wherein the facultative fungal endophytes are present in the fluid seed coating in an amount effective to reduce yield loss.
8. The method of claim 7, wherein yield loss is reduced by at least 5%.
9. The method of claim 7, wherein the reduction in yield loss results in a yield increase of at least 5%.
10. The method of claim 1, wherein enhanced resistance to drought stress is assessed by withholding water from 7-day old seedlings of the cotton plant grown in the greenhouse, wherein the seedlings have increased time to wilt as compared to a seedling grown from a reference seed.
11. The method of claim 1, wherein the seed is surface sterilized before contacting the seed with the fluid seed coating.
12. The method of claim 1, wherein the contacted seed contains at least 100 CFU, at least 300 CFU, at least 1,000 CFU, at least 3,000 CFU, or at least 10,000 CFU of the facultative fungal endophytes coated onto the surface of the seed.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
DETAILED DESCRIPTION OF THE INVENTION
(26) Endophytic fungi are ubiquitous in nature, infecting virtually all plants in both natural and agronomic ecosystems. Plants commonly harbor a diversity of fungi living within their tissues as asymptomatic endophytes that can provide protection from a range of biotic and abiotic stressors. The present disclosure describes certain fungal endophytes that can be pathogens, parasites or antagonists to plant pathogens, insects, and nematode pests, thereby providing health and performance benefits to crop plants. The symbiotic endophyte-host relationships can provide several general health and fitness benefits to the host plant, such as enhancement of nutrition, increased drought tolerance and/or chemical defense from potential herbivores and often enhanced biomass production. Root-colonizing mycorrhizae survive on photosynthetic carbohydrates from the plant, and in return, aid in the solubilization and uptake of water and minerals to the host, which can lead to the promotion of seed germination and plant growth. Additionally, the association of a fungal endophyte with a host plant often provides protection from pathogens or tolerance to a variety of biotic and abiotic stresses, such as insect infestation, grazing, water or nutrient deficiency, heat stress, salt or aluminum toxicity, and freezing temperatures. Host growth and fitness promotion and protection are thought to be achieved through multiple beneficial properties of the endophyte-host association.
(27) These fungal endophytes provided in Table 1 were originally collected as fungal endophytes of cotton. These endophytic fungi can be inoculated to live within cotton using either seed, soil or foliar applications and exhibited surprisingly beneficial effects by providing protection from pest infestation. Pests can be nematode and/or insect pests. In addition, these endophytic fungi have an unexpected beneficial effect on cotton yield.
(28) Described is the application of beneficial fungi to establish endophytically within crop plants to improve plant performance and yield while conferring protection against insect and nematode pests. In this regard, the present invention overcomes the limitations of the prior art such as the susceptibility of the fungi to degradation by UV light, desiccation or heat after exposure to the environment following application as an inundative soil or foliar biopesticide. Inoculation and endophytic establishment of the fungi within the plant protects the fungi from UV light, desiccation, and unfavorable temperatures, while harboring the fungi in the very plant tissues they are intended to protect. Introducing fungi to live endophytically within plants requires no genetic modification of the plant or microorganisms, and the fungi themselves can be a source for natural products. In various embodiments, the fungal inoculant can be formulated and applied, for example, as treatment of seeds, in furrow applications, before or during planting, or as foliar application after plant germination, and after inoculation, the fungal endophytes provide season-long protective effects and higher crop yields (approximately 25% higher). In certain embodiments, the increase of yield is about 5%, 10%, 15%, 20%, 30%, 40%, 45%, 50%, or greater than 50% relative to a crop to which no endophyte composition has been applied. In further embodiments, the increase of yield is the result of reduction of loss that comprises reduction of loss due to insect infestation or drought and the loss is less than 50%, 40%, 30%, 20%, 10%, 5%, or 5% relative to a crop to which no endophyte composition has been applied. In certain embodiments, the crop is cotton and the reduction of loss comprises reduced boll damage.
(29) Thus, in one aspect, the invention provides a combination (also termed a symbiotum) of a host plant and an endophyte that allows for improved agronomic properties of host plants. The combination may be achieved by artificial inoculation, application, or other infection of a host plant or seeds thereof, such as a cotton plant or seed thereof, or host plant tissues, with a fungal endophyte strain of the present invention. Thus, a combination achieved by such an inoculation is termed a synthetic combination, synthetic composition, synthetic seed coating, and/or synthetic pest-resistant seed composition. The fungal endophyte may be present in intercellular spaces within plant tissue, such as the root. Its presence may also occur or may also be maintained within a plant or plant population by means of grafting or other inoculation methods such as treating seeds, plants or parts thereof with endophyte mycelia, or endophyte spores. In certain embodiments, the plant, part of the plant, roots, seed, or leaves are sterilized to remove microorganisms before applying the endophyte. In particular embodiments, seeds are sterilized to remove native endophytes before adding the endophyte compositions herein described. In certain aspects, the ability of the seed to germinate is not affected by the sterilization.
(30) The invention also provides methods for detecting the presence of the fungal endophyte of the present invention within a host plant. This may be accomplished, for instance, by isolation of total DNA from tissues of a potential plant-endophyte combination, followed by PCR, or alternatively, Southern blotting, western blotting, or other methods known in the art, to detect the presence of specific nucleic or amino acid sequences associated with the presence of a fungal endophyte strain of the present invention. Alternatively, biochemical methods such as ELISA, HPLC, TLC, or fungal metabolite assays may be utilized to determine the presence of an endophyte strain of the present invention in a given sample of crop tissue. Additionally, methods for identification may include microscopic analysis, such as root staining, or culturing methods, such as grow out tests or other methods known in the art (Deshmukh et al. 2006). In particular embodiments, the roots of a potential grass plant-endophyte combination may be stained with fungal specific stains, such as WGA-Alexa 488, and microscopically assayed to determine fungal root associates.
(31) In certain embodiments, the agronomic qualities may be selected from the group consisting of: increased biomass, increased tillering, increased root mass, increased flowering, increased seed yield, and enhanced resistance to biotic and/or abiotic stresses, each of these qualities being rated in comparison to otherwise identical plants grown under the same conditions, and differing only with respect to the presence or absence of a fungal endophyte. The synthetic combinations and methods of the present invention may be applied to respond to actual or anticipated stresses. Such stresses may include, for instance, drought (water deficit), cold, heat stress, nutrient deficiency, salt toxicity, aluminum toxicity, grazing by herbivores, insect infestation, nematode infection, and fungal, bacteria or viral infection, among others.
(32) The present disclosure provides, in one embodiment, fungal endophytes selected from those in Table 1 that negatively affect the reproduction of insect herbivores feeding on leaves above ground (cotton aphids, Aphis gossypii) and plant parasitic nematodes attacking roots below ground (root knot nematodes, Meloidogyne incognita). In addition, improved plant performance and yields in colonized versus uncolonized control plants may be observed in field trials employing seed treatment with such endophytes. Plant growth enhancement and increased resistance to root knot nematodes was demonstrated in cotton, for example, employing Chaetomium globosum as an endophyte in greenhouse trials. In addition and as a further non-limiting illustrative example, using Beauveria bassiana as an endophyte in cotton, reductions in insect (cotton aphid) reproduction was demonstrated in both greenhouse and field trials. The endophytic presence of Paecilomyces lilacinus and Beauveria bassiana also had negative effects on the host selection behavior of key sucking bug pests (Lygus hesperus and Nezara viridula) that attack developing flowers and fruits in cotton. Furthermore, in field trials using Beauveria bassiana as an endophyte in cotton positive effects on plant performance and higher yields in endophyte colonized versus uncolonized control plants was demonstrated.
(33) Metabolomic differences between the plants can be detected using methods known in the art. For example, a biological sample (whole tissue, exudate, phloem sap, xylem sap, root exudate, etc.) from the endophyte-associated and reference agricultural plants can be analyzed essentially as described in Fiehn et al., (2000) Nature Biotechnol., 18, 1157-1161, or Roessner et al., (2001) Plant Cell, 13, 11-29. Such metabolomic methods can be used to detect differences in levels in hormones, nutrients, secondary metabolites, root exudates, phloem sap content, xylem sap content, heavy metal content, and the like.
(34) In another embodiment, the present invention contemplates methods of coating the seed of a plant with a plurality of endophytes, as well as seed compositions comprising a plurality of endophytes on and/or in the seed. The methods according to this embodiment can be performed in a manner similar to those described herein for single endophyte coating. In one example, multiple endophytes can be prepared in a single preparation that is coated onto the seed. The endophytes can be from a common origin (i.e., a same plant). Alternatively, the endophytes can be from different plants.
(35) Where multiple endophytes are coated onto the seed, any or all of the endophytes may be capable of conferring a beneficial trait onto the host plant. In some cases, all of the endophytes are capable of conferring a beneficial trait onto the host plant. The trait conferred by each of the endophytes may be the same (e.g., both improve the host plant's tolerance to a particular biotic stress), or may be distinct (e.g., one improves the host plant's tolerance to drought, while another improves phosphate utilization). In other cases the conferred trait may be the result of interactions between the endophytes.
Definitions
(36) In the description and tables herein, a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, the following definitions are provided. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.
(37) When a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of that term. The singular form a, an, and the include plural references unless the context clearly dictates otherwise. For example, the term a cell includes one or more cells, including mixtures thereof.
(38) The term comprising is intended to mean that the compositions and methods include the recited elements, but not excluding others. Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and agriculturally acceptable carriers. Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for applying the compositions of this invention. Embodiments defined by each of these transition terms are within the scope of this invention.
(39) Biological control: the term biological control and its abbreviated form biocontrol, as used herein, is defined as control of a pest, pathogen, or insect or any other undesirable organism by the use of at least one endophyte.
(40) A composition is intended to mean a combination of active agent and at least another compound, carrier or composition, inert (for example, a detectable agent or label or liquid carrier) or active, such as a pesticide.
(41) As used herein, an agricultural seed is a seed used to grow plants in agriculture (an agricultural plant). The seed may be of a monocot or dicot plant, and is planted for the production of an agricultural product, for example grain, food, fiber, etc. As used herein, an agricultural seed is a seed that is prepared for planting, for example, in farms for growing. Agricultural seeds are distinguished from commodity seeds in that the former is not used to generate products, for example commodity plant products.
(42) As used herein, a commodity plant product refers to any composition or product that is comprised of material derived from a plant, seed, plant cell, or plant part of the present invention. Commodity plant products may be sold to consumers and can be viable or nonviable. Nonviable commodity products include but are not limited to nonviable seeds and grains; processed seeds, seed parts, and plant parts; dehydrated plant tissue, frozen plant tissue, and processed plant tissue; seeds and plant parts processed for animal feed for terrestrial and/or aquatic animal consumption, oil, meal, flour, flakes, bran, fiber, and any other food for human or animal consumption; and biomasses and fuel products. Any such commodity plant product that is derived from the plants of the present invention may contain at least a detectable amount of the specific and unique DNA corresponding to the endophytes described herein. Any standard method of detection for polynucleotide molecules may be used, including methods of detection disclosed herein.
(43) As used herein, the phrase agronomically elite plants refers to a genotype or cultivar with a phenotype adapted for commercial cultivation. Traits comprised by an agronomically elite plant may include biomass, carbohydrate, and/or seed yield; biotic or abiotic stress resistance, including drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, cold tolerance, and salt tolerance; improved standability, enhanced nutrient use efficiency, and reduced lignin content.
(44) In certain embodiments, cotton agronomically elite plants include, for example, known cotton varieties AM 1550 B2RF, NG 1511 B2RF, NG 1511 B2RF, FM 1845LLB2, FM 1944GLB2, FM 1740B2F, PHY 499 WRF, PHY 375 WRF, PHY 367 WRF, PHY 339 WRF, PHY 575 WRF, DP 1252 B2RF, DP 1050 B2RF, DP 1137 B2RF, DP 1048 B2RF, and/or DP 1137 B2RF.
(45) As used herein, the phrase culture filtrate refers to broth or media obtained from cultures inoculated with a strain of fungi and allowed to grow. The media is typically filtered to remove any suspended cells, leaving the nutrients, hormones, or other chemicals.
(46) As used herein, the term endophyte refers to an organism capable of living within a plant or plant tissue. An endophyte may comprise a fungal organism that may confer an increase in yield, biomass, resistance, or fitness in its host plant. Fungal endophytes may occupy the intracellular or extracellular spaces of plant tissue, including the leaves, stems, flowers, or roots.
(47) The phrase pest resistance refers to inhibiting or reducing attack from pests. Pest resistance provides at least some increase in pest resistance over that which is already possessed by the plant.
(48) As used herein, the term genotypes refers to the genetic constitution of a cell or organism.
(49) As used herein, the term phenotype refers to the detectable characteristics of a cell or organism, which characteristics are either the direct or indirect manifestation of gene expression.
(50) As used herein, the phrase host plant refers to any plant that an endophytic fungi colonizes. In certain embodiments, the host plant comprises progeny of colonized plant.
(51) As used herein, the phrase increased yield refers to an increase in biomass or seed weight, seed or fruit size, seed number per plant, seed number per unit area, bushels per acre, tons per acre, kilo per hectare, carbohydrate yield, or cotton yield. Such increased yield is relative to a plant or crop that has not been inoculated with the endophyte. In certain embodiments, the increase yield is relative to other commonly used pest treatments or other methods of addressing the biotic or abiotic stress.
(52) As used herein, the phrase biomass means the total mass or weight (fresh or dry), at a given time, of a plant tissue, plant tissues, an entire plant, or population of plants, usually given as weight per unit area. The term may also refer to all the plants or species in the community (community biomass).
(53) As used herein, sticker refers to compounds to enhance binding of spores to the seed surface. Non-limiting examples of such compounds are alginic acid, carrageenan, dextrin, dextran, pelgel, polyethelene glycol, polyvinyl pyrrolidone, methyl cellulose, polyvinyl alcohol, or gelatin.
(54) As used herein, an agriculturally acceptable excipient or carrier is one that is suitable for use in agriculture without undue adverse side effects to the plants, the environment, or to humans or animals who consume the resulting agricultural products derived therefrom commensurate with a reasonable benefit/risk ratio.
(55) As used herein, the term synthetic or the phrase synthetic combination refers to an artificial combination that includes mycelia and/or spores of a endophyte that is or leads to an endophytic fungal-host relationship (also termed a symbiotum) of a host plant and an endophyte. The synthetic combination may be achieved, for example, by artificial inoculation, application, or other infection of a host plant, host plant seeds, or host plant tissues with the endophyte. In addition, the combination of host plant and an endophyte may be achieved by inoculating the soil or growth media of the plant.
(56) The present invention contemplates the use of isolated microbe. As used herein, an isolated microbe is a microbe that is isolated from its native environment, and carries with it an inference that the isolation was carried out by the hand of man. An isolated microbe is one that has been separated from at least some of the components with which it was previously associated (whether in nature or in an experimental setting) or occurs at a higher concentration, viability, or other functional aspect than occurring in its native environment. Therefore, an isolated microbe is partially or completely separated from any other substance(s) as it is found in nature or as it is cultured, propagated, stored or subsisted in naturally or non-naturally occurring environments. Specific examples of isolated microbes include partially pure microbes, substantially pure microbes and microbes cultured in a medium that is non-naturally occurring.
(57) As used herein, a microbe is considered to be native to a plant or a portion of the plant, and is said to be natively present in the plant or a portion of plant, if that plant or portion of the plant contains the microbe, for example, in the absence of any contacting with the microbe preparation, or contains the microbe at much lower concentrations than the contacting with the microbe preparation would provide.
(58) Some of the methods described herein allow the colonization of plant seeds by microbes. As used herein, a microbe is said to colonize a plant or seed when it can exist in a symbiotic or non-detrimental relationship with the plant in the plant environment, for example on, in close proximity to or inside a plant, including the seed.
(59) A population of plants, as used herein, refers to a plurality of plants that were either grown from the seeds treated with the endophytes as described herein, or are progeny of a plant or group of plants that were subjected to the inoculation methods. The plants within a population are typically of the same species, and/or typically share a common genetic derivation.
EXAMPLES
Example 1: Creating Spore Suspensions and Treatment of Seeds
(60) Cultivation of plants and endophytic fungi strains: The cotton seed variety used in particular embodiments was variety LA122 (available from All-Tex Seed, Inc., Levelland, Tex. 79336). Paecilomyces lilacinus and Chaetomium globosum were obtained from cotton plants as described (Ek-Ramos et al. 2013, PLoS ONE 8(6): e66049. doi:10.1371/journal.pone.0066049). Persons of ordinary skill in the art can obtain endophytes suitable for performing the various embodiments of the present invention by performing the procedures described therein. In short, plant samples were rinsed in tap water and surface sterilized by immersion in 70% ethanol for 5 min, 10% bleach solution for 3 min, and rinsed twice with autoclaved distilled water. Samples were blotted dry using autoclaved paper towels. Five individual surface sterilized leaves, squares and bolls (N=15 total samples) were randomly selected and imprinted onto fresh potato dextrose agar (PDA) and V8 media as a way to monitor surface sterilization efficiency. For endophyte isolation, leaves were cut in small fragments of approximately 1 cm.sup.2. Squares and bolls were cut in six pieces. Any fiber present was removed and cut into six smaller pieces. Leaf fragments were placed upside down on PDA and V8 medium plates in triplicate. Each plate contained 3 leaf fragments for a total of 9 fragments assayed per plant. For squares collected early in the season, 3 slices per square were plated on PDA and V8 media as with the leaf fragments. Because of similarity in size and location within a plant, when collected later in the season, squares and bolls from a given plant were plated together on petri dishes containing two square slices, two boll slices and two pieces of fiber. Antibiotics Penicillin G (100 Units/mL) and Streptomycin (100 g/mL) (Sigma, St Louis, Mo., USA) were added to the media to suppress bacterial growth. All plates were incubated in the dark at room temperature for, in average, two weeks until growth of fungal endophyte hyphae from plant tissues was detected.
(61) An inclusive combination of morphological and molecular fungal endophyte identification was employed for identification. Once fungal hyphae were detected growing from the plant material, samples were taken to obtain pure fungal isolates. For identification by PCR, genomic DNA was extracted from mycelium of each isolated fungal strain, following a chloroform:isoamyl alcohol 24:1 protocol and fungal specific primers were used to amplify the ITS (Internal Transcribed Spacer) region of nuclear ribosomal DNA. This region is the primary barcoding marker for fungi and includes the ITS1 and ITS2 regions, separated by the 5.8S ribosomal gene. In order to avoid introducing biases during PCR (taxonomy bias and introduction of mismatches), it has been suggested to amplify the ITS1 region only, therefore the primers ITS1 (5 TCC GTA GGT GAA CCT GCG G 3) (SEQ ID NO:5) and ITS2 (5 GCT GCG TTC TTC ATC GAT GC 3) (SEQ ID NO:6) were used to amplify and sequence the 240 bp ITS1 region of each one of the isolated fungal strains. The resulting sequences were aligned as query sequences with the publicly available databases GenBank nucleotide, UNITE and PlutoF. The last two are specifically compiled and used for fungi identification. Table 1 provides a list of endophytes identified and useful in the present invention. All of these endophytes belong to phylum Ascomycota, subphylum Pezizomycotina, except for Phanerochaete crassa, which belongs to phylum Basidiomycota, subphylum Agaricomycotina, and Pseudozyma sp, which belongs to phylum Basidiomycota, subphylum Ustilaginomycotina. Table 1 shows the species/genus, family, order, subclass, class, and the SEQ ID NO corresponding to the 240 bp ITS1 region for each one of the isolated fungal strains, except for Beauveria bassiana, Aspergillus parasiticus, Lecanicillium lecanii, and Paecilomyces lilacinus, where the sequences shown includes the ITS1, ITS2, 5.8S, 18S, and 28S sequences and were obtained from the UNITE database for GenBank numbers JF837090, JX857815, FJ643076, and EU553283, respectively.
(62) TABLE-US-00001 TABLE 1 endophytes identified and useful in the present invention Genus/Species Family Order Subclass Class SEQ ID NO. Acremonium Incertaesedis Hypocreales Hypocreomycetidae Sordariomycetes 7 alternatum Alternaria Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 8 alternata Alternaria Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 9 brassicae Alternaria Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 10 compacta Alternaria dianthi Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 11 Alternaria Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 12 longipes Alternaria mali Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 13 Alternaria sesami Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 14 Alternaria solani Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 15 Alternaria sp. Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 16 Alternaria Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 17 tenuissima Bipolaris Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 18 spicifera Cercospora Mycosphaerellaceae Capnodiales Dothideomycetidae Dothideomycetes 19 canescens Cercospora Mycosphaerellaceae Capnodiales Dothideomycetidae Dothideomycetes 20 capsici Cercospora Mycosphaerellaceae Capnodiales Dothideomycetidae Dothideomycetes 21 kikuchii Cercospora Mycosphaerellaceae Capnodiales Dothideomycetidae Dothideomycetes 22 zinnia Chaetomium Chaetomiaceae Sordariales Sordariomycetidae Sordariomycetes 23 globosum Chaetomium Chaetomiaceae Sordariales Sordariomycetidae Sordariomycetes 24 piluliferum Chaetomium sp. Chaetomiaceae Sordariales Sordariomycetidae Sordariomycetes 25 Cladosporium Cladosporiaceae Capnodiales Dothideomycetidae Dothideomycetes 26 cladosporioides Cladosporium sp. Cladosporiaceae Capnodiales Dothideomycetidae Dothideomycetes 27 Cladosporium Cladosporiaceae Capnodiales Dothideomycetidae Dothideomycetes 28 uredinicola Cochliobolus sp Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 29 Phanerochaete Phanerochaetaceae Polyporales Incertae sedis Agaricomycetes 30 crassa Phoma Incertae sedis Pleosporales Pleosporomycetidae Dothideomycetes 31 americana Phoma Incertae sedis Pleosporales Pleosporomycetidae Dothideomycetes 32 subherbarum Phomopsis Diaporthaceae Diaporthales Sordariomycetidae Sordariomycetes 33 liquidambari Phomopsis sp. Diaporthaceae Diaporthales Sordariomycetidae Sordariomycetes 34 Pleospora sp. Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 35 Pleosporaceae Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 36 sp. Preussia africana Sporormiaceae Pleosporales Pleosporomycetidae Dothideomycetes 37 Preussia sp. Sporormiaceae Pleosporales Pleosporomycetidae Dothideomycetes 38 Pseudozyma sp. Ustilaginaceae Ustilaginales Ustilaginomycetidae Ustilaginomycetes 39 Pyrenophora Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 40 teres Colletotrichum Glomerellaceae Incertae sedis Sordariomycetidae Sordariomycetes 41 capsici Coniolariella Incertae sedis Xylariales Xylariomycetidae Sordariomycetes 42 gamsii Coniothyrium Coniothyriaceae Pleosporales Pleosporomycetidae Dothideomycetes 43 aleuritis Coniothyrium sp. Coniothyriaceae Pleosporales Pleosporomycetidae Dothideomycetes 44 Corynespora Corynesporascaceae Pleosporales Pleosporomycetidae Dothideomycetes 45 cassiicola Diaporthe sp. Diaporthaceae Diaporthales Sordariomycetidae Sordariomycetes 46 Diatrype sp. Diatrypaceae Xylariales Xylariomycetidae Sordariomycetes 47 Drechslerella Orbiliaceae Orbiliales Orbiliomycetidae Orbiliomycetes 48 dactyloides Embellisia Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 49 indefessa Epicoccum Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 50 nigrum Epicoccum sp. Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 51 Exserohilum Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 52 rostratum Fusarium Nectriaceae Hypocreales Hypocreomycetidae Sordariomycetes 53 chlamydosporum Fusarium sp. Nectriaceae Hypocreales Hypocreomycetidae Sordariomycetes 54 Gibellulopsis Plectosphaerellaceae Incertae sedis Hypocreomycetidae Sordariomycetes 55 nigrescens Gnomoniopsis sp. Glomerellaceae Incertae sedis Hypocreomycetidae Sordariomycetes 56 Lewia infectoria Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 57 Mycosphaerella Mycosphaerellaceae Capnodiales Dothideomycetidae Dothideomycetes 58 coffeicola Mycosphaerellaceae Mycosphaerellaceae Capnodiales Dothideomycetidae Dothideomycetes 59 sp. Nigrospora Incertae sedis Trichosphaeriales Incertae sedis Sordariomycetes 60 oryzae Nigrospora sp. Incertae sedis Trichosphaeriales Incertae sedis Sordariomycetes 61 Nigrospora Incertae sedis Trichosphaeriales Incertae sedis Sordariomycetes 62 sphaerica Paecilomyces sp. Trichocomaceae Eurotiales Eurotiomycetidae Eurotiomycetes 63 Penicillium Trichocomaceae Eurotiales Eurotiomycetidae Eurotiomycetes 64 citrinum Retroconis sp. Incertae sedis Incertae sedis Incertae sedis Incertae sedis 65 Rhizopycnis sp. Incertae sedis Incertae sedis Incertae sedis Dothideomycetes 66 Schizothecium Lasiosphaeriaceae Sordariales Sordariomycetidae Sordariomycetes 67 inaequale Stagonospora sp. Phaeosphaeriaceae Pleosporales Pleosporomycetidae Dothideomycetes 68 Stemphylium Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 69 lancipes Thielavia Chaetomiaceae Sordariales Sordariomycetidae Sordariomycetes 70 hyrcaniae Thielavia sp. Chaetomiaceae Sordariales Sordariomycetidae Sordariomycetes 71 Ulocladium Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 72 chartarum Verticillium sp. Plectosphaerellaceae Incertae sedis Hypocreomycetidae Sordariomycetes 73 Beauveria Cordycipitaceae Hypocreales Hypocreomycetidae Sordariomycetes 74 bassiana Aspergillus Trichocomaceae Eurotiales Eurotiomycetidae Eurotiomycetes 75 parasiticus Lecanicillium Cordycipitaceae Hypocreales Hypocreomycetidae Sordariomycetes 76 lecanii Paecilomyces Trichocomaceae Eurotiales Eurotiomycetidae Eurotiomycetes 77 lilacinus
(63) TABLE 1 List of endophytes:
(64) Acremonium alternatum, Alternaria alternata, Ahernaria brassicae, Alternaria compacta, Alternaria dianthi, Alternaria longipes, Ahernaria mali, Ahernaria sesami, Alternaria solani, Alternaria sp., Alternaria tenuissima, Ascomycota sp. Bipolaris spicifera, Cercospora canescens, Cercospora capsici, Cercospora kikuchii, Cercospora zinnia, Chaetomium globosum, Chaetomium piluliferum, Chaetomium sp., Cladosporium cladosporioides, Cladosporium sp., Cladosporium uredinicola, Cochliobolus sp, Phanerochaete crassa, Phoma americana, Phorna subherbarum, Phomopsis liquidambari, Phomopsis sp., Pleospora sp., Pleosporaceae sp., Polyporales sp., Preussia africana, Preussia sp., Pseudozyma sp., Pyrenophora teres, Colletotrichumcapsici, Coniolariella gamsii, Coniothyrium aleuritis, Coniothyrium sp., Corynespora cassiicola, Diaporthe sp., Diatrype sp., Drechslerella dactyloides, Embellisia indefessa, Epicoccum nigrum, Epicoccum sp., Exserohilum rostratum, Fusarium chlamydosporum, Eusarium sp., Gibellulopsis nigrescens, Gnomoniopsis sp., Lewia injectoria, Mycosphaerella cojffeicola, Mycosphaerellaceae sp., Nigrospora oryzae, Nigrospora sp., Nigrospora sphaerica, Paecilomyces sp., Penicillium citrinum, Reiroconis sp., Rhizopycnis sp., Schizothecium inaequale, Stagonospora sp., Stemphylium kancipes, Thielavia hyrcaniae, Thielavia sp., Ulocladium chartarum, Verticillium sp., Beauveria bassiana, Aspergillus parasiticus, Lecanicillium lecanii, Paecilomyces lilacinus.
(65) Beauveria bassiana was cultured from a commercially obtained strain (available from Botanigard). Beauveria bassiana, Paecilomyces lilacinus, and Chaetomium globosum were cultured on potato dextrose agar media (PDA). Stock spore concentration solutions of each fungi were made by adding 10 ml of sterile water to the fungi plates and scraping them free of the agar with a sterile scalpel. The resulting mycelia and spores obtained were then filtered into a sterile beaker utilizing a cheese cloth to filter out the mycelia, thereby creating stock solutions. A haemocytometer was used to measure and calculate spore concentrations of the stock solutions. The desired concentrations were created by dilution, and seeds were placed into spore suspensions with the desired spore concentrations. In various embodiments, the final treatment concentrations can be about 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, or 10.sup.9 spores/ml which can be reached by serial dilutions in sterile water or in an appropriate solution or buffer.
(66) For seed inoculation, the seeds were surface sterilized prior to soaking them in spore suspensions with the desired concentration by immersion the seeds in 70% ethanol for 3 minutes with constant shaking followed by incubation in 2% NaOCl for 3 minutes; followed by three washes in sterile water. The third sterile water wash was plated onto potato dextrose agar media (PDA) to confirm that surface sterilization was effective. Seeds were then soaked for 24 hours in beakers containing spore suspensions with two different concentrations of fungi. Control group seeds were treated with sterile water only. Spore concentrations for Beauveria bassiana were zero (control), 110.sup.6 (treatment 1) and 110.sup.9 (treatment 2) and for Paecilomyces lilacinus or Chaetomium globosum were zero (control), 110.sup.6 (treatment 1) and 110.sup.7 (treatment 2). These beakers were incubated for 24 hours at 32 C. in a culture chamber until next day for planting (24 hr).
(67) Soaked seeds were planted in L22 mix soil (Borlaug Institute, Texas A&M). All plants were grown in a laboratory greenhouse at 28 C. with a natural light photoperiod. There was no fertilization of the plants, and watering was done consistently across all treatments as needed.
(68) Direct seed inoculation: In particular embodiments, individual seeds and the surrounding soil can be directly inoculated with the spore solution (10.sup.2-10.sup.3, 10.sup.3-10.sup.4, 10.sup.4-10.sup.5, 10.sup.6-10.sup.7, or 10.sup.7-10.sup.8 spores/ml) at planting before covering the seed with soil.
(69) In various embodiments, any seed or plant treatments that are suitable for application of biological agents to seeds or plants and known to persons having ordinary skill in the art can be employed.
Example 2: Application of Endophyte Spores as a Dry Powder Composition
(70) In addition to application of a spore solution for seed treatment, the endophytes or endophyte spores can also be applied as dry powder or using a sicker such as methyl cellulose for seed treatment. In certain embodiments, the concentration may be at least 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, or higher colony forming units or spores/g dry weight.
(71) In certain embodiments, endophytes can be grown in fungi cultivation media in a fermenter. Endophytic mycelial fragments or spores can be collected, dried and ground. A sticker such as caboxymethyl cellulose may also be added to the ground endophytic material.
(72) In certain embodiments the weight ratio between endophytic material and sticker may be between 1:10-50, 1:50-100, 1:100-500, or 1:500-1000 to obtain the seed coating or seed inoculation material. This seed inoculation material can be applied to seeds. In various embodiments, the weight ratio between seed inoculation material and seed may be 1:10-50, 1:50-100, 1:100-500, 1:500-1000, or 1:1000-5000.
Example 3: Soil (in Furrow) Endophyte Treatments
(73) Soil drench (in furrow) application may be performed by applying an endophyte composition to the surface of the soil and/or seed during planting. In particular embodiments, the endophyte composition may comprise an endophyte suspension or an endophyte dry powder formulation. In various embodiments the endophyte may comprise mycelia and/or spores. In particular embodiments, the soil drench application may comprise applying the endophyte composition to the surface of the soil directly above each seed. In certain embodiments, the endophyte composition may comprise 0.01-0.1, 0.1-1, or 1-10 ml endophyte suspension, which may be a endophyte spore suspension.
(74) Soil inoculation: In certain embodiments, seeds can be planted into inoculated soil. The inoculum can be obtained by multiplying the endophyte on fungal growth media. The fungal growth media can be potato dextrose agar media (PDA). In other embodiments the fungal growth media can be as wheat grain. In a non-limiting example, 100 g of wheat grain can be washed and soaked overnight in sterile water. Excess water can be drained, seeds dried on paper towel, packed in a 500 ml conical flask and autoclaved at 15 psi for 1 h. One milliliter of the endophytic fungal spore suspension (10.sup.7 spores/ml) can be inoculated to the flask, and the cultures can be incubated at 25 C. for 2 weeks. To avoid clumping, the flasks can be shaken vigorously to separate the grain and break the mycelial mat. Approximately 5 g of inoculum can be placed in soil at planting. In certain embodiments, the inoculum can be placed in the soil at the same time or within 1 month of planting the seeds. In certain embodiments, the seeds may comprise sterilized seeds.
Example 4: Foliar Endophyte Treatments
(75) Plants were inoculated via foliar application at the third true leaf stage by spraying the surface of fully expanded leaves to run-off with a spore suspension (10.sup.8 spores/ml) using a hand-held plastic sprayer (1 L). In certain embodiments, endophyte spore suspensions were made in water. In certain embodiments, the water was supplemented with a detergent. In a particular non-limiting example, the spore suspension contained 0.02% Triton X 100 as a detergent.
(76) Foliar endophyte treatment may be performed using any suitable method known to a person having ordinary skill in the art. In particular, foliar endophyte treatment may be performed using a sprayer by directly spraying leaves with an endophyte suspension, which may be a endophyte spore suspension.
(77)
Example 5: Confirmation of Plant Colonization by Endophytic Fungi
(78) Plants were individually placed in plastic bags, which were labeled with plant number, treatment, and final aphid number, and stored in 4 C. until the next day for endophyte confirmation. Half of each plant was utilized for plating on PDA agar and the other half was freeze-dried for to conduct diagnostic PCR assays for endophyte confirmation. The surface sterilization protocol and plating of third sterile water wash on PDA to test for surface contamination was conducted as described above. For diagnostic PCR assays, plant tissue was freeze-dried and DNA was extracted utilizing the CTAB protocol (Doyle & Doyle, 1987, Phytochemistry Bulletin 19:11-15). The oligonucleotide primer sequences synthesized were based upon a NCBI BLAST search corresponding to the laboratory culture sequence results isolated (Ek-Ramos et al., 2013). Sense and antisense oligonucleotide sequences for Beauveria bassiana were: 5-CGGCGGACTCGCCCCAGCCCG-3 (SEQ ID NO:1) and 5-CCGCGTCGGGGTTCCGGTGCG-3 (SEQ ID NO:2) respectively. The oligonucleotides used to amplify Paecelomyces lilacinus were: 5 CTCAGTTGCCTCGGCGGGAA 3 (SEQ ID NO:3) and 5 GTGCAACTCAGAGAAGAAATTCCG 3 (SEQ ID NO:4).
(79) The PCR protocol consisted of a denaturation step at 95 C. for 5 min, followed by alignment of oligonucleotides at 56 C. for 2 min and an extension step of 7 min at 72 C. with a total of 35 cycles. The PCR products were visualized in a 2% agarose gel containing 1% ethidium bromide. Electrophoresis was performed at 70 volts for 30 min.
Example 6: Endophytic Fungi can be Manipulated in the Field
(80) A field trial using isolates of Paecilomyces lilacinus and Beauveria bassiana was conducted during the summer. A randomized block design with five replicate plots that were planted with seeds that were inoculated by soaking for 9 hr in three different aqueous spore concentrations (0, 10.sup.6, or 10.sup.8 spores/ml) of the candidate endophyte (such as Paecilomyces lilacinus or Beauveria bassiana). Each plot consisted of four 15.24 m (40 ft) rows, each separated by 101.6 cm (40 in).
(81) Colonization efficiency: At the first true leaf stage, four plants from each plot for a total of 20 plants per treatment were randomly sampled and tested for colonization by each of the candidate endophytes. Colonization frequencies were determined by incubating surface sterilized root, stem and leaf fragments on PDA media and observing for fungal growth. Colonization frequencies are reported as the number of plants per treatment group with at least one positively colonized plant fragment.
(82) The high endophytic colonization frequency of seedlings by Paecilomyces lilacinus or Beauveria bassiana demonstrates that the presence of specific endophytes can be manipulated under field planting conditions (
Example 7: Cotton Aphid Reproduction Test
(83) A colony of A. gossypii was reared on cotton in cages in a greenhouse kept at approximately 28 C. with natural light photoperiod. Second instar nymphs were placed directly onto endophyte-treated cotton plants and control plants. Ten plants were utilized per treatment group and ten aphids were placed per plant. After plants were inoculated with the aphids, the plants were placed in individual plastic 4520 cm cups and sealed with no-see-um mesh (Eastex products, NJ) to avoid aphid movement from plant to plant. In one embodiment, the plants used were 13 days old, approximately in the first true leaf stage, and aphids were left to reproduce for seven days under greenhouse conditions. In another embodiment, aphids were left to reproduce for 14 days on plants initially 20 days old at the beginning of the experiment, approximately in the third true leaf stage. At the end of each embodiment, aphid numbers were counted and recorded per individual plant. The presence of Beauveria bassiana or Paecilomyces lilacinus as an endophyte in cotton significantly reduced the reproduction of cotton aphids on endophyte treated plants versus untreated control plants (
Example 8: Fungal Endophytes Reduce Nematode Reproduction
(84) Plants were germinated from treated and untreated control seeds in an environment chamber and then transplanted to soil in pots 11 days after planting. Two replicate seedlings per treatment were sampled to examine the endophyte colonization efficiency by surface sterilization and plating on PDA agar. Nematode treatment group seedlings were treated with either 2,000 or 10,000 eggs/plant at day six after transplanting. Plants were harvested and processed 6 weeks after nematode inoculation. The numbers of galls per gram of root tissue and total egg numbers in the population for each plant were quantified to compare nematode performance between endophyte-treated and untreated (control) plants.
(85)
Example 9: Effect of Fungal Endophytes on Insects
(86) Endophyte-treated and control plants were grown from non-transgenic cotton seeds (Gossypium hirsutum)(variety LA122, AllTex Seed Co.). Seeds were soaked for 24 hours in beakers containing 10.sup.8 spores/ml solutions of the fungi utilized plus sterile water-only as a control. The beakers were placed in a 32 C. culture chamber overnight (approx. 9 h) until planting the next day. The plants were grown under both greenhouse and field conditions. Greenhouse plants were first germinated in seedling trays and then transferred to 30 cm pots. Field grown plants were concurrently planted and grown.
(87) Behavioral assays: No-choice and choice behavioral assays were conducted to compare the response of western tarnished plant bugs (L. hesperus) and green stink bugs (N. viridula) to squares and bolls from endophyte-treated and untreated plants. The assays were conducted at 30 C. in 10 cm diameter petri dishes with a thin layer of 2% agar on the bottom to provide moisture for the squares (L. hesperus assays) and bolls (N. viridula assays) from experimental plants offered to the insects during the observations. For no-choice assays, a single square or boll was inserted by the base into the agar in the center of the dish. A single young adult (1-7 days post molt) insect was placed in each dish and covered with the top. A total of 30 insects were observed in each trial with N=10 insects each in the Beauveria bassiana, Paecilomyces lilacinus and control treatment groups. The L. hesperus no-choice trials were replicated four times (N=40 per treatment) with squares from greenhouse grown plants used in all but one trial. The N. viridula no-choice trials were replicated three times (N=20 per treatment) with bolls from greenhouse grown plants used in one trial.
(88) Choice tests were conducted under the similar conditions using the same arenas, but with two equal sized squares (L. hesperus) or bolls (N. viridula) placed 4 cm apart in the center of the petri dish. The two squares or bolls per arena were from an untreated control plant and either a Beauveria bassiana or Paecilomyces lilacinus treated plant. A total of 20 insects were observed in each trial, with N=10 each in the Beauveria bassiana vs. control and Paecilomyces lilacinus vs. control treatment groups. The L. hesperus and N. viridula choice trials were both replicated twice (N=20 per treatment) with squares from field-grown plants in all trials.
(89) Insects were observed for 6 hours per trial using a point sampling procedure for both the no-choice and choice assays. Preliminary observations indicated that the insects of both species were more active at the beginning of the assay, thus staged sampling schedule was adopted with observations recorded at 5 minute intervals early in the assay (0-60 min), 15 minute intervals in the middle (61-180 min) and 30 minute intervals late (181-360 min) in the assay. At each sampling interval, the insects were recorded as either off the square/boll or feeding or roosting upon the square/boll.
(90) Data analysis: In the no-choice assays, the proportion of insects observed either feeding or resting upon cotton squares (L. hesperus) or bolls (N. viridula) was compared between treatment groups at each observation point across the duration of the assay using the Wilcoxon Signed Ranks Test. To test for variation in responses over time, for each individual the proportion of observations either feeding or upon the plant sample was calculated for early (0-60 min), middle (61-180 min) and late (181-360 min) periods of the assay and compared across treatment groups using a repeated measures analysis of variance (ANOVA) with the endophyte treatment group as the main factor and time as the repeat effect. The observed frequency of individuals failing to make contact with squares or bolls from endophyte-treated plants was compared to the expected frequency of individuals failing to do so based on the control group using a X2 test. Among the insects that did make contact with either a square or boll, the time to first contact (latency) was compared among treatment groups using a one-way ANOVA. All analyses including tests of normality and homogeneity of variances were conducted in SPSS 21 (SPSS Inc.).
(91) Results of the L. hesperus no-choice assays: Over the duration of the assay, a significantly higher proportion of L. hesperus individuals over time was observed in contact with and feeding upon squares from untreated control plants relative to those from either of the Beauveria bassiana or Paecilomyces lilacinus endophyte treatment groups (Wilcoxon Signed Ranks test, P<0.0001 for both comparisons) (
(92) Results of the L. hesperus choice assays: In simultaneous choice tests, L. hesperus individuals selected squares from untreated control plants more often than those from endophyte-treated plants. Response ratios were significantly greater than 0.5 over the duration of the assays, indicating that the insects non-randomly selected bolls from control plants over bolls from plants endophytically colonized by either (A) Beauveria bassiana (P<0.0001; Wilcoxon Signed Ranks test) or (B) Paecilomyces lilacinus (P<0.0001; Wilcoxon Signed Ranks test)(
(93) Results of the N. viridula no-choice assays: Over the duration of the assay, a significantly higher proportion of N. viridula individuals over time was observed in contact with and feeding upon bolls from untreated control plants relative to those from either of the Beauveria bassiana or Paecilomyces lilacinus endophyte treatment groups (Wilcoxon Signed Ranks test, P<0.0001 for both comparisons)(
Example 10: More Bolls are Retained after Endophyte Treatment
(94) During the field trial, cotton phenology and development was quantified using a plant mapping and information system developed specifically for cotton to track fruit development and retention by the plant as a means of monitoring plant development and stress (COTMAN, Cotton Inc.). One measure of cotton stress is the retention of developing flowers (squares) and fruits (bolls) in the first fruiting position on branches. First position squares and bolls were measured on 5 plants per row in two rows in each of the five replicate plots (N=10 plants per plot) for each treatment group.
(95)
(96)
Example 11: Endophyte Treatment Increases Yield
(97) At the end of the field trial employing endophyte treatment and treatment plants, plots were machine harvested with a 1-row picker. Surprisingly, the final yields at harvest were significantly higher than expected (25% higher than the untreated controls). Unexpectedly, treatment with Paecilomyces lilacinus or Beauveria bassiana resulted in higher yields than untreated control plants with regardless of the initial seed treatment concentration. (
Example 12: Endophyte Treatment of Sorghum Increased Growth in the Greenhouse
(98) The effect of the described microbial compositions on sorghum was tested in a seedling assay. Sorghum bicolor seeds were surface sterilized using ethanol and bleach as described in Example 1 for cotton. Three strains (B. bassiana, P. fumosoroseus, and P. lilacinus) were prepared as conidia suspensions at 10.sup.7 conidia/ml, and coated on the sorghum seeds as described in Example 1. Control seeds were soaked in sterile water instead of a conidia suspension. Planted seeds were held in constant growth chamber conditions for two weeks at a replication of 10. At the end of two weeks, the plants were removed from the growth chamber and the plant height and biomass were measured.
Example 13: Treatment with Fungal Endophytes Modulates the Colonization Frequencies of Native Endophytes
(99) To determine whether endophyte seed treatments could alter the microbiome of the plant grown from the seed, cotton seeds were treated with spore suspensions of Paecilomyces lilacinus or Beauveria bassiana. Plants were grown in the field as part of a field trial planted and maintained under standard agricultural practices. Endophytic fungi were isolated on PDA media separately from surface-sterilized above-ground stem/leaf and below-ground root tissue to assess changes in the microbial community. The comparison shown in
(100) Fungal endophyte treatments may alter the colonization frequencies of any of the fungal endophytes naturally present in plants. To determine what other native endophytes may be affected by seed treatments with fungal endophytes, the identity of cotton fungal endophytes isolated from plants of two commercial cotton varieties, CG3787B2RF and PHY499WRF, were assessed. The samples were obtained during a variety trial near Lubbock, Tex., USA identified as Lubbock-RACE. One single healthy leaf was collected from each of nine individual plants sampled per variety across multiple replicate plots arranged in a randomized block design to control for spatial variation in the field. To identify the fungal endophyte species, whole genomic DNA was extracted and the ribosomal DNA internal transcribed spacer (ITS) region was amplified as a barcode for 454 pyrosequencing using ITS1F forward and ITS2 reverse universal fusion primers. The fungal endophytes identified in this experiment, along with those shown in
(101) TABLE-US-00002 TABLE 2 Native fungal endophytes that may be altered by seed treatments with other fungal endophytes Phylum Class Order Family Genus species Ascomycota Leotiomycetes Leotiomycetes Geomyces auratus Dothideomycetes Botryosphaeriales Botryosphaeriaceae Macrophomina sp. Dothideomycetes Capnodiales Davidiellaceae Dothideomycetes Capnodiales Davidiellaceae Cladosporium sp. Dothideomycetes Capnodiales Davidiellaceae Cladosporium cladosporioides Dothideomycetes Capnodiales Davidiellaceae Davidiella sp. Dothideomycetes Capnodiales Mycosphaerellaceae Cercospora sp. Dothideomycetes Capnodiales Mycosphaerellaceae Cercospora beticola Dothideomycetes Pleosporales Dothideomycetes Pleosporales Pleosporaceae Dothideomycetes Pleosporales Pleosporaceae Alternaria sp. Dothideomycetes Pleosporales Pleosporaceae Alternaria alternata Dothideomycetes Pleosporales Pleosporaceae Alternaria citri Dothideomycetes Pleosporales Pleosporaceae Alternaria porri Dothideomycetes Pleosporales Pleosporaceae Alternaria tenuissima Dothideomycetes Pleosporales Pleosporaceae Cochliobolus sp. Dothideomycetes Pleosporales Pleosporaceae Curvularia sp. Dothideomycetes Pleosporales Pleosporaceae Epicoccum sp. Dothideomycetes Pleosporales Pleosporaceae Exserohilum sp. Dothideomycetes Pleosporales Pleosporaceae Lewia sp. Dothideomycetes Pleosporales Pleosporaceae Lewia infectoria Dothideomycetes Pleosporales Pleosporaceae Pyrenophora sp. Dothideomycetes Pleosporales Pleosporaceae Pyrenophora tritici-repentis Dothideomycetes Pleosporales Pleosporaceae Pleospora sp. Dothideomycetes Pleosporales Didymellaceae Phoma americana Dothideomycetes Pleosporales Sporormiaceae Preussia africana Eurotiomycetes Chaetothyriales Eurotiomycetes Chaetothyriales Chaetothyriaceae Eurotiomycetes Eurotiales Trichocomaceae Eurotiomycetes Eurotiales Trichocomaceae Aspergillus sp. Eurotiomycetes Eurotiales Trichocomaceae Penicillium sp. Eurotiomycetes Eurotiales Trichocomaceae Thermomyces sp. Eurotiomycetes Eurotiales Trichocomaceae Thermomyces lanuginosus Saccharomycetes Saccharomycetales Saccharomycetes Saccharomycetales Saccharomycetaceae Saccharomycetes Saccharomycetales Saccharomycetaceae Candida sp. Saccharomycetes Saccharomycetales Saccharomycetaceae Candida quercitrusa Saccharomycetes Saccharomycetales Saccharomycetaceae Candida tropicalis Saccharomycetes Saccharomycetales Saccharomycetaceae Cyberlindnera sp. Saccharomycetes Saccharomycetales Saccharomycetaceae Cyberlindnera jadinii Saccharomycetes Saccharomycetales Saccharomycetaceae Kluyveromyces sp. Saccharomycetes Saccharomycetales Saccharomycetaceae Kluyveromyces marxianus Sordariomycetes Sordariomycetes Diaporthales Gnomoniaceae Gnomoniopsis sp. Sordariomycetes Hypocreales Cordycipitaceae Beauveria bassiana Sordariomycetes Hypocreales Cordycipitaceae Cordyceps sp. Sordariomycetes Hypocreales Cordycipitaceae Cordyceps bassiana Sordariomycetes Hypocreales Nectriaceae Sordariomycetes Hypocreales Nectriaceae Fusarium sp. Sordariomycetes Hypocreales Hypocreaceae Sordariomycetes Hypocreales Hypocreaceae Gibellulopsis nigrescens Sordariomycetes Hypocreales Hypocreaceae Hypocrea sp. Sordariomycetes Hypocreales Hypocreaceae Hypocrea lixii Sordariomycetes Hypocreales Hypocreaceae Hypocrea virens Sordariomycetes Hypocreales Hypocreaceae Trichoderma sp. Sordariomycetes Hypocreales Hypocreaceae Trichoderma tomentosum Sordariomycetes Hypocreales Plectosphaerellaceae Verticillium sp. Sordariomycetes Ophiostomatales Ophiostomataceae Sordariomycetes Ophiostomatales Ophiostomataceae Ophiostoma sp. Sordariomycetes Ophiostomatales Ophiostomataceae Ophiostoma dendifundum Sordariomycetes Sordariales Chaetomiaceae Chaetomium sp. Sordariomycetes Sordariales Chaetomiaceae Chaetomium globosum Sordariomycetes Sordariales Chaetomiaceae Thielavia hyrcaniae Sordariomycetes Sordariales Chaetomiaceae Taifanglania sp. Sordariomycetes Sordariales Chaetomiaceae Taifanglania inflata Sordariomycetes Sordariales Lasiosphaeriaceae Schizothecium inaequale Sordariomycetes Trichosphaeriales Trichosphaeriaceae Nigrospora sp. Sordariomycetes Xylariales Amphisphaeriaceae Truncatella angustata Basidiomycota Agaricomycetes Cantharellales Ceratobasidiaceae Rhizoctonia sp. Agaricomycetes Corticiales Corticiaceae Agaricomycetes Corticiales Corticiaceae Phanerochaete sp Agaricomycetes Polyporales Coriolaceae Agaricomycetes Polyporales Coriolaceae Trametes sp. Agaricomycetes Polyporales Coriolaceae Trametes hirsuta Agaricomycetes Polyporales Coriolaceae Trametes villosa Agaricomycetes Russulales Peniophoraceae Microbotryomycetes Sporidiobolales Microbotryomycetes Sporidiobolales Sporidiobolaceae Rhodotorula sp. Microbotryomycetes Sporidiobolales Sporidiobolaceae Rhodotorula mucilaginosa Tremellomycetes Tremellomycetes Tremellales Tremellomycetes Tremellales Tremellaceae Cryptococcus sp Tremellomycetes Tremellales Tremellaceae Cryptococcus skinneri Tremellomycetes Tremellales Tremellaceae Tremella sp.
Example 14: Fungal Endophyte Seed Treatment Leads to Modulation of Phytohormone Levels in Plants Grown from the Seed
(102) To determine whether fungal endophyte seed treatment affects phytohormone levels in plants grown from the seed, tissue was harvested from the root or third true leaf of cotton plants inoculated with either endophytic Beauveria bassiana or Paecilomyces lilacinus. The experiment was done with three endophyte treatments (uncolonized control, B. bassiana or P. lilacinus) and, for Beauveria bassiana, two herbivory treatments (no aphids, or aphid herbivory for either 1, 4, 8, 24 or 48 hours). Phytohormone levels for abscisic acid (ABA), tuberonic acid (12-OH-JA, an oxidation product of JA-Ile) (TA), ascorbic acid (AA), 12-Oxophytodienoic acid (a JA precursor) (OPDA), JA isoleucine (JA-Ile), and salicylic acid (SA) were assessed by LC-MS in leaf and root tissues separately. All phytohormone level comparisons were made versus plants in the uncolonized control group with significance at P<0.05. Phytohormone levels in plants grown from seed treated with Beauveria bassiana are shown in Table 3, and phytohormone levels in plants grown from seed treated with Paecilomyces lilacinus are shown in Table 4.
(103) TABLE-US-00003 TABLE 3 Phytohormone levels in plants grown from seed treated with Beauveria bassiana Herbivory Phytohormone Tissue Upregulated/downregulated Tissue Upregulated/downregulated Yes ABA Leaves Down at 8 hours of feeding Roots Upregulated at 48 hrs of feeding No Not significant Upregulated Yes TA Leaves Not significant Roots Upreguated at 48 hrs of feeding No Not significant Not significant Yes AA Leaves Down at 4 hrs up at 24 hrs Roots Up at 8 hrs down at 48 hrs No Not significant Upregulated Yes OPDA Leaves Not significant Roots Up at 4 hrs and 8 hrs No Not significant Upregulated Yes JA-Ile Leaves Up at 48 hrs Roots Up at 48 hrs No Not significant Upregulated Yes SA Leaves Up at 1 hr, 8 hr, 24 and 48 hr Roots Down at 4 hr the rest n.s No Not significant Not significant
(104) TABLE-US-00004 TABLE 4 Phytohormone levels in plants grown from seed treated with Paecilomyces lilacinus Yes ABA Leaves Down at 48 hrs Roots Up at 1 hr and 8 hrs Yes TA Leaves down at 4 and 8 hrs Roots up at 4 hrs Yes AA Leaves down at 4 and 8 hrs Roots up at 4 hrs Yes OPDA Leaves down at 4 and 8 hrs Roots Up at 4 and 48 hrs, down at 24 hrs Yes JA-Ile Leaves Down at 8 and 48 hrs Roots Up at 4 and 24 hrs Yes SA Leaves Up at 1 and 4 hr, down at 8 hrs Roots Up at 1, down at 8 hrs
Example 15: Fungal Endophyte Seed Treatments Alter Traits in Certain Cotton Cultivars in Field Trials
(105) The 2014 field trials were executed in a similar fashion as described in Example 6. A field trial using isolates of listed below was conducted during the summer. Each plot consisted of four 15.24 m (40 ft) rows, each separated by 101.6 cm (40 in), and there were 6 replicate plots per treatment. Yield from plots treated with the described microbial compositions was compared relative to the untreated control plots. For thrips, this damage assessment was on a scale of 0-5; 0=no damage, 1=noticeable feeding scars, but no stunting, 2=noticeable feeding and 25% stunting, 3=feeding with blackened leaf terminals and 50% stunting, 4=severe feeding and 75% stunting, and 5=severe feeding and 90% stunting. For fleahoppers, the number of insects per plant were quantified and reported as an average for each plot.
(106) A number of other mid-season plant traits were also assessed in the field to determine the effect of the described fungal endophyte compositions.
(107) In
Example 16: Fungal Endophyte Seed Treatments Provide Drought Tolerance in Cotton Cultivars in Greenhouse Trials
(108) Cotton plants were germinated from endophyte-treated and untreated control seeds in the greenhouse. All seeds watered for 7 days or until cotyledon stage using pre-determined soil saturation volume of water per plant. At 7 DAP, water was withheld from water stressed plants while controls continued to be watered. Time to wilt and time to death were measured at a max of 21 DAP. The data in
Example 17: Identification of Fungal Endophytes with at Least 97% Identity to Those in Table 1
(109) All known fungal endophytes with 97% identity to SEQ ID NO:7 through SEQ ID NO:77 were identified and are listed here by accession number: FJ425672, AY526296, JQ760047, UDB014465, KC662098, HQ649874, JQ764783, EU881906, KF251285, JQ862870, AB019364, AB594796, JF773666, JN034678, KC343142, EU707899, AB627855, GU138704, JN695549, DQ279491, HM776417, AB361643, DQ782839, AF222826, EU682199, DQ782833, EU054429, FJ025275, AY354239, AF222828, GU721921, GU721920, DQ093715, AJ309335, FR774125, JQ747741, EF042603, KC968942, HE584924, AY740158, FJ645268, HQ692590, GQ203786, AY233867, HE579398, AB777497, KF435523, DQ420778, JQ649365, AJ271430, GQ996183, EF070423, FJ172277, AF483612, JX675127, EF070420, EF070421, AB741597, JN225408, DQ019364, KF251279, EF194151, EU977196, JX981477, EU686115, JX021531, FJ527863, AJ302451, AJ302455, JN975370, EU754952, AF284388, KF296855, AF502785, JX317207, AF502781, DQ278915, EU686867, KC179120, HM991270, AF284384, DQ632670, JQ759806, JQ747685, EU885302, GU721781, EF434047, EF505854, JQ666587, JQ619887, GQ919270, KF531831, AB627854, DQ914679, DQ914681, HQ599592, DQ279490, DQ660336, JX069862, AB607957, HE820869, FJ859345, JX966567, GU910230, AB627850, JX144030, DQ914723, HM595556, KC771473, DQ849310, EU179868, KF312152, JN890447, JX042854, EU554174, JN198518, HM992813, JQ845947, KF251310, JQ758707, AM930536, KF296912, JN865204, JN943512, GQ921743, EU245000, EU977304, EU144787, HE579322, HE579402, GU910171, HE792919, KC960885, DQ485941, JN604449, HQ607913, AF502620, DQ468027, JX944132, JN207338, JQ922240, JN207336, JX559559, JN207330, JN207333, HE820882, JX969625, HQ339994, JF744950, HE584937, JN120351, JX298885, DQ872671, AJ877102, JQ081564, DQ019391, AF071342, EF104180, JQ759755, GU827492, JN418769, GU324757, JX984750, JX256420, KF436271, JX205162, JN712450, KF435911, GU367905, JX416919, KC315933, JQ736648, AY904051, AF404126, FJ466722, HE584965, JN890282, HE584966, HQ166312, KC305124, HE977536, KC305128, AY907040, JF710504, AF483609, AJ302460, AJ302461, AJ302462, AY969615, EU685981, U75615, AJ302468, FJ210503, GU237860, JX960591, JX143632, HM044649, EU164404, HE584824, HQ116406, DQ156342, JX416911, U75617, GU721359, KC427041, EU254839, JX262800, KC179307, HQ107993, KF361474, GU721420, HM053659, EF619702, EU686156, HE820839, HQ634617, GU721810, AB277211, AJ302417, KC315945, JQ002571, AM237457, AF009805, JX489795, EU680554, KC507199, FJ236723, HQ692618, JN846717, JX944160, JQ585672, KF435573, EU520590, HM581946, DQ250382, JX243908, KC343184, KC485454, GQ479695, GU237760, KF147147, EF619849, GU237767, GU237766, AB818997, AF502847, EU683672, KF225801, KC965743, AJ488254, DQ825983, JN031007, DQ825985, KF028765, AB818999, HQ238268, EU685984, KC966180, HE998711, HQ533007, AM113729, KF251637, FN394692, KF435172, JN207307, JQ814305, HM770988, KC145175, AB511813, EU552102, AJ309344, EU645686, JQ936328, JN038492, DQ875349, EU977228 JQ814357, KF040480, JX317350, DQ401548, DQ318195, DQ318194, GU721776, KF193449, AF178544, AM262354, AB540567, AY627787, HE792907, HE579333, EU445372, AF362069, GU973687, HM053663, AB374284, DQ062977, GU237797, JQ760783, EF029240, HM751829, FM200445, AY953383, AY233922, JF742784, HM626650, FN610871, JX155902 JX006065, AB566289, AF163078, AY344976, AB566287, AF282089, AY251441, AF395693, JQ761899, AJ315835, HQ187633, KC287233, AJ315831, HE820745, JN418779, M13906, JQ761896, AJ315838, AY536373, HQ328035, JX838793, JQ758986, HQ166357, JN163855, KC965595, JN545789, JN545788, GU944558, HE579247, KF296900, EF377335, KC965954, GU269703, AB095511, EF419913, DQ993641, AB325678, HQ223035, AY513945, FJ197013, FR799277, HM071900, JN207293, FJ025268, JQ758966, GU138733, GU138730, DQ267595, GQ919269, JF770450, GU138734, DQ279488, DQ279486, DQ242472, EU164804, EF104177, GU366726, KF212243, DQ923534, GU079598, JX987761, JX984765, AY585343, JQ769260, GU721919, DQ923538, EU686756, EU040222, U75626, GU004264, EU686753, JQ765651, JX270629, JN943408, EF042604, AJ271588, HE579386, GQ479556, JQ759962, JX317413, EU516867, DQ780361, JQ905644, HQ649792, JQ247355, FN386296, AY004778, DQ102374, KF251383, GU237835, DQ383642, FN868479, GU237814, KC343032, JN943394, HQ450001, KC800573, AB217793, GQ851883, EU330630, JF309198, AY489281, GU325687, JX399008, AB164703, EF159407, AJ302429, UDB008141, UDB008140, FM200496, AJ302426, AJ302422, AJ302423, JQ683725, KF193481, JQ683727, HE792931, AB220252, FJ013057, DQ286207, JQ759811, JF414842, JX088707, JN415754, AY787715, JX559577, KC776206, GU166440, KC460867, FJ515595, KF056850, DQ118964, KC806227, KC631802, EU823315, AY528970, HQ116401, JX317516, KF251313, KC800565, AF502705, AF502810, M747697, AY527407, EU680518, AJ621773, AB374285, HQ832827, GU174316, DQ974750, JN198507, JF749806, JQ782739, HQ023202, AY616234, KC965315, AB743781, EU554161, KC507201, HM036624, EF464164, JX391942, AB743995, FJ415474, AY647237, KC965503, AB540553, HQ377280, JX898571, JN969419, DQ166962, HM123519, GU237881, A B683953, AY681487, EU498738, EU687037, AB540550, EF394866, AY853245, EU680532, HQ450006, AM292674, KF435452, AF502638, JN890354, JX256427, JF773646, KC916704, FJ347031, JN572154, AF443850, AY273300, JQ247392, JQ247393, HQ316569, GU324760, AB120858, JF440978, HQ115719, JF440976, DQ124120, HQ022342, AF333138, AB255293, GQ999456, DQ286209, HE820785, AF451751, JN038479, JQ044421, JQ044422, KC968911, KC492447, FM172902, AF437754, HM030631, HM595545, AY510424, JX414184, HQ184179, AB588822, JQ813816, JQ813817, FJ025255, AY745019, EU668292, HM216214, AF427105, EU479799, JQ769257, HM484866, EU301059, EU564808, AY265329, HQ701737, KC677889, AY907030, GU721349, AY304513, GU062277, AY907037, HM484859, AB576865, JX090109, UDB004179, JN692542, JQ327868, AY756490, JN890185, JX042994, FJ613832, AF009815, HQ332534, AF009816, EU686781, DQ520639, KC247154, HE820841, HE820847, JN717228, JX944174, GU721348, AB444657, KF435560, JQ585546, JQ775577, UDB004443, JF744968, KF192823, JN102440, AM504058, JX164074, GU907781, HQ889707, FJ612980, KF251355, AF502854, AF350291, HQ649989, GU966521, FJ481149, AY916491, AB444663, FR799197, KC691458, HE820786, JN802324, AF149926, AY372686, AY233908, HQ631033, UDB004677, KF251596, EU479757, GU079602, KC691456, DQ420883, DQ914680, DQ914683, KC305134, JN207313, AB512307, JN807326, GQ395365, JN207256, FJ425678, AB000932, JN207252, KF293814, GU138728, AY160210, UDB015006, KC565735, FJ524302, AF404127, EU272486, JF796251, JF439458, AY304511, KC592278, JX143583, JF440977, EU686925, JX982370, EU687082, JX966607, GU222370, JN687988, JN006771, JX436806, JQ936201, KF481950, AF178551, KC181937, JX144778, DQ790541, JF796076, JX898576, JX418352, AF097902, FJ411320, AF309617, FR863589, HM469970, AF163069, KF582795, AB566293, HE820790, GQ267191, JX130356, JN049828, HM060596, KF436001, GQ919283, HQ832834, JN049822, EU041786, AB594789, HE579259, HE584944, GU004268, GU237770, GQ921765, HE579253, KC305158, AF043599, GQ267190, AY344968, JN601031, JN969420, GU328624, AB540507, AM691002, JN102384, EU480019, JN545815, DQ993651, JX130360, JX398990, AY969704, KF251559, AF395695, HQ449993, U94714, KF435968, JX966550, AB859762, JF749808, U94713, GU981750, AF177152, FJ430599, JQ647433, GU981756, GU981757, EF104164, JN802311, GQ266146, HQ445083, JX155909, KF436256, DQ318204, GU078649, JN890115, DQ386141, GQ999487, EU686744, FJ426983, UDB013022, FN435799, EF600976, HM596012, JF825143, AM711381, EU816668, AJ972833, JQ905735, AF004686, EU266103, EU266107, HQ166334, EF679384, UDB004580, AM691001, JX399012, KC460880, JX982437, AB482221, AM292048, KF251253, AF350308, JF502446, JQ905803, KC179320, KF251393, GU053815, DQ323686, DQ323681, KC343119, HE820747, KF251529, DQ676536, U17215, DQ278919, EU489950, FR668016, GU903287, AJ302439, AJ302438, AJ302435, AJ302434, JN807325, AB741584, KC790941, DQ394387, FJ403513, GQ461566, KF193491, KC305164, AF502895, GU237707, EU977520, AB247177, AB482220, AY929321, GU004278, AB247171, GU461294, GU461295, JX123570, AY684241, EU686968, JX944143, JN871718, JQ796813, HQ829122, KF435590, KC806231, JX414183, GU944858, AF502733, JN662314, HQ022970, AY510418, KC623569, KC216145, KF129059, DQ279515, KF251526, JN192379, JN192376, HM140630, DQ006928, AF011289, EU089663, FJ825373, DQ307292, JN890424, KF155521, AB670714, GQ927271, AB670717, AB670711, AB670713, KF435279, GU053814, KF435375, JX414188, AF033422, GU225946, EU520610, JF773645, KC595884, KC965570, DQ812921, EU885299, DQ078757, FJ612618, KF018920, JX077035, EU686911, JX270567, HE579352, EU885297, FJ418185, DQ914724, HQ608112, HQ450016, GU174399, JN890327, HM999913, GU079580, HE584936, JQ765675, GU726947, JQ765670, HM588120, AY969986, JN120335, JQ247384, HQ891112 JQ769297, JN207242, EU002888, EU479803, AY365468, AF163083, DQ534482, KC146356, KF436052, AF416460, JX537970, JX156018, AY907035, GQ241278, AF409972, JQ388941, FR668022, EU687151, DQ468026, AY251418, AB508842, AB508840, DQ233665, GU721949, AJ302444, JF927155, AJ302442, GU721976, AJ302440, KC790931, UDB004433, GU328539, EU479791, HQ649905, KC797566, JQ753968, GU721449, HQ701742, AY613410, GU062246, AY907045, HM991267, DQ979608, JQ781840, GU721442, EU426553, DQ980024, HQ634638, AF222836, GU222372, AY969338, EF104158, AY431101, JQ081415, FJ649318, AY152583, JN943058, EU885294, HQ231255, FJ179477, EU304350, KC005785, FR799224, EF070422, HQ533789, AJ289870, KF025952, HQ611347, DQ485934, KC989106, JQ081921, HE820871, AF404125, JN603182, KF436170, HQ832964, DQ185074, KC216108, JN102460, GU553324, DQ318207, HQ589260, AB819001, AY699669, EU812501, AB819004, HQ436065, KC013976, KF251204, KF435307, AF249905, EF029217, EF029216, FJ708614, EF029198, JQ517314, GU199416, HM180398, EU479748, GU721599, DQ185081, EF104175, JX021528, KF251430, AY611071, AY329221, JN207241, HM235963, JN890375, JF506092, KF193461, KF453551, HM123501, HM051074, AB255269, HQ904082, KF193500, FN562038, GU721911, EF417805, KF193504, KF028766, HE579312, EF433991, KF144910, KF144911, FM200450, AF163090, AB444665, AB444664, HQ649964, AB444666, AB444661, AY528998, DQ525492, KC870889, EF543844, GU073125, AY684240, JN163853, EU680538, AF395694, KC179102, KC778197, JN102425, DQ520638, EU244997, GU994552, DQ279527, KC179418, EF495164, AY999117, JX860441, JQ793663, DQ836775, EU479964, AY772736, AJ875343, KC013972, AJ875346, AY208785, HE614864, HF570009, KF435344, KC148376, EF641857, JX625368, AB512308, KC305146, AY266384, KC662096, HE579269, GU004277, GU004276, EF504668, EU687114, GU004272, GU004271, EU516731, KC213751, JN102394, HQ654776, JQ862729, EU687052, JX868653, FJ172294, JX130355, HE584891, FJ427063, GQ996174, FN252438, AJ633598, JX398987, EU245009, HM069466, FJ859344, JN942165, FJ785433, EF504592, HQ449989, HQ449988, JN120346, JX868648, EF600969, HQ529711, JN383815, KF003112, JN890192, GU981748, EU715654, EF535663, GU328634, UDB004320, GQ999475, FR731421, GU322457, EF550969, GU322450, FJ477838, KC305130, AJ247519, JQ026214, AJ972825, KC305135, EU520614, EU338415, JQ747670, EU040241, HE584979, KF477240, HM162095, AB746179, KC963934, AY906949, JN975339, EU520120, HM071902, JX399005, EU828350, JX399006, EF070418, FJ025231, EF070415, JN859327, JQ517292, JX399009, KF297004, JN618372, AY233888, EU784271, AM292673, EU514295, GQ921804, GU595027, HM008727, GU174426, JN673038, AF442801, EU686126, JF440982, EU754960, GQ154505, GU055711, FJ175159, KC354573, DQ993639, JQ621881, JN102454, AY177233, FJ013071, AY566992, GQ120971, EF408555, JX317505, AF524905, FJ887922, AF264905, AF264906, HM997113, EF619857, KC537805, KC537804, FJ887928, AB255303, HQ671302, FJ210537, FN386267, HQ649813, GU083033, KF251334, GU721297, KC181926, DQ832329, JQ781696, KF251233, KF251234, GQ505688, AJ437294, AJ437295, EF679363, HE820831, FN868450, GU174305, AY428866, AY956759, JQ759940, DQ489291, AJ271418, AY157952, EU784408, FJ427055, EF419900, FN813731, FJ427059, KF435462, JQ860113, KF209290, JF439437, KC565714, FJ228189, AF377282, JQ814364, HM991266, EF458676, AY762046, JN048884, HQ896484, HE579345, AB444659, EU076958, HQ402674, AF540504, AM922204, EU479758, JN943840, JN943841, FJ427025, KC584194, AF502754, FJ418192, KC343004, AB524806, AJ877224, DQ394377, FJ427028, AF282090, GQ927270, EU178738, DQ059579, EF535699, KF040479, AF163085, JX256429, AY999125, KF477238, KC513506, GQ999534, GU237837, EU002898, HM164732, AF443193, AJ315828, AJ315829, AY586560, JX868722, EU686847, DQ875350, DQ421277, AM176740, JX280875, AM691003, KF302463, GQ921786, KC965801, AM691004, EF452446, EU040235, KC662103, KC662102, AY251073, DQ993637, AY489282, FJ151434, JQ936199, EF505495, JN163856, JN659510, EF452449, EF504607.1, GQ516009.1, GQ508761.1, KC8008470.1, JX187590.1, GQ508832.1, KC800841.1, KC800840.1, EF504876.1, HQ540685.1, EF505180.1, AY842353.1, GU014821.1, FJ761203.1, GQ510033.1, EF504642.1, GU014822.1, AY998786.1, AB581046.1, EF452470.1, FJ907534.1, EF504721.1, Y08744.2, FJ757587.1, GU014820.1, AF400896.1, KC800831.1, EF505804.1, EF505121.1, JX187587.1, KC800858.1, GQ866210.1, GQ522120.1, Y10748.1, EF504853.1, EF452471.1, KJ834329.1, AB581446.1, JX187588.1, AF163061.1, AB632670.1, Y08746.1, EF505082.1, JX187589.1, EF504723.1, AF400889.1, KC800835.1, and EF505282.1.
Example 18: Endophytes and Combination Thereof
(110) The protocols as described in Examples 1-16 are used in connection with the endophytes of Table 1 to confirm beneficial properties on plant health, such as yield and/or past resistance, for example. In particular, endophytes from Table 1 are employed in a synthetic combination with a plant as described herein with crop plants, such as cotton. Any single or combination of endophytes listed in Table 1 can also be used in this manner, employing for example seed coatings or foliar, soil, or rhizosphere applications. A seed composition may comprise seeds and any combination of endophytes listed in Table 1. Endophytes listed in Table 1 or combinations thereof are thus employed in methods for preventing pest infestation, increased yield, treating a pest infestation, manufacturing pest-resistant seeds; or increasing a yield or reducing loss of a crop according to the methods of Examples 1-15.